Chromosome VII History

From SGD-Wiki
Jump to: navigation, search

This page lists all sequence and annotation changes that have been made to the Chromosome VII systematic reference sequence since its intial release on 1996-07-31.

  • The sequence of Chromosome VII has been updated 125 times, affecting 87 features.
  • The annotation of Chromosome VII has been updated 54 times, affecting 88 features.
  • Current and past versions can be obtained from SGD's Download site.


Sequence Changes

Date Affected Features Start Coordinate of Change End Coordinate of Change Type of Change Old Sequence New Sequence
2011-02-03 YGR067C 622408 622408 Substitution A T
A single nucleotide substitution was made in the stop codon of ORF YGR067C, destroying it and increasing the length of the annotated protein by 10 amino acids.
New    622362   TCTTTGGCCATTATTTTATTTGGCTAAAAATTTCAATGTTTTTACTTTGTTTATTGTCAG  622421
                |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    622366   TCTTTGGCCATTATTTTATTTGGCTAAAAATTTCAATGTTTTAACTTTGTTTATTGTCAG  622425

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL197W 125909 125910 Substitution CG GC
125487 125487 Insertion A
125495 125495 Deletion A
Nucleotide changes within the coding region of MDS3/YGL197W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 262-264 are now QSE rather than HPK, and residue 403 is now Alanine rather than Arginine.
New    125449   TAGACATCTATAACATCTCACAGAATTGCTGGCAATCCGAAA-CCATACCCAAACAACCG  125507
                |||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||
Old    125454   TAGACATCTATAACATCTCACAGAATTGCTGGCA-TCCGAAAACCATACCCAAACAACCG  125512

New    125868   ATATACGATATTAACTCCGGAAAGTGGTCACGAGTCGCTACCGCCTGCCCTGACTGCGAT  125927
                ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||
Old    125873   ATATACGATATTAACTCCGGAAAGTGGTCACGAGTCCGTACCGCCTGCCCTGACTGCGAT  125932

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL041C, YGL041W-A 419056 419056 Deletion G
A single nucleotide was deleted within the coding regions of overlapping ORFs YGL041W-A and YGL041C, resulting in altered protein sequences for both ORFs. The YGL041W-A C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 72 amino acids longer. The YGL041C N-terminus remains the same, but the C-terminus has changed and the annotated protein is truncated by one-third of its length (reduced from 104 amino acids to 67 amino acids).
New    419013   ACTCATGGATCAAATAAATTCGAGGCCTAATGTTCTGG-AAAAGTTAGAAAAGGTTAGCA  419071
                |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Old    419018   ACTCATGGATCAAATAAATTCGAGGCCTAATGTTCTGGGAAAAGTTAGAAAAGGTTAGCA  419077

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL214W 90019 90019 Insertion T
A single T nucleotide was inserted within ORF YGL214W very near its 5' end, altering its coding sequence. The reading frame and stop remain the same, but the start has been shifted downstream four nucleotides and the annotated protein is now one amino acid shorter.
New    89994    CCAAAAAGAATAATGGATGATTGTAAGGTTACATGCAATATATCAAGATATTACTAGAGA  90053
                ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Old    89999    CCAAAAAGAATAATGGATGAT-GTAAGGTTACATGCAATATATCAAGATATTACTAGAGA  90057

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL129C 269097 269097 Deletion A
A single nucleotide was deleted within ORF RSM23/YGL129C, altering its coding sequence. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 38 amino acids shorter.
New    269076   TATTCTGATACGTATA-CCACGTGGCTTGTACTTGTTCTCTTGTTAATGTTTTCCCTCGA  269134
                |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old    269081   TATTCTGATACGTATAACCACGTGGCTTGTACTTGTTCTCTTGTTAATGTTTTCCCTCGA  269140

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL056C 397085 397086 Substitution CG GC
397241 397241 Substitution A C
Nucleotide changes within the coding region of SDS23/YGL056C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 180 is now Glycine rather than Alanine.
New    397060   GTGTCAACTTTACTATCTCGCCCACGGGCACGGACTTACCATTCTGGCAGTCTGAGGTTA  397119
                |||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||
Old    397066   GTGTCAACTTTACTATCTCCGCCACGGGCACGGACTTACCATTCTGGCAGTCTGAGGTTA  397125

New    397190   TGTTAAACAATTCATGTCTCCCGGAAAATTCTCCACAGGCAAAGACGTTAGCTGGTGCTT  397249
                ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    397196   TGTTAAACAATTCATGTCTCCCGGAAAATTCTCCACAGGCAAAGAAGTTAGCTGGTGCTT  397255

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGR058W 607109 607109 Substitution T G
A single nucleotide substitution within the coding region of PEF1/YGR058W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 324 is now Aspartic Acid rather than Tyrosine.
New    607062   TAATCAAGAAGGCATTGCAACCATACAGTACAAAGATTTTATCGATGCTACATTATATTT  607121
                ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old    607066   TAATCAAGAAGGCATTGCAACCATACAGTACAAAGATTTTATCTATGCTACATTATATTT  607125

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGR271W 1033108 1033108 Substitution C T
1032373 1032373 Substitution G A
1031948 1031948 Substitution C A
Nucleotide substitutions within the coding region of SLH1/YGR271W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 51 is now Glutamine rather than Proline, residue 193 is now Lysine rather than Glutamic Acid, and residue 438 is now Serine rather than Proline.
New    1031905  TTTGATGACGAGCTAAAAAAAGTCCAAAAGGATGAACAAAATCAAAGAACTGAACTAACT  1031964
                ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Old    1031911  TTTGATGACGAGCTAAAAAAAGTCCAAAAGGATGAACCAAATCAAAGAACTGAACTAACT  1031970

New    1032325  CCAGAGTTCCTGACACAGCAAGATATCAGGAATCAAGTTTTGAAAAGTGCAGAGGATGCC  1032384
                |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    1032331  CCAGAGTTCCTGACACAGCAAGATATCAGGAATCAAGTTTTGGAAAGTGCAGAGGATGCC  1032390

New    1033055  AATTACTAATTATTGATGAAGTTCATTTACTGCACGAAGATAGAGGTTCGGTTATTGAAA  1033114
                ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    1033061  AATTACTAATTATTGATGAAGTTCATTTACTGCACGAAGATAGAGGTCCGGTTATTGAAA  1033120

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL109W 303591 303591 Substitution A C
A single nucleotide substitution within the coding region of YGL109W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 26 is now Glutamine rather than Lysine.
New    303574   GAATGGAAGGCCAACAAAAAAATTCTTGTACAATTGCATATATTGATTCATTACAATATT  303633
                |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Old    303577   GAATGGAAGGCCAAAAAAAAAATTCTTGTACAATTGCATATATTGATTCATTACAATATT  303636

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGR070W 630688 630688 Substitution C T
A single nucleotide substitution within the coding region of ROM1/YGR070W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 960 is now Valine rather than Alanine.
New    630642   GTAAAAGAATCATTATGATTGCACATCATTTTTTGCACGCCGTACAATTATTGATTGTTA  630701
                |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    630646   GTAAAAGAATCATTATGATTGCACATCATTTTTTGCACGCCGCACAATTATTGATTGTTA  630705

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL059W 392896 392896 Insertion A
392901 392901 Deletion A
Nucleotide changes within the coding region of PKP2/YGL059W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 224-225 are now SI rather than VY.
New    392862   TCAAGAAGATTGATTGTAGAGGAACACGTCAGTAT-CACAGCCAACTACACTAGTGGTAA  392920
                |||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||
Old    392867   TCAAGAAGATTGATTGTAGAGGAACACGTC-GTATACACAGCCAACTACACTAGTGGTAA  392925

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL124C 275965 275965 Substitution C G
276384 276384 Substitution A T
Nucleotide changes within the coding region of MON1/YGL124C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 113 is now Serine rather than Cysteine.
New    275925   GATTCAACAATTCGTTCGAGGACTCGCCTCTTTCGGATTGAGCCATTAGTAATATAGGTG  275984
                |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Old    275931   GATTCAACAATTCGTTCGAGGACTCGCCTCTTTCCGATTGAGCCATTAGTAATATAGGTG  275990

New    276345   TGTCCAAATAAGGACCGAAATCCTTTTTTGGACTGTTTAGTGCTCTCGTTGTATCATCAT  276404
                ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old    276351   TGTCCAAATAAGGACCGAAATCCTTTTTTGGACAGTTTAGTGCTCTCGTTGTATCATCAT  276410

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGR221C 938725 938725 Deletion T
938792 938792 Insertion T
Nucleotide changes within the coding region of TOS2/YGR221C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 69-91 are now EPSMQDFDPNFEGDLYYLPKMDS rather than NLLCRILTQILRAIYTIYRRWIT.
New    938681   TTCTGTGGCATTGCTGTCTGAGTTTGCAGAATTCATAGAAG-AATCCATCTTCGGTAAAT  938739
                ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old    938684   TTCTGTGGCATTGCTGTCTGAGTTTGCAGAATTCATAGAAGTAATCCATCTTCGGTAAAT  938743

New    938740   AGTATAAATCGCCCTCAAAATTTGGGTCAAAATCCTGCATAGAAGGTTCTTTTTTGCATC  938799
                ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    938744   AGTATAAATCGCCCTCAAAATTTGGGTCAAAATCCTGCATAGAAGGTTC-TTTTTGCATC  938802

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGR145W 783805 783805 Substitution A C
A single nucleotide substitution within the coding region of ENP2/YGR145W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 678 is now Aspartic Acid rather than Glutamic Acid.
New    783751   ATTATAAATCCAGGCGTCATGATAATTCATCGGATGAAGAAGGTATTGACGAAAATGGTA  783810
                ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    783756   ATTATAAATCCAGGCGTCATGATAATTCATCGGATGAAGAAGGTATTGAAGAAAATGGTA  783815

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGR153W 796569 796570 Substitution AC CA
Nucleotide substitutions within the coding region of YGR153W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 158 is now Alanine rather than Aspartic Acid.
New    796531   TAAAACCGTGTGGTTGTCATAAATCGAGAAAAGCAAAATGCTTCAAAGAACTGGAGATGG  796590
                |||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||
Old    796536   TAAAACCGTGTGGTTGTCATAAATCGAGAAAAGACAAATGCTTCAAAGAACTGGAGATGG  796595

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGR227W 948219 948219 Substitution A T
A single nucleotide substitution within the coding region of DIE2/YGR227W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 266 is now Isoleucine rather than Lysine.
New    948200   GTTCTGCCCTATATGATAAATTTTGTTTTGTTCTTCATTTATCTGATTTGGAACAGATCC  948259
                |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old    948203   GTTCTGCCCTATATGAAAAATTTTGTTTTGTTCTTCATTTATCTGATTTGGAACAGATCC  948262

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL063W 384063 384064 Substitution CG GC
Nucleotide substitutions within the coding region of PUS2/YGL063W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 136 is now Cysteine rather than Serine.
New    384044   CGAAACGTGGGGGGATGCTACCGCGAAGACGGCTCGCAAGAGGTGTGGGATACGTTCCTG  384103
                ||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||
Old    384047   CGAAACGTGGGGGGATCGTACCGCGAAGACGGCTCGCAAGAGGTGTGGGATACGTTCCTG  384106

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 ARS714, tW(CCA)G1 286729 286729 Deletion T
286355 286355 Insertion C
A single nucleotide insertion and a single nucleotide deletion were made in the intergenic region between ARS714 and tRNA-Trp tW(CCA)G1.
New    286305   CACCATTAACTTTACAACATTACATAATATGACATTCCACAGAACCTCTCTATTCCATTT  286364
                ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    286311   CACCATTAACTTTACAACATTACATAATATGACATTCCACAGAAC-TCTCTATTCCATTT  286369
New    286675   TGCATTTATCTCAGGATATAATGATCCCGTTATCCAATCGATATAGCTT-CCTCAGGTTT  286733
                ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    286680   TGCATTTATCTCAGGATATAATGATCCCGTTATCCAATCGATATAGCTTTCCTCAGGTTT  286739

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 ARS710 203957 203957 Substitution C A
A single nucleotide substitution was made within ARS710.
New    203926   AGATTTTTGATGTTTACATATGAGCAGTTTGATAGAAATTTTGCAATTTTTTATATTTAT  203985
                ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Old    203932   AGATTTTTGATGTTTACATATGAGCCGTTTGATAGAAATTTTGCAATTTTTTATATTTAT  203991

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL036W, YGL037C 428252 428252 Insertion G
A single nucleotide insertion was made in the intergenic region between ORFs PNC1/YGL037C and YGL036W.
New    428202   ATTCACTTTTCCAGTACGTAACACCACGCGGCGCCCCTTTGTGGGGCCTGCCCCTTTTTT  428261
                ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    428208   ATTCACTTTTCCAGTACGTAACACCACGCGGCGCCCCTTTGTGGG-CCTGCCCCTTTTTT  428266

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 ARS734,YGR253C 999367 999367 Substitution A C
999335 999335 Insertion C
999271 999271 Substitution C T
Two separate single nucleotide substitutions and a single nucleotide insertion were made in the intergenic region between ORF PUP2/YGR253C and ARS734.
New    999218   AATTTCCTAGGTTACTCTTTTGCCACCGGTCTTGGTTTATGATAACCCTGTATAATGAAA  999277
                |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    999223   AATTTCCTAGGTTACTCTTTTGCCACCGGTCTTGGTTTATGATAACCCCGTATAATGAAA  999282
New    999318   AGCACTAAATTATCCTTACGGACTTGGGCTACATTCATGTTTGCACGCTTAATAAAAAAT  999377
                ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||
Old    999323   AGCACTAAATTAT-CTTACGGACTTGGGCTACATTCATGTTTGCAAGCTTAATAAAAAAT  999381

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 ARS734 999676 999676 Deletion T
A single nucleotide deletion was made within ARS734.
New    999628   CTGAGCTTTTATCTTCATTAATATATAGTAATTACAACATGTTA-TTGAAATGCACAGCA  999686
                |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    999632   CTGAGCTTTTATCTTCATTAATATATAGTAATTACAACATGTTATTTGAAATGCACAGCA  999691

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGR216C, YGR217W 924488 924488 Insertion C
924482 924482 Insertion A
Two separate single nucleotide insertions were made in the intergenic region between ORFs GPI1/YGR216C and CCH1/YGR217W.
New    924451   GTAATTTGGCATGTCATTTAACTGTATAAAACCGCCCCTGAATTCGAAGGTTCCTGTTCA  924510
                ||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||
Old    924456   GTAATTTGGCATGTCATTTAACTGTAT-AAACCG-CCCTGAATTCGAAGGTTCCTGTTCA  924513

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGR054W 598535 598535 Substitution C T
A single nucleotide substitution was made within ORF YGR054W. Note that the protein sequence was not affected.
New    598482   TAAAGAAATTAAGGGCTATTGAAACCTTGAAGGAAAGACAGGCCGTCGGTGACAAACTAG  598541
                ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    598486   TAAAGAAATTAAGGGCTATTGAAACCTTGAAGGAAAGACAGGCCGTCGGCGACAAACTAG  598545

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGR236C, YGR237C 962981 962981 Deletion T
A single nucleotide deletion was made in the intergenic region between ORFs SPG1/YGR236C and YGR237C.
New    962959   CCCTCACGTCGCGAAGCA-TTTTTAACAGTGTTATCCCAGTATCCCGTAATTCTTCTCTT  963017
                |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old    962963   CCCTCACGTCGCGAAGCATTTTTTAACAGTGTTATCCCAGTATCCCGTAATTCTTCTCTT  963022

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL158W, tL(CAA)G1 206467 206467 Insertion G
A single nucleotide insertion was made in the intergenic region between tRNA-Leu tL(CAA)G1 and ORF RCK1/YGL158W.
New    206446   GAGACCCCGCCCTGCGGAGAGGGGCAAACAATTCTAGCAGAAAAAAATCAGTGGAAAAAA  206505
                |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old    206452   GAGACCCCGCCCTGCG-AGAGGGGCAAACAATTCTAGCAGAAAAAAATCAGTGGAAAAAA  206510

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL145W 230256 230256 Substitution C T
A single nucleotide substitution was made within ORF TIP20/YGL145W. Note that the protein sequence was not affected.
New    230206   TATTGTTTATAAGCATAGTCACAAGTGCATAAAAACTATGAACGGTATTGATGATCTCCT  230265
                ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    230211   TATTGTTTATAAGCATAGTCACAAGTGCATAAAAACTATGAACGGCATTGATGATCTCCT  230270

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL116W, YGL117W 289567 289567 Insertion G
289527 289527 Insertion G
289525 289525 Insertion G
Three separate single nucleotide insertions were made in the intergenic region between ORFs YGL117W and CDC20/YGL116W.
New    289484   CAATTTGATTGCCGAAAGAGGCAAAACGTAAATAGGGTTGGTTTCAAATAATTAGAAGGA  289543
                |||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||
Old    289490   CAATTTGATTGCCGAAAGAGGCAAAACGTAAATAGG-TT-GTTTCAAATAATTAGAAGGA  289547
New    289544   GCATCGGAAAAATGCAACGAGCAAAACCTCTAGCAGGCAAAGAATTTATCACCTTTAAAA  289603
                |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Old    289548   GCATCGGAAAAATGCAACGA-CAAAACCTCTAGCAGGCAAAGAATTTATCACCTTTAAAA  289606

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL060W, YGL061C 390008 390008 Deletion G
389965 389965 Deletion G
Two separate single nucleotide deletions were made in the intergenic region between ORFs DUO1/YGL061C and YBP2/YGL060W.
New    389924   TCTAAAAGGCTAAAAGAACTCACCGTCAAGAGGAAGGG-CTCAGAAAGTATGGGTGAGTC  389982
                |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Old    389927   TCTAAAAGGCTAAAAGAACTCACCGTCAAGAGGAAGGGGCTCAGAAAGTATGGGTGAGTC  389986
New    389983   AATTGAAACAATTTGTAAAAG-CCTTGTCAGGGCTTTCCAAGAGGAGAAGGATGATTTTG  390041
                ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Old    389987   AATTGAAACAATTTGTAAAAGGCCTTGTCAGGGCTTTCCAAGAGGAGAAGGATGATTTTG  390046

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL058W, YGL059W 393814 393814 Deletion G
A single nucleotide deletion was made in the intergenic region between ORFs PKP2/YGL059W and RAD6/YGL058W.
New    393761   CTACATTTCCCGGATTAGTGTATGTATATACAAAAAGGCACCTCCGGG-TAGCCGGAGTA  393819
                |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    393766   CTACATTTCCCGGATTAGTGTATGTATATACAAAAAGGCACCTCCGGGGTAGCCGGAGTA  393825

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL055W, YGL056C 398069 398069 Insertion G
398035 398035 Insertion GC
398033 398033 Insertion G
398027 398027 Deletion G
398014 398014 Insertion A
397868 397868 Deletion A
Several nucleotide sequence changes were made in the intergenic region between ORFs SCS23/YGL056C and OLE1/YGL055W.
New    397840   AAAAAAAAAAAAAAATAAATGA-CACATGGAAATAAGTCAAGGATTAGCGGATATGTAGT  397898
                |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old    397846   AAAAAAAAAAAAAAATAAATGAACACATGGAAATAAGTCAAGGATTAGCGGATATGTAGT  397905
New    397959   CTAATCATTATGCACGTCAAGATTCTCCGTGACTATGGCTCTTTTCTGAAGCATTTTTCG  398018
                ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    397966   CTAATCATTATGCACGTCAAGATTCTCCGTGACTATGGCTCTTTTCTGA-GCATTTTTCG  398024
New    398019   GG-CGCCCGGTGGCCAAAAACTAACTCCGAGCCCGGGCATGTCCCGGGGTTAGCGGGCCC  398077
                || |||||| ||  |||||||||||||||||||||||||||||||||| |||||||||||
Old    398025   GGGCGCCCG-TG--CAAAAACTAACTCCGAGCCCGGGCATGTCCCGGG-TTAGCGGGCCC  398080

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL054C, tE(UUC)G2 401427 401427 Deletion T
401422 401422 Insertion A
A single nucleotide insertion and a single nucleotide deletion were made in the intergenic region between ORF ERV14/YGL054C and tRNA-Glu tE(UUC)G2.
New    401378   TGAGAAAAATCCAGGTCTCTCCTTCGTATTAAGGAATACATGATCTA-GCTATCACTCTT  401436
                |||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||
Old    401381   TGAGAAAAATCCAGGTCTCTCCTTCGTATTAAGGAATACATG-TCTATGCTATCACTCTT  401439

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL213C, YGL215W 89751 89751 Deletion T
89749 89749 Deletion G
89735 89735 Substitution G C
89610 89610 Deletion G
89601 89601 Insertion A
89587 89590 Deletion GTTA
Several nucleotide sequence changes were made in the intergenic region between ORFs CLG1/YGL215W and SKI8/YGL213C.
New    89571    AAAGATTATTATTATTA----CTTTTTTTATTAGTACTCCA-TATGGACCTCTTAGGTGA  89625
                |||||||||||||||||    ||||||||||| |||||||| ||||||||||||||||||
Old    89570    AAAGATTATTATTATTAGTTACTTTTTTTATT-GTACTCCAGTATGGACCTCTTAGGTGA  89628
New    89706    GGAATAAAAACTATAAAAAATGAAAACCAAAAAAAAAAAG-C-ACTGGATTTTTAACATC  89763
                |||||||||||||||||||||||||| ||||||||||||| | |||||||||||||||||
Old    89709    GGAATAAAAACTATAAAAAATGAAAAGCAAAAAAAAAAAGGCTACTGGATTTTTAACATC  89768

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL210W, YGL211W 93660 93660 Deletion C
A single nucleotide deletion was made in the intergenic region between ORFs NCS6/YGL211W and YPT32/YGL210W.
New    93644    ATAGTACGGCGC-GCCCTCCATTAGAACGCGCAACACAATAAAGACAAATAAAAGAATCA  93702
                |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Old    93648    ATAGTACGGCGCCGCCCTCCATTAGAACGCGCAACACAATAAAGACAAATAAAAGAATCA  93707

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL209W, YGL210W 95484 95484 Insertion AA
95471 95471 Insertion A
95084 95084 Deletion A
95082 95082 Deletion G
94596 94596 Insertion T
95447 95448 Substitution TA AT
95444 95444 Deletion A
Several nucleotide sequence changes were made in the intergenic region between ORFs YPT32/YGL210W and MIG2/YFL209W.
New    94553    ACATATACCTTCCCAAGTTATTTATTACTAACCTTCGTTGCACGCAAGAAAAAATGTATT  94612
                |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Old    94558    ACATATACCTTCCCAAGTTATTTATTACTAACCTTCGT-GCACGCAAGAAAAAATGTATT  94616
New    95033    ATTAGAGCGTGTTTCGGAAAACAAACTCGCTCGATACAGTAATTG-C-GTTTTATTTACG  95090
                ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||
Old    95037    ATTAGAGCGTGTTTCGGAAAACAAACTCGCTCGATACAGTAATTGGCAGTTTTATTTACG  95096
New    95391    CTTGCGTCAACTAGCTCTCCCCTTTCCCCATTGAAGTTAGCGTATTA-CCATCAGTTAAT  95449
                ||||||||||||||||||||||||||||||||||||||||||||||| ||  ||||||||
Old    95397    CTTGCGTCAACTAGCTCTCCCCTTTCCCCATTGAAGTTAGCGTATTAACCTACAGTTAAT  95456
New    95450    GATTGATAGGCTCATACGAAGAAGAAAAAAAGCCGGGATAAGAAACCCCGCCTCCACTTT  95509
                ||||||||||||||| |||||||||||||  |||||||||||||||||||||||||||||
Old    95457    GATTGATAGGCTCAT-CGAAGAAGAAAAA--GCCGGGATAAGAAACCCCGCCTCCACTTT  95513

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL045W, YGLWdelta10 413970 413970 Deletion G
413784 413784 Deletion A
413409 413410 Substitution CG GGC
413366 413367 Substitution GC CG
413089 413089 Deletion G
Several nucleotide sequence changes were made in the intergenic region between Ty1 LTR YGLWdelta10 and ORF RIM8/YGL045W.
New    413077   TCTACAGCCG-ACGGGCACTCTATGTATACTCATATCACAGCCACTGTTGCACTACATTA  413135
                |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Old    413079   TCTACAGCCGGACGGGCACTCTATGTATACTCATATCACAGCCACTGTTGCACTACATTA  413138
New    413316   TCGCACGGGTCTTCTGTGCGAATGAGCCACAACGGGGCCGAGTTCAGCGCGTGTCCGCCT  413375
                |||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||
Old    413319   TCGCACGGGTCTTCTGTGCGAATGAGCCACAACGGGGCCGAGTTCAGGCCGTGTCCGCCT  413378
New    413376   ACAACGTCCGCCAACTAGTGGCAATTGCTAGGCTACGCCGACCACGCTGACACGCACCGT  413435
                |||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||
Old    413379   ACAACGTCCGCCAACTAGTGGCAATTGCTACG-TACGCCGACCACGCTGACACGCACCGT  413437
New    413736   CTTAATCGCCTTTCTTTGTTTTCTTTCTTCGTTATTTGTTCTTGGA-CTTTTCCGCTCCA  413794
                |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    413738   CTTAATCGCCTTTCTTTGTTTTCTTTCTTCGTTATTTGTTCTTGGAACTTTTCCGCTCCA  413797
New    413925   TGTCTAAGCTCTATTGAGTCAAAAGTAACAATCTAGACGAAG-AAAAAAAAAAAATAGAA  413983
                |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    413928   TGTCTAAGCTCTATTGAGTCAAAAGTAACAATCTAGACGAAGGAAAAAAAAAAAATAGAA  413987

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL041C-B, YGL042C 418633 418633 Deletion C
A single nucleotide deletion was made in the intergenic region between ORFs YGL042C and YGL041C-B.
New    418594   ATATACATATACTGCTGGTGTTAATTTTTTTTGTC-TGTCTCACGTAAAATCTTTTGTTC  418652
                ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Old    418598   ATATACATATACTGCTGGTGTTAATTTTTTTTGTCCTGTCTCACGTAAAATCTTTTGTTC  418657

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGR256W, tT(UGU)G2 1004546 1004546 Insertion T
1004338 1004338 Deletion T
A single nucleotide deletion and a single nucleotide insertion were made in the intergenic region between tRNA-Thr tT(UGU)G2 and ORF GND2/YGR256W.
New    1004306  AGTATTAATAATTGAGGCGCCCCTAA-TTTTTTTGGCACCGCTCTCGATGAAAAAGTAGA  1004364
                |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Old    1004312  AGTATTAATAATTGAGGCGCCCCTAATTTTTTTTGGCACCGCTCTCGATGAAAAAGTAGA  1004371
New    1004495  GGAGTTAGCTCAAATATATATATATATATATATATGGAGACAACGTTTGAAGAATTCGTA  1004554
                ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    1004502  GGAGTTAGCTCAAATATATATATATATATATATATGGAGACAACG-TTGAAGAATTCGTA  1004560

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGR255C, tT(UGU)G2 1004035 1004035 Deletion C
A single nucleotide deletion was made in the intergenic region between ORF COQ6/YGR255C and tRNA-Thr tT(UGU)G2.
New    1004007  AGTTACTGAATGAAGAAAATTAT-CGCCACAATTATATTTATTCCTTTTTAATGTCGTAT  1004065
                ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old    1004012  AGTTACTGAATGAAGAAAATTATCCGCCACAATTATATTTATTCCTTTTTAATGTCGTAT  1004071

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL208W 98172 98172 Substitution G A
A single nucleotide substitution was made within ORF SIP2/YGL208W. Note that the protein sequence was not affected.
New    98150    TCGATCCTCAATTGCTCTACAAATTGGTAAGGATCCAGACGATTTTGGTGACGGATATAC  98209
                |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old    98154    TCGATCCTCAATTGCTCTGCAAATTGGTAAGGATCCAGACGATTTTGGTGACGGATATAC  98213

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL200C, tK(CUU)G1 122568 122568 Deletion G
A single nucleotide deletion was made in the intergenic region bewteen tRNA-Lys tK(CUU)G1 and ORF EMP24/YGL200C.
New    122520   ACCATATATATGTATATATTTATTTACATGTAATTGGCACAGGG-AAAAACAGTGGAAGG  122578
                |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    122524   ACCATATATATGTATATATTTATTTACATGTAATTGGCACAGGGGAAAAACAGTGGAAGG  122583

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL195W, YGL196W 131262 131262 Deletion G
A single nucleotide deletion was made in the intergenic region between ORFs DSD1/YGL196W and GCN1/YGL195W.
New    131208   TCTCTGTGTCTATGTAATTGTGTATCTATTTATAAATAGTAACTAAGAG-TAAGGTTGTA  131266
                ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    131213   TCTCTGTGTCTATGTAATTGTGTATCTATTTATAAATAGTAACTAAGAGGTAAGGTTGTA  131272

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL185C, YGL186C 153012 153012 Insertion G
152961 152961 Deletion C
A single nucleotide deletion and a single nucleotide insertion were made in the intergenic region between ORFs TPN1/YGL186C and YGL185C.
New    152927   GAAAATTTCAGGTGAGATAAGGTGCGGC-GAACAAATCCGAAATTTACTTACACGCAAGT  152985
                |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Old    152933   GAAAATTTCAGGTGAGATAAGGTGCGGCCGAACAAATCCGAAATTTACTTACACGCAAGT  152992
New    152986   ACGAGTCATACACCTACGGGGCACTGTACTACAATCCATTGTCGAAACAAAAACGGCACT  153045
                |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Old    152993   ACGAGTCATACACCTACGGG-CACTGTACTACAATCCATTGTCGAAACAAAAACGGCACT  153051

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGR118W 727144 727144 Deletion A
A single nucleotide deletion was made within the intron of ORF RPS23A/YGR118W.
New    727112   TTGTGAGCTCTGGAGTGATAAATTTATC-AGTAACATATCCTGGCGCAAATCAGTTTGGA  727170
                |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Old    727116   TTGTGAGCTCTGGAGTGATAAATTTATCAAGTAACATATCCTGGCGCAAATCAGTTTGGA  727175

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGR233C, YGR234W 958923 958923 Deletion C
A single nucleotide deletion was made in the intergenic region between ORFs PHO81/YGR233C and YHB1/YGR234W.
New    958890   GCAAGAATAATAGGGCACGGTACGTTCATT-CACGTAGCGTTAGCTAGTGCTGCCACAAG  958948
                |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Old    958893   GCAAGAATAATAGGGCACGGTACGTTCATTCCACGTAGCGTTAGCTAGTGCTGCCACAAG  958952

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGR273C, YGR274C 1039741 1039741 Deletion A
A single nucleotide deletion was made in the intergenic region between ORFs YGR273C and TAF1/YGR274C.
New    1039705  AATATGCACTTTTCATCTTACTGCAAAAGT-GCACATTCACACACCACGTCCATCGTTTA  1039763
                |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Old    1039711  AATATGCACTTTTCATCTTACTGCAAAAGTAGCACATTCACACACCACGTCCATCGTTTA  1039770

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGR274C 1042563 1042563 Substitution G A
1042313 1042313 Substitution A G
1042308 1042308 Substitution A G
1042185 1042185 Substitution A G
1042083 1042083 Substitution A G
1041870 1041870 Substitution C T
Six separate single nucleotide substitutions were made within ORF TAF1/YGR274C. Note that the protein sequence was not affected.
New    1041814  ATATCAAGTTACTACTATCCAGTTGTTGCTTTTGCTGCGCTAAATTATTTGTTTTCTCAA  1041873
                ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    1041821  ATATCAAGTTACTACTATCCAGTTGTTGCTTTTGCTGCGCTAAATTATTCGTTTTCTCAA  1041880
New    1042044  TCCGCCAAGGTTGCTGTTGATGAAGTACCTTGGTTGATGATTTTTTCTTGGTCCCAATCA  1042103
                |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Old    1042051  TCCGCCAAGGTTGCTGTTGATGAAGTACCTTGATTGATGATTTTTTCTTGGTCCCAATCA  1042110
New    1042164  TTTTGTTGCTCTTTGATAGGGAAAAGTTCATCAATGGAAACATGAATTAAACCTCTTCGG  1042223
                |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Old    1042171  TTTTGTTGCTCTTTAATAGGGAAAAGTTCATCAATGGAAACATGAATTAAACCTCTTCGG  1042230
New    1042284  GATATTGTCCTTGAGTTGAATAGCCTCTTATCATCCTGTTGAACCTTGAATTTCAAATTT  1042343
                ||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||
Old    1042291  GATATTGTCCTTGAGTTAAATAACCTCTTATCATCCTGTTGAACCTTGAATTTCAAATTT  1042350
New    1042524  CCATCTGACATATCTGGTTCCATGATAAATCCACCATTTATCGACATATCATTTCCATTA  1042583
                |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Old    1042531  CCATCTGACATATCTGGTTCCATGATAAATCCGCCATTTATCGACATATCATTTCCATTA  1042590

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL006W, YGL006W-A 485901 485901 Insertion A
A single nucleotide insertion was made in the intergenic region between ORFs YGL006W-A and YGL006W.
New    485852   ACTTGAACAAATAAAGTTTAGAAAAGTGGTTCTAAAAAAAAAAAAACTGTGTGCGTAACA  485911
                ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    485857   ACTTGAACAAATAAAGTTTAGAAAAGTGGTTCTAAAAAAAAAAAA-CTGTGTGCGTAACA  485915

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGR060W, snR48 610095 610095 Substitution A G
A single nucleotide substitution was made in the intergenic region between snoRNA SNR48 and ORF ERG25/YGR060W.
New    610052   ACGGCCACTGCCACTACCACTGCCTCCCTTCGTATACGGGACACAGAGATCGTATACGGT  610111
                ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old    610056   ACGGCCACTGCCACTACCACTGCCTCCCTTCGTATACGGAACACAGAGATCGTATACGGT  610115

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGLWdelta10, tV(AAC)G1 412393 412393 Insertion G
A single nucleotide insertion was made in the intergenic region between tRNA-Val tV(AAC)G1 and Ty1 LTR YGLWdelta10.
New    412357   ACCACGAAACCAGTTTTTTGATGTTTCGTTTAGGGACAAGAGTCCTATGAGAGTCCACTA  412416
                |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Old    412360   ACCACGAAACCAGTTTTTTGATGTTTCGTTTAGG-ACAAGAGTCCTATGAGAGTCCACTA  412418

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGR152C, YGR153W 795986 795989 Substitution AAAA GGGG
A tetranucleotide substitution was made in the intergenic region between ORFs RSR1/YGR152C and YGR153W.
New    795941   TGAGTACTATTCGCCTTTTCCCATAAAGTTGTTTTTTTCTGGGGTTTATGTGTATCGTAA  796000
                ||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||
Old    795946   TGAGTACTATTCGCCTTTTCCCATAAAGTTGTTTTTTTCTAAAATTTATGTGTATCGTAA  796005

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL062W, YGL063W 384846 384847 Substitution CG GC
A dinucleotide substitution was made in the intergenic region between ORFs PUS2/YGL063W and PYC1/YGL062W.
New    384824   GGCTATTCAACTTAGACAAGCGCCAGTTGCGCGCACAAATTTGGTCATGACCGCTCCACC  384883
                |||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||
Old    384827   GGCTATTCAACTTAGACAACGGCCAGTTGCGCGCACAAATTTGGTCATGACCGCTCCACC  384886

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YGL226C-A, YGL227W 72712 72712 Insertion T
A single nucleotide insertion was made in the intergenic region between ORFs VID30/YGL227W and OST5/YGL226C-A.
New    72671    AATATTCTCATCCAAAATACTTCTTAAGTATAGTATATAATTTCATCGATAATTCCTTTA  72730
                |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    72671    AATATTCTCATCCAAAATACTTCTTAAGTATAGTATATAATT-CATCGATAATTCCTTTA  72729

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2007-12-11 YGR271C-A, YGR272C 1038054 1038054 Insertion C
Kastenmayer et al confirmed the insertion of one C nucleotide in YGR272C in an S288C strain background. As a consequence of this sequence change, YGR272C was merged into an adjacent ORF, YGR271C-A. This change extended YGR271C-A at the 5' end, increasing the size of the protein from 63 amino acids to 233 amino acids.
New         TTCTACGCCCTTTGGGTCTGTAGATGGTGTATCATTCGGATATAGTGCAATATACTTTTC 
             ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| 
Old 1038046 TTCTACGCC-TTTGGGTCTGTAGATGGTGTATCATTCGGATATAGTGCAATATACTTTTC 1038104

Kastenmayer JP, et al.(2006) Functional genomics of genes with small open reading frames (sORFs) in S. cerevisiae. Genome Res 16(3):365-73.
SGD paper | PubMed | Full-Text | Web Supplement | Downloads | Comments & Errata

2005-11-29 YGR225W, YGR226C 946899 946899 Insertion T
Based on the automated comparison of related fungi, Brachat et al. (2003) suggest that the C-terminus of Ama1p/YGR225Wp be extended 31 amino acids. SGD has confirmed the insertion of a T after the T at 946899 and is supported by Cooper, et al (2000). As a consequence, YGR225W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 562 amino acids to 593 amino acids. In addition, YGR226C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 199 amino acids to 69 amino acids.
New        ACTAACGATGAAACGATAAGATTTTATGAACTGTGGAACGATAAGGAGGAAATAATTAAT
            |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old 946876 ACTAACGATGAAACGATAAGATTT-ATGAACTGTGGAACGATAAGGAGGAAATAATTAAT 946934

Cooper KF, et al. (2000) Ama1p is a meiosis-specific regulator of the anaphase promoting complex/cyclosome in yeast. Proc Natl Acad Sci U S A 97(26):14548-53.
SGD paper | PubMed | Full-Text
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text

2005-11-22 YGR236C 962549 962549 Deletion G
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. (2003) suggest that the stop site for YGR236C be moved 101 nt upstream. SGD has confirmed the deletion of the G at 962549. As a consequence, YGR236C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 129 amino acids to 95 amino acids.
New        CAAATTCCCTTACATGATTGAAGAG-AACATCAAATACGTTACTTCATCAT
            ||||||||||||||||||||||||| |||||||||||||||||||||||||
Old 962523 CAAATTCCCTTACATGATTGAAGAGGAACATCAAATACGTTACTTCATCAT 962573

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata

2004-07-20 YGL210W-A, YGL211W 93254 93254 Insertion C
93425 93425 Deletion A
93037 93037 Insertion C
The work of Brachat et al. 2003 suggested potential sequence errors within and downstream of NCS6/YGL211W. SGD resequenced this region in S288C and found that the following sequence changes were necessary to correct the reference sequence: insertion of a single C nucleotide after the G at chromosomal coordinate 93037, insertion of a C after the C at 93254, and deletion of the A at 93425. As a consequence of these changes (1) NCS6/YGL211W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 193 to 359 amino acids and (2) YGL210W-A was merged into YGL211W.
Old 93001 TTTTAGAAGACAATCATTGGACCGTGGTGCTGCAAAG-TGGGCATATCTCACGTTGTCAC 93059
           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
New 93001 TTTTAGAAGACAATCATTGGACCGTGGTGCTGCAAAGCTGGGCATATCTCACGTTGTCAC 93060

Old 93240 GCTGGATTATTTTTC-ACTGAGTGTACCTATGCCCCAGAAGCGTTTAGGGGCACTGCGAG 93298
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
New 93241 GCTGGATTATTTTTCCACTGAGTGTACCTATGCCCCAGAAGCGTTTAGGGGCACTGCGAG 93300

Old 93419 TGTTGAACGGCAATAGATGCGCTAGATGTGGATATCTGTCGTCAAATAACATTTGCAAGG 93478
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New 93421 TGTTGA-CGGCAATAGATGCGCTAGATGTGGATATCTGTCGTCAAATAACATTTGCAAGG 93479

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text

2004-07-19 YGL196W 130260 130260 Substitution A C
130106 130106 Insertion C
130298 130298 Deletion C
130416 130416 Deletion G
131047 131047 Insertion A
The work of Kellis et al. 2003 predicted insertion of a single nucleotide downstream of YGL196W; SGD resequenced this region, as well as the region upstream of YGL196W, and confirmed 5 separate sequence errors in the regions flanking YGL196W. SGD has made the following corrections to the reference sequence: insertion of a single C nucleotide after the C at 130106, transversion of A to C at 130260, deletion of a C at 130298, deletion of a G at 130416, and insertion of an A after the A at 131047. As a consequence of these sequence changes, YGL196W was extended at both the 5' and the 3' ends, altering both the N- and C-termini without changing the translation frame, and increasing the size of the predicted protein from 165 to 428 amino acids.
N-terminus:
Old: 130079 ACTTTGAAACAATTGGGCCACGGACTTC-ATTGGCTAAACGCACTACAAGAGCCATATTA 130137
            |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
New: 130080 ACTTTGAAACAATTGGGCCACGGACTTCCATTGGCTAAACGCACTACAAGAGCCATATTA 130139

Old: 130258 AGAAATTTGTCAAGAAGGGTGAATAATTTTCAGGTTTTTGCTTGATAACATTGAACACTT 130317
            || ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
New: 130260 AGCAATTTGTCAAGAAGGGTGAATAATTTTCAGGTTTTTG-TTGATAACATTGAACACTT 130318

Old: 130378 GGTTGATATGGGGACTAAGAGGGCAGGTCTTGCTTTCGGACTCTCCAGAATTTTTGAGTC 130437
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New: 130379 GGTTGATATGGGGACTAAGAGGGCAGGTCTTGCTTTCG-ACTCTCCAGAATTTTTGAGTC 130437
C-Terminus:
Old: 131038 CTCCATTAAA-TTAGGCAGCAAAATTGCCGTCCTTCCTCAACACGCTTGTATCACAATGG 131096
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
New: 131038 CTCCATTAAAATTAGGCAGCAAAATTGCCGTCCTTCCTCAACACGCTTGTATCACAATGG 131097

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata

2004-07-15 YGR231C 952555 952555 Deletion A
The work of Kellis et al. 2003 predicted the deletion of a single A nucleotide at chromosomal coordinate 952555; this sequence error was confirmed in S288C by SGD. As a consequence of this sequence change, PHB2/YGR231C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 315 to 310 amino acids.
Old 952500 CTTAACATTGTTACTCAATTCTTAAAGATAATATCTAGCCTTCGCTATTTATTTGACCCC 952559
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
New 952501 CTTAACATTGTTACTCAATTCTTAAAGATAATATCTAGCCTTCGCTATTTATTTG-CCCC 952559

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata

2004-07-15 YGL236C 53811 53811 Insertion C
The work of Kellis et al. 2003 predicted the insertion of a single C nucleotide after the C at chromosomal coordinate 53811; this sequence error was confirmed in S288C by SGD. As a consequence of this sequence change, MTO1/YGL236C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 679 to 669 amino acids.
Old 53761 TATACAAGCTAACGATTAAAGGATATTTACATGACTGGTTGGCTTGGCTTC-GTGCCACA 53819
           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
New 53761 TATACAAGCTAACGATTAAAGGATATTTACATGACTGGTTGGCTTGGCTTCCGTGCCACA 53820

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata

2004-01-23 YGL198W 124271 124271 Deletion T
124331 124331 Deletion T
124279 124279 Insertion C
124251 124251 Insertion C
Kellis et al. 2003 predicted and confirmed four sequence errors in YGL198W: the insertion of a single C nucleotide after the C at chromosomal coordinate 124251, and the deletion of a single T at 124271, the insertion of a single C after the C at 124279, and the deletion of a single T at 124331. As a consequence of these sequence changes, YGL198W was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 261 to 235 amino acids.
New 124234 CCATTATCGAGATATACCCTCTGGCACTCTGTCTTTTT-GGCATGGCCTGGTTGTCAACT 124290
            |||||||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Old 124234 CCATTATCGAGATATACC-TCTGGCACTCTGTCTTTTTTGGCATGGC-TGGTTGTCAACT 124291

New 124291 ATTTTATAACACTAGTTACATATGTATAAAACCCAATAT-CATGGACATAGAATTGCCTA 124351
            ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old 124292 ATTTTATAACACTAGTTACATATGTATAAAACCCAATATTCATGGACATAGAATTGCCTA 124351

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata

2004-01-23 YGL201C 120375 120375 Substitution C G
A single C nucleotide at chromosomal coordinate 120375 was changed to a G, altering the coding sequence of MCM6/YGL201C. The start, stop, and reading frame remain the same, but protein residue 179 is now a proline rather than an alanine. See GenBank Accession AY258324. Thanks to Andrea Duina and F. Winston for resequencing this region in S288c.
New 120335 TACTTTCTTACTACTCTTCTTAAACCCTTTTGTAAAAAAGGCAAAAATCTGTAATATTGT 120394
            |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old 120335 TACTTTCTTACTACTCTTCTTAAACCCTTTTGTAAAAAAGCCAAAAATCTGTAATATTGT 120394
2004-01-22 YGR006W 506672 506672 Insertion G
Kellis et al. predicted and confirmed the insertion of a single G nt. As a consequence of this sequence change, YGR006W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 219 to 251 amino acids.
New 506640 ATGTGGCCTGGCCTATTGGTGTTACTAGCGTAGGCATTCATGCTCGTAGTGCACATTCGA 506699
            ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old 506640 ATGTGGCCTGGCCTATTGGTGTTACTAGCGTAG-CATTCATGCTCGTAGTGCACATTCGA 506698

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata

2003-01-09 YGL045W, YGL046W 414910 414910 Insertion C
414883 414883 Insertion A
414983 414983 Insertion CC
415042 415042 Deletion G
Due to the following changes to the systematic sequence of Chromosome VII, YGL045W and YGL046W have been merged into one single larger ORF: A insertion at 414883, C insertion at 414910, CC insertion at 414983, and G deletion at 415042. RIM8 is the standard name for the new merged ORF; YGL046W is now an alias of RIM8/YGL045W. We thank Claude Gaillardin and Aaron P. Mitchell for reporting this sequence error to SGD.
Old 414838 TTCTAGCAGTTCAGTAAACTCCAAGACGTCCCCCTTACCAAATAAA-CGGTGACTATATC 414896
            |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New 414841 TTCTAGCAGTTCAGTAAACTCCAAGACGTCCCCCTTACCAAATAAAACGGTGACTATATC 414900

Old 414897 CGTAGACATAC-GCAGGCTGGATTCATGATTGGTGAAATTATCCCTATAGACGTTAAGAT 414955
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New 414901 CGTAGACATACCGCAGGCTGGATTCATGATTGGTGAAATTATCCCTATAGACGTTAAGAT 414960

Old 414956 TGACCACTATAAGCCTTTCTATGCC--TGCGGGTCTCACCACCACTTTGGTGAGGATATG 415013
            |||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||
New 414961 TGACCACTATAAGCCTTTCTATGCCCCTGCGGGTCTCACCACCACTTTGGTGAGGATATG 415020

Old 415014 TAGGGTGGGCGGTGCAGGCAAAGATGGATCCTATGGAGACTTTCAGAAAAGATATATGTC 415073
            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New 415021 TAGGGTGGGCGGTGCAGGCAAAGATG-ATCCTATGGAGACTTTCAGAAAAGATATATGTC 415079

Treton B, et al.(2003) Ambient pH signalling in ascomycetous yeasts involves homologues of the Aspergillus nidulans genes palF and paIH. Mol Gen Genet 263(3):505-13.
SGD paper | PubMed | Full-Text
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata

2003-01-06 YGL125W 273208 273209 Substitution AT GC
273061 273061 Insertion CG
273111 273112 Substitution AC CA
273049 273049 Insertion A
Due to the insertion of an A after the A at coordinate 273049, a CG insertion after the A at 273061, a substitution of AC at 273111-273112 with CA, and a substitution of AT at 273208-273209 with GC, the coordinates for the ORF YGL125W have changed to 272524-274326. The old coordinates for YGL125W were 272524-274323. Thanks to Dean Appling and Sherwin Chan for reporting this sequence error on Chromosome VII to SGD.
Old 273001 CATCCGGAGTTGCCTAACAAAGACGTGAAGCTTGATCTCGAGTATTTGA-GCAGAAGATC 273059
            ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New 273001 CATCCGGAGTTGCCTAACAAAGACGTGAAGCTTGATCTCGAGTATTTGAAGCAGAAGATC 273060
Old 273060 GA--CCGGCGGCGACTTCATCATCACTCAGATGTTTTACGATGTTGATAATTTACTCAAC 273117
            ||  |||||||||||||||||||||||||||||||||||||||||||||||||  |||||
New 273061 GACGCCGGCGGCGACTTCATCATCACTCAGATGTTTTACGATGTTGATAATTTCATCAAC 273120
Old 273118 TGGTGTTCCCAAGTTAGAGCTGCGGGCATGGACGTGCCCATTATTCCCGGGATCATGCCG 273177
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New 273121 TGGTGTTCCCAAGTTAGAGCTGCGGGCATGGACGTGCCCATTATTCCCGGGATCATGCCG 273180
Old 273178 ATCACTACCTACGCGGCCTTCTTGAGAAGGATCCAATGGGGCCAAATCTCCATCCCTCAA 273237
            ||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||
New 273181 ATCACTACCTACGCGGCCTTCTTGAGAAGGGCCCAATGGGGCCAAATCTCCATCCCTCAA 273240

Brachmann CB, et al. (1998) Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14(2):115-32.
SGD paper | PubMed | Full-Text

2003-01-03 YGL059W 393525 393525 Insertion A
In 2001, Lubo Tomaska and Yde Steensma reported that they had resequenced the C-terminal part of YGL059W and found that a single A nucleotide was missing between relative coordinates 1303 and 1304 in the reference sequence. As a consequence, the predicted protein should be 46 amino acids longer than originally annotated. This corresponds to the prediction based on comparative genomics by Blandin et al. 2000. SGD verified this change through resequencing of the region in strain FY1679, a derivative of S288c, and inserted an A after the A at chromosomal coordinate 393525 in the systematic sequence of Chromosome VII. As a result of this change, the new coordinates are 39223-393698, extending the predicted length of the protein from 445 amino acids to 491 amino acids.
Old 393481 TAAATGGGCACATCAAATATGAAACTCCCCTAATTGAATTGTTAA-GCGGTCTTTTAGAT 393539
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
New 393481 TAAATGGGCACATCAAATATGAAACTCCCCTAATTGAATTGTTAAAGCGGTCTTTTAGAT 393540

Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6.
SGD paper | PubMed | Full-Text

2000-06-16 YGR113W 719761 719761 Insertion C
Iain Cheeseman reported that a single frameshift 874 bp into the open reading frame at chromosomal coordinate 719761 (TATAC to TATCAC) results in a different coding sequence for the last 44 amino acids and a different stop codon 24 bp downstream from the sequence originally stored in SGD. The Candida DAM1 homolog is more similar to the sequence that Iain Cheeseman reports. SGD incorporated this sequence change on 2001-05-31.
Old 719701 TACCCATCGAAAACGACAATGTTGTTAATTTGGGAGATCTGCATCCAAATAATCGAATAT 719760
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New 719701 TACCCATCGAAAACGACAATGTTGTTAATTTGGGAGATCTGCATCCAAATAATCGAATAT 719760
Old 719761 -ACTCGGAAGTGGTGCTGCAAGAGTGGTCAATGGGCCCGTTACGAAGAACAGAAATTCAA 719819
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New 719761 CACTCGGAAGTGGTGCTGCAAGAGTGGTCAATGGGCCCGTTACGAAGAACAGAAATTCAA 719820



Annotation Changes without sequence changes

Date Affected Features
2014-11-19 ARS737

The coordinates of the ARS consensus sequence annotated within ARS737 were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704.
SGD paper | PubMed | Full-Text

2014-11-19 ARS716, ARS720, ARS722, ARS729, ARS734

As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome VII based on Liachko et al. 2013: ARS716, ARS720, ARS722, ARS729, ARS734.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704.
SGD paper | PubMed | Full-Text

2014-11-19 ARS702, ARS707, ARS714, ARS716, ARS718, ARS727, ARS728, ARS737, ARS734

The chromosomal coordinates of the following ARS elements on Chromosome VII were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS702, ARS707, ARS714, ARS716, ARS718, ARS727, ARS728, ARS737, ARS734.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704.
SGD paper | PubMed | Full-Text

2014-11-19 RME3

RME3 was added to the genome annotation and assigned genomic coordinates based on Xu et al. 2009 and Gelfand et al. 2011 as part of SGD's genome annotation revision R64.2.

Xu Z, et al. (2009) Bidirectional promoters generate pervasive transcription in yeast. Nature 457(7232):1033-7.
SGD paper | PubMed | Full-Text | Comments & Errata
Gelfand B, et al. (2011) Regulated antisense transcription controls expression of cell-type-specific genes in yeast. Mol Cell Biol 31(8):1701-9.
SGD paper | PubMed | Full-Text

2014-11-19 RME2

RME2 was added to the genome annotation and assigned genomic coordinates based on Yassour et al. 2010 and Gelfand et al. 2011 as part of SGD's genome annotation revision R64.2.

Yassour M, et al. (2010) Strand-specific RNA sequencing reveals extensive regulated long antisense transcripts that are conserved across yeast species. Genome Biol 11(8):R87.
SGD paper | PubMed | Full-Text
Gelfand B, et al. (2011) Regulated antisense transcription controls expression of cell-type-specific genes in yeast. Mol Cell Biol 31(8):1701-9.
SGD paper | PubMed | Full-Text

2014-11-18 YGL033W

A second intron and third coding region were added to the annotation of HOP2/YGL033W as part of SGD's genome annotation revision R64.2.

Old coordinates:
CDS	1-55	435625..435679
intron	56-125	435680..435749
CDS	126-727	435750..436351
New coordinates:
CDS	1-55 	435625..435679 - stays the same
intron	56-125	435680..435749 - stays the same
CDS	126-688	435750..436312 - new coordinates
intron	689-750	436313..436374 - new intron
CDS 	751-777	436375..436401 - new coding region

Chan YL, et al. (2014) The Third Exon of the Budding Yeast Meiotic Recombination Gene HOP2 Is Required for Calcium-dependent and Recombinase Dmc1-specific Stimulation of Homologous Strand Assimilation. J Biol Chem 289(26):18076-18086.
SGD paper | PubMed | Full-Text

2014-11-18 ETC1, ETC2, ETC3, ETC4, ETC6, ETC7, ETC8

The following previously unmapped features were identified as nuclear matrix attachment sites and assigned chromosomal coordinates based on Hiraga et al. 2012 as part of SGD's genome annotation revision R64.2: ETC1, ETC2, ETC3, ETC4, ETC6, ETC7, ETC8.

Hiraga SI, et al. (2012) TFIIIC localizes budding yeast ETC sites to the nuclear periphery. Mol Biol Cell 23(14):2741-54.
SGD paper | PubMed | Full-Text

2009-05-07 ARS709, ARS712, ARS715, ARS723, ARS735, ARS736

The following ARS elements on Chromosome 7 were added to the genome annotation based on Raveendranathan et al. 2006: ARS709, ARS712, ARS715, ARS723, ARS724, ARS735, and ARS736.

Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39.
SGD paper | PubMed | Full-Text

2008-06-02 YGL256W

The start of ADH4/YGL256W was moved 249 nt downstream, based on Williams & Paquin 1987 and Lyons et al. 2000, who state that Met84 appears to be the true translational start. See also GenBank X05992.

Lyons TJ, et al. (2000) Genome-wide characterization of the Zap1p zinc-responsive regulon in yeast. Proc Natl Acad Sci U S A 97(14):7957-62.
SGD paper | PubMed | Full-Text | YFGdb
Williamson VM and Paquin CE (1987) Homology of Saccharomyces cerevisiae ADH4 to an iron-activated alcohol dehydrogenase from Zymomonas mobilis. Mol Gen Genet 209(2):374-81.
SGD paper | PubMed | Full-Text

2007-05-08 snR46

Updated coordinates of snR46 based on GenBank Z72814, U56647, Z72815. Shifted entire feature downstream 1 nucleotide.

Balakin AG, et al. (1996) The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell 86(5):823-34.
SGD paper | PubMed | Full-Text

2007-04-04 YGR148C

RPL24B/YGR148C mRNA contains an intron in the 5' untranslated region (UTR).

Baronas-Lowell DM and Warner JR (1990) Ribosomal protein L30 is dispensable in the yeast Saccharomyces cerevisiae. Mol Cell Biol 10(10):5235-43.
SGD paper | PubMed | Full-Text
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement
Mitra G and Warner JR (1984) A yeast ribosomal protein gene whose intron is in the 5' leader. J Biol Chem 259(14):9218-24.
SGD paper | PubMed | Full-Text
Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51.
SGD paper | PubMed | Full-Text
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7.
SGD paper | PubMed | Full-Text

2007-04-04 YGR027C

RPS25A/YGR027C mRNA contains an intron in the 5' untranslated region (UTR).

Nieuwint RT, et al. (1985) The gene for yeast ribosomal protein S31 contains an intron in the leader sequence. Curr Genet 10(1):1-5.
SGD paper | PubMed | Full-Text
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement
Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51.
SGD paper | PubMed | Full-Text
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7.
SGD paper | PubMed | Full-Text

2007-04-04 YGL189C

RPS26A/YGL189C mRNA contains an intron in the 5' untranslated region (UTR)..

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51.
SGD paper | PubMed | Full-Text
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7.
SGD paper | PubMed | Full-Text

2007-04-04 YGL187C

COX4/YGL187W mRNA contains an intron in the 5' untranslated region (UTR).

Schneider JC and Guarente L (1987) The untranslated leader of nuclear COX4 gene of Saccharomyces cerevisiae contains an intron. Nucleic Acids Res 15(8):3515-29.
SGD paper | PubMed | Full-Text
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement
Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51.
SGD paper | PubMed | Full-Text
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7.
SGD paper | PubMed | Full-Text

2007-04-04 YGL031C

RPL24A/YGL031C mRNA contains an intron in the 5' untranslated region (UTR).

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement
Mitra G and Warner JR (1984) A yeast ribosomal protein gene whose intron is in the 5' leader. J Biol Chem 259(14):9218-24.
SGD paper | PubMed | Full-Text
Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51.
SGD paper | PubMed | Full-Text
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7.
SGD paper | PubMed | Full-Text

2006-10-05 YGR034W

Based on N-terminal sequencing (Otaka E. et al) and conservation with RPL26A, the first exon of RPL26B was moved upstream. The new first exon is 19 nts in length (the previous first exon was 25 nts), and the new start codon is 117 nt upstream of the previously annotated start. The 5' end of the intron has been extended upstream, but the 3' end of the intron remains the same, as does the second exon. The protein product is now two residues shorter and altered at the N-terminus. Special thanks to Ivo Pedruzzi and the team at Swiss-Prot for bringing this to our attention.

Otaka E, et al. (1984) Yeast ribosomal proteins. VIII. Isolation of two proteins and sequence characterization of twenty-four proteins from cytoplasmic ribosomes. Mol Gen Genet 195(3):544-6.
SGD paper | PubMed | Full-Text

2006-10-03 ARS737

ARS737, also known as ARS731.5, was added to the genome annotation based on Nieduszynski et al. 2006.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9.
SGD paper | PubMed | Full-Text | Web Supplement

2006-10-03 ARS702, ARS704, ARS707, ARS710, ARS714, ARS717, ARS718, ARS719, ARS721, ARS727, ARS728, ARS729, ARS731, ARS733

ARS Consensus Sequences (ACS elements) were annotated in the following ARS elements on Chromosome VII based on Nieduszynski et al. 2006: ARS702, ARS704, ARS707, ARS710, ARS714, ARS717, ARS718, ARS719, ARS721, ARS727, ARS728, ARS729, ARS731, ARS733.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9.
SGD paper | PubMed | Full-Text | Web Supplement

2006-09-08 ARS702, ARS704, ARS707, ARS710, ARS714, ARS716,ARS717, ARS718, ARS719, ARS720, ARS721, ARS722, ARS727, ARS728, ARS729, ARS731, ARS733, ARS734

The following new ARS elements on Chromosome VII were added to SGD based on Nieduszynski et al. 2006: ARS702, ARS704, ARS707, ARS710, ARS714, ARS716, ARS717, ARS718, ARS719, ARS720, ARS721, ARS722, ARS727, ARS728, ARS729, ARS731, ARS733, ARS734.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9.
SGD paper | PubMed | Full-Text | Web Supplement

2006-05-09 CEN7

The previously annotated 3' boundary of CEN7 was moved 1 bp upstream to coincide with the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60.
SGD paper | PubMed | Full-Text
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68.
SGD paper | PubMed | Full-Text

2006-04-12 ARS706

ARS706, also known as "ARO8 ARS", was added to the genome annotation for Chromosome VII at coordinates 117565-117858 based on Wyrick et al. 2001 and Iraqui et al. 1998.

Iraqui I, et al. (1998) Characterisation of Saccharomyces cerevisiae ARO8 and ARO9 genes encoding aromatic aminotransferases I and II reveals a new aminotransferase subfamily. Mol Gen Genet 257(2):238-48.
SGD paper | PubMed | Full-Text
Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60.
SGD paper | PubMed | Full-Text | Comments & Errata

2006-01-23 YGR088W

Based on based on 5' SAGE TSS and multiple orthologous sequences alignment, Zhang and Dietrich suggest that the start site CTT1/YGR088W be moved 33 nt (11 codons) downstream. This is the same start codon published in the initial characterization by Hartig and Ruis. This change has been incorporated into SGD and the numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly.

Hartig A and Ruis H (1986) Nucleotide sequence of the Saccharomyces cerevisiae CTT1 gene and deduced amino-acid sequence of yeast catalase T. Eur J Biochem 160(3):487-90.
SGD paper | PubMed | Full-Text
Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51.
SGD paper | PubMed | Full-Text | YFGdb

2005-11-10 YGL194C-A

Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that this new ORF, YGL194C-A, be added to the S. cerevisiae genome annotation.

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2005-11-01 YGL194C-A

Identified based on conservation in closely related fungi.

Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6.
SGD paper | PubMed | Full-Text

2004-10-12 CEN7

The orientation of this centromere was reversed (from Watson to Crick) and its coordinates expanded to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. (2001) and Espelin et al. (2003).

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60.
SGD paper | PubMed | Full-Text
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68.
SGD paper | PubMed | Full-Text

2004-08-27 YGR161W-C

The ORF YGR161W-C was added per Blandin et al. Note that this ORF was originally published using the systematic name "YGR161W-A;" however, the systematic name "YGR161W-A" had already been used to refer to a TyA Gag protein downstream of the new ORF predicted by Blandin et al.

Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6.
SGD paper | PubMed | Full-Text

2004-04-01 snR82

Start and stop coordinates updated per McCutcheon & Eddy 2004.

McCutcheon JP and Eddy SR (2004) Detailed correction to: Computational identification of noncoding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res. 31:4119-4128, 2003.
SGD paper | PubMed | Full-Text

2004-04-01 snR7-L, snR7-S

5' chromosomal coordinate of both snR7-L and snR7-S changed to that experimentally determined in Patterson, B and Guthrie, C. (1987).

Patterson B and Guthrie C (1987) An essential yeast snRNA with a U5-like domain is required for splicing in vivo. Cell 49(5):613-24.
SGD paper | PubMed | Full-Text

2003-09-22 YGR095C

Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for RRP46/YGR095C was moved 99 nt (33 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) this is the form of the protein detected in analyses by Synowsky et al.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement
Synowsky SA, et al. (2006) Probing genuine strong interactions and post-translational modifications in the heterogeneous yeast exosome protein complex. Mol Cell Proteomics 5(9):1581-92.
SGD paper | PubMed | Full-Text

2003-09-22 YGR275W

Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for RTT102/YGR275W was moved 87 nt (29 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YGL240W

Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for DOC1/YGL240W was moved 99 nt (33 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YGL250W

Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for YGL250W was moved 12 nt (4 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YGR201C

Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for YGR201C was moved 147 nt (49 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YGL025C

Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for PGD1/YGL025C was moved 102 nt (34 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YGR120C

Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for COG2/YGR120C was moved 39 nt (13 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YGL245W

Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for YGL245W was moved 48 nt (16 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YGL128C

Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for CWC23/YGL128C was moved 192 nt (64 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YGR057C

Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for LST7/YGR057C was moved 9 nt (3 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-09 TEL07L, TEL07R

The chromosomal locations for TEL07L, TEL07L-TR, TEL07L-XC, TEL07L-XR, TEL07R, TEL07R-XC, TEL07R-XR, and TEL07R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).

Note that TEL07R does have telomeric repeats (TEL07R-TR), but they are missing from the genome annotation due to sequencing difficulties encountered during the initial genome sequencing efforts in the 1990s.

2003-07-29 YGL041C-B, YGL210W-A, YGR121W-A, YGR240C-A

Thanks to Kessler et al. for providing the coordinates of the following Chromosome VII ORFs: YGR240C-A, YGL210W-A, YGR121W-A, and YGL041C-B.

Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71.
SGD paper | PubMed | Full-Text

2003-07-29 YGL007C-A, YGL063C-A, YGL123C-A, YGL188C-A, YGR031C-A, YGR068W-A, YGR146C-A, YGR174W-A, YGR204C-A, YGR270C-A, YGR296C-A, YGR296C-B

Thanks to Kumar et al. for providing the coordinates of the following Chromosome VII ORFs: YGR270C-A, YGR296C-A, YGR296C-B, YGL007C-A, YGL063C-A, YGL123C-A, YGL188C-A, YGR031C-A, YGR068W-A, YGR146C-A, YGR174W-A, and YGR204C-A.

Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63.
SGD paper | PubMed | Full-Text | YFGdb | Comments & Errata

2003-07-29 YGL006W-A

Thanks to MIPS for providing the coordinates of YGL006W-A..

2003-07-29 YGL014C-A, YGL041W-A, YGR035W-A

Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the following Chromosome VII ORFs: YGL014C-A, YGL041W-A and YGR035W-A.

Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9.
SGD paper | PubMed | Full-Text
Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51.
SGD paper | PubMed | Full-Text | YFGdb
Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20.
SGD paper | PubMed | Full-Text | Web Supplement | YFGdb

2003-07-29 YGR169C-A

Thanks to Brachat et al. for providing the coordinates of YGR169C-A.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text

2003-03-06 snR82

Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8.

McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28.
SGD paper | PubMed | Full-Text

2003-01-07 YGL183C

A new intron and in-frame 5' exon were added to MND1/YGL183C, changing the N-terminus and increasing the size of the protein from 174 aa to 219 aa. The relative coordinates of the coding region change from 1-525 to 1-3..87-743. Note that the stop remains unchanged. Thanks to Pinar Kondu (Yeast Proteome Database) for reporting this change to SGD.

Tsubouchi H and Roeder GS (2002) The Mnd1 protein forms a complex with hop2 to promote homologous chromosome pairing and meiotic double-strand break repair. Mol Cell Biol 22(9):3078-88.
SGD paper | PubMed | Full-Text

2003-03-06 ARS701

Courtesy of Prof. BiK Tye; based on Ph. D. thesis of Dr. Clarence Chan.

2000-12-01 YGL033W

The start of ORF YGL033W was moved 374 nucleotides downstream, and the existing intron was narrowed at both ends. The relative coordinates of the coding region change from 1-24..568-1101 to 1-55..126-727, and the chromosomal coordinates of the coding region change from 435247-435270..435814-436347 to 435621-435675..435746-436347.

2000-12-01 YGR225W

The stop of ORF YGR225W was moved 552 nucleotides downstream, and at the same time an intron was added at relative coordinates 1184-1276. The relative coordinates of the coding region change from 1-1230 to 1-1183..1277-1782, and the chromosomal coordinates of the coding region change from 945137-946366 to 945137-946319..946413-946918. Note that the start remains unchanged.

2000-07-14 YGR029W

The start of ORF YGR029W was moved 299 nucleotides upstream, and at the same time an intron was added at relative coordinates 87-169. The relative coordinates of the coding region change from 1-354 to 1-86..170-653, and the chromosomal coordinates of the coding region change from 543846-544199 to 543547-543632..543716-544199. Note that the stop remains unchanged.

2000-07-14 YGL251C

The start of ORF YGL251C was moved 575 nucleotides upstream, and at the same time an intron was added at relative coordinates 59-210. The relative coordinates of the coding region change from 1-3141 to 1-58..211-3716, and the chromosomal coordinates of the coding region change from 31061-27921 to 31636-31579..31426-27921. Note that the stop remains unchanged.

2000-05-19 YGR001C

Davis et al. 2000 demonstrated a second intron upstream of the annotated YGR001C ORF that extends the N-terminus by 55 amino acids (aa). The gene was previously annotated to chromosomal coordinates 497802-497128, with two exons at relative coordinates 1-349 and 443-675, for a predicted protein of 193 aa. The updated annotation is from chromosomal coordinates 498029-497128, with three exons at 1-35, 98-576, and 670-902, for a predicted protein of 248 aa.

Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6.
SGD paper | PubMed | Full-Text

1999-07-17 YGL244W

The start of ORF YGL244W was moved 300 nucleotides upstream. The relative coordinates of the coding region change from 1-1377 to 1-1677, and the chromosomal coordinates of the coding region change from 41798-43174 to 41498-43174. Note that the stop remains unchanged.

1998-05-21 YGR122C-A

The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A.

The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.

Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51.
SGD paper | PubMed | Full-Text | YFGdb