Difference between revisions of "Chromosome VII History"
Line 1: | Line 1: | ||
+ | This page lists all sequence and annotation changes that have been made to the Chromosome VII systematic reference sequence since its intial release on 1996-07-31. | ||
+ | The sequence of Chromosome VII has been updated 125 times, affecting 87 features. | ||
+ | The annotation of Chromosome VII has been updated 54 times, affecting 88 features. | ||
+ | |||
=Sequence Changes= | =Sequence Changes= | ||
Revision as of 09:41, 27 September 2019
This page lists all sequence and annotation changes that have been made to the Chromosome VII systematic reference sequence since its intial release on 1996-07-31. The sequence of Chromosome VII has been updated 125 times, affecting 87 features. The annotation of Chromosome VII has been updated 54 times, affecting 88 features.
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YGR067C | 622408 | 622408 | Substitution | A | T |
A single nucleotide substitution was made in the stop codon of ORF YGR067C, destroying it and increasing the length of the annotated protein by 10 amino acids.
New 622362 TCTTTGGCCATTATTTTATTTGGCTAAAAATTTCAATGTTTTTACTTTGTTTATTGTCAG 622421 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 622366 TCTTTGGCCATTATTTTATTTGGCTAAAAATTTCAATGTTTTAACTTTGTTTATTGTCAG 622425 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YGL197W | 125909 | 125910 | Substitution | CG | GC |
125487 | 125487 | Insertion | A | |||
125495 | 125495 | Deletion | A | |||
Nucleotide changes within the coding region of MDS3/YGL197W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 262-264 are now QSE rather than HPK, and residue 403 is now Alanine rather than Arginine.
New 125449 TAGACATCTATAACATCTCACAGAATTGCTGGCAATCCGAAA-CCATACCCAAACAACCG 125507 |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| Old 125454 TAGACATCTATAACATCTCACAGAATTGCTGGCA-TCCGAAAACCATACCCAAACAACCG 125512 New 125868 ATATACGATATTAACTCCGGAAAGTGGTCACGAGTCGCTACCGCCTGCCCTGACTGCGAT 125927 |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 125873 ATATACGATATTAACTCCGGAAAGTGGTCACGAGTCCGTACCGCCTGCCCTGACTGCGAT 125932 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 |