Difference between revisions of "Chromosome VII History"
Line 405: | Line 405: | ||
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | ||
Old 428208 ATTCACTTTTCCAGTACGTAACACCACGCGGCGCCCCTTTGTGGG-CCTGCCCCTTTTTT 428266</pre> | Old 428208 ATTCACTTTTCCAGTACGTAACACCACGCGGCGCCCCTTTGTGGG-CCTGCCCCTTTTTT 428266</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | rowspan="3"| 2011-02-03 | ||
+ | | rowspan="3"| [https://www.yeastgenome.org/locus/ARS734 ARS734],[https://www.yeastgenome.org/locus/YGR253C YGR253C] | ||
+ | | 999367 | ||
+ | | 999367 | ||
+ | | Substitution | ||
+ | | A | ||
+ | | C | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 999335 | ||
+ | | 999335 | ||
+ | | Insertion | ||
+ | | | ||
+ | | C | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 999271 | ||
+ | | 999271 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | T | ||
+ | |- | ||
+ | | || colspan="6" | Two separate single nucleotide substitutions and a single nucleotide insertion were made in the intergenic region between ORF PUP2/YGR253C and ARS734. | ||
+ | <pre>New 999218 AATTTCCTAGGTTACTCTTTTGCCACCGGTCTTGGTTTATGATAACCCTGTATAATGAAA 999277 | ||
+ | |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | ||
+ | Old 999223 AATTTCCTAGGTTACTCTTTTGCCACCGGTCTTGGTTTATGATAACCCCGTATAATGAAA 999282 | ||
+ | New 999318 AGCACTAAATTATCCTTACGGACTTGGGCTACATTCATGTTTGCACGCTTAATAAAAAAT 999377 | ||
+ | ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| | ||
+ | Old 999323 AGCACTAAATTAT-CTTACGGACTTGGGCTACATTCATGTTTGCAAGCTTAATAAAAAAT 999381</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/ARS734 ARS734] | ||
+ | | 999676 | ||
+ | | 999676 | ||
+ | | Deletion | ||
+ | | T | ||
+ | | | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide deletion was made within ARS734. | ||
+ | <pre>New 999628 CTGAGCTTTTATCTTCATTAATATATAGTAATTACAACATGTTA-TTGAAATGCACAGCA 999686 | ||
+ | |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||
+ | Old 999632 CTGAGCTTTTATCTTCATTAATATATAGTAATTACAACATGTTATTTGAAATGCACAGCA 999691</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | rowspan="2"| 2011-02-03 | ||
+ | | rowspan="2"| [https://www.yeastgenome.org/locus/YGR216C YGR216C], [https://www.yeastgenome.org/locus/YGR217W YGR217W] | ||
+ | | 924488 | ||
+ | | 924488 | ||
+ | | Insertion | ||
+ | | | ||
+ | | C | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 924482 | ||
+ | | 924482 | ||
+ | | Insertion | ||
+ | | | ||
+ | | A | ||
+ | |- | ||
+ | | || colspan="6" | Two separate single nucleotide insertions were made in the intergenic region between ORFs GPI1/YGR216C and CCH1/YGR217W. | ||
+ | <pre>New 924451 GTAATTTGGCATGTCATTTAACTGTATAAAACCGCCCCTGAATTCGAAGGTTCCTGTTCA 924510 | ||
+ | ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| | ||
+ | Old 924456 GTAATTTGGCATGTCATTTAACTGTAT-AAACCG-CCCTGAATTCGAAGGTTCCTGTTCA 924513</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YGR054W YGR054W] | ||
+ | | 598535 | ||
+ | | 598535 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | T | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide substitution was made within ORF YGR054W. Note that the protein sequence was not affected. | ||
+ | <pre>New 598482 TAAAGAAATTAAGGGCTATTGAAACCTTGAAGGAAAGACAGGCCGTCGGTGACAAACTAG 598541 | ||
+ | ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||
+ | Old 598486 TAAAGAAATTAAGGGCTATTGAAACCTTGAAGGAAAGACAGGCCGTCGGCGACAAACTAG 598545</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YGR236C YGR236C], [https://www.yeastgenome.org/locus/YGR237C YGR237C] | ||
+ | | 962981 | ||
+ | | 962981 | ||
+ | | Deletion | ||
+ | | T | ||
+ | | | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs SPG1/YGR236C and YGR237C. | ||
+ | <pre>New 962959 CCCTCACGTCGCGAAGCA-TTTTTAACAGTGTTATCCCAGTATCCCGTAATTCTTCTCTT 963017 | ||
+ | |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||
+ | Old 962963 CCCTCACGTCGCGAAGCATTTTTTAACAGTGTTATCCCAGTATCCCGTAATTCTTCTCTT 963022</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YGL158W YGL158W], [https://www.yeastgenome.org/locus/tL(CAA)G1 tL(CAA)G1] | ||
+ | | 206467 | ||
+ | | 206467 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide insertion was made in the intergenic region between tRNA-Leu tL(CAA)G1 and ORF RCK1/YGL158W. | ||
+ | <pre>New 206446 GAGACCCCGCCCTGCGGAGAGGGGCAAACAATTCTAGCAGAAAAAAATCAGTGGAAAAAA 206505 | ||
+ | |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | ||
+ | Old 206452 GAGACCCCGCCCTGCG-AGAGGGGCAAACAATTCTAGCAGAAAAAAATCAGTGGAAAAAA 206510</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YGL145W YGL145W] | ||
+ | | 230256 | ||
+ | | 230256 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | T | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide substitution was made within ORF TIP20/YGL145W. Note that the protein sequence was not affected. | ||
+ | <pre>New 230206 TATTGTTTATAAGCATAGTCACAAGTGCATAAAAACTATGAACGGTATTGATGATCTCCT 230265 | ||
+ | ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | ||
+ | Old 230211 TATTGTTTATAAGCATAGTCACAAGTGCATAAAAACTATGAACGGCATTGATGATCTCCT 230270</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | rowspan="3"| 2011-02-03 | ||
+ | | rowspan="3"| [https://www.yeastgenome.org/locus/YGL116W YGL116W], [https://www.yeastgenome.org/locus/YGL117W YGL117W] | ||
+ | | 289567 | ||
+ | | 289567 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 289527 | ||
+ | | 289527 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 289525 | ||
+ | | 289525 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
+ | |- | ||
+ | | || colspan="6" | Three separate single nucleotide insertions were made in the intergenic region between ORFs YGL117W and CDC20/YGL116W. | ||
+ | <pre>New 289484 CAATTTGATTGCCGAAAGAGGCAAAACGTAAATAGGGTTGGTTTCAAATAATTAGAAGGA 289543 | ||
+ | |||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| | ||
+ | Old 289490 CAATTTGATTGCCGAAAGAGGCAAAACGTAAATAGG-TT-GTTTCAAATAATTAGAAGGA 289547 | ||
+ | New 289544 GCATCGGAAAAATGCAACGAGCAAAACCTCTAGCAGGCAAAGAATTTATCACCTTTAAAA 289603 | ||
+ | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | ||
+ | Old 289548 GCATCGGAAAAATGCAACGA-CAAAACCTCTAGCAGGCAAAGAATTTATCACCTTTAAAA 289606</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | rowspan="2"| 2011-02-03 | ||
+ | | rowspan="2"| [https://www.yeastgenome.org/locus/YGL060W YGL060W], [https://www.yeastgenome.org/locus/YGL061C YGL061C] | ||
+ | | 390008 | ||
+ | | 390008 | ||
+ | | Deletion | ||
+ | | G | ||
+ | | | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 389965 | ||
+ | | 389965 | ||
+ | | Deletion | ||
+ | | G | ||
+ | | | ||
+ | |- | ||
+ | | || colspan="6" | Two separate single nucleotide deletions were made in the intergenic region between ORFs DUO1/YGL061C and YBP2/YGL060W. | ||
+ | <pre>New 389924 TCTAAAAGGCTAAAAGAACTCACCGTCAAGAGGAAGGG-CTCAGAAAGTATGGGTGAGTC 389982 | ||
+ | |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | ||
+ | Old 389927 TCTAAAAGGCTAAAAGAACTCACCGTCAAGAGGAAGGGGCTCAGAAAGTATGGGTGAGTC 389986 | ||
+ | New 389983 AATTGAAACAATTTGTAAAAG-CCTTGTCAGGGCTTTCCAAGAGGAGAAGGATGATTTTG 390041 | ||
+ | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | ||
+ | Old 389987 AATTGAAACAATTTGTAAAAGGCCTTGTCAGGGCTTTCCAAGAGGAGAAGGATGATTTTG 390046</pre> | ||
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
Revision as of 11:34, 27 September 2019
This page lists all sequence and annotation changes that have been made to the Chromosome VII systematic reference sequence since its intial release on 1996-07-31. The sequence of Chromosome VII has been updated 125 times, affecting 87 features. The annotation of Chromosome VII has been updated 54 times, affecting 88 features.
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YGR067C | 622408 | 622408 | Substitution | A | T |
A single nucleotide substitution was made in the stop codon of ORF YGR067C, destroying it and increasing the length of the annotated protein by 10 amino acids.
New 622362 TCTTTGGCCATTATTTTATTTGGCTAAAAATTTCAATGTTTTTACTTTGTTTATTGTCAG 622421 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 622366 TCTTTGGCCATTATTTTATTTGGCTAAAAATTTCAATGTTTTAACTTTGTTTATTGTCAG 622425 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL197W | 125909 | 125910 | Substitution | CG | GC |
125487 | 125487 | Insertion | A | |||
125495 | 125495 | Deletion | A | |||
Nucleotide changes within the coding region of MDS3/YGL197W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 262-264 are now QSE rather than HPK, and residue 403 is now Alanine rather than Arginine.
New 125449 TAGACATCTATAACATCTCACAGAATTGCTGGCAATCCGAAA-CCATACCCAAACAACCG 125507 |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| Old 125454 TAGACATCTATAACATCTCACAGAATTGCTGGCA-TCCGAAAACCATACCCAAACAACCG 125512 New 125868 ATATACGATATTAACTCCGGAAAGTGGTCACGAGTCGCTACCGCCTGCCCTGACTGCGAT 125927 |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 125873 ATATACGATATTAACTCCGGAAAGTGGTCACGAGTCCGTACCGCCTGCCCTGACTGCGAT 125932 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL041C, YGL041W-A | 419056 | 419056 | Deletion | G | |
A single nucleotide was deleted within the coding regions of overlapping ORFs YGL041W-A and YGL041C, resulting in altered protein sequences for both ORFs. The YGL041W-A C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 72 amino acids longer. The YGL041C N-terminus remains the same, but the C-terminus has changed and the annotated protein is truncated by one-third of its length (reduced from 104 amino acids to 67 amino acids).
New 419013 ACTCATGGATCAAATAAATTCGAGGCCTAATGTTCTGG-AAAAGTTAGAAAAGGTTAGCA 419071 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Old 419018 ACTCATGGATCAAATAAATTCGAGGCCTAATGTTCTGGGAAAAGTTAGAAAAGGTTAGCA 419077 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL214W | 90019 | 90019 | Insertion | T | |
A single T nucleotide was inserted within ORF YGL214W very near its 5' end, altering its coding sequence. The reading frame and stop remain the same, but the start has been shifted downstream four nucleotides and the annotated protein is now one amino acid shorter.
New 89994 CCAAAAAGAATAATGGATGATTGTAAGGTTACATGCAATATATCAAGATATTACTAGAGA 90053 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 89999 CCAAAAAGAATAATGGATGAT-GTAAGGTTACATGCAATATATCAAGATATTACTAGAGA 90057 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL129C | 269097 | 269097 | Deletion | A | |
A single nucleotide was deleted within ORF RSM23/YGL129C, altering its coding sequence. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 38 amino acids shorter.
New 269076 TATTCTGATACGTATA-CCACGTGGCTTGTACTTGTTCTCTTGTTAATGTTTTCCCTCGA 269134 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 269081 TATTCTGATACGTATAACCACGTGGCTTGTACTTGTTCTCTTGTTAATGTTTTCCCTCGA 269140 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL056C | 397085 | 397086 | Substitution | CG | GC |
397241 | 397241 | Substitution | A | C | ||
Nucleotide changes within the coding region of SDS23/YGL056C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 180 is now Glycine rather than Alanine.
New 397060 GTGTCAACTTTACTATCTCGCCCACGGGCACGGACTTACCATTCTGGCAGTCTGAGGTTA 397119 ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 397066 GTGTCAACTTTACTATCTCCGCCACGGGCACGGACTTACCATTCTGGCAGTCTGAGGTTA 397125 New 397190 TGTTAAACAATTCATGTCTCCCGGAAAATTCTCCACAGGCAAAGACGTTAGCTGGTGCTT 397249 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 397196 TGTTAAACAATTCATGTCTCCCGGAAAATTCTCCACAGGCAAAGAAGTTAGCTGGTGCTT 397255 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR058W | 607109 | 607109 | Substitution | T | G |
A single nucleotide substitution within the coding region of PEF1/YGR058W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 324 is now Aspartic Acid rather than Tyrosine.
New 607062 TAATCAAGAAGGCATTGCAACCATACAGTACAAAGATTTTATCGATGCTACATTATATTT 607121 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 607066 TAATCAAGAAGGCATTGCAACCATACAGTACAAAGATTTTATCTATGCTACATTATATTT 607125 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR271W | 1033108 | 1033108 | Substitution | C | T |
1032373 | 1032373 | Substitution | G | A | ||
1031948 | 1031948 | Substitution | C | A | ||
Nucleotide substitutions within the coding region of SLH1/YGR271W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 51 is now Glutamine rather than Proline, residue 193 is now Lysine rather than Glutamic Acid, and residue 438 is now Serine rather than Proline.
New 1031905 TTTGATGACGAGCTAAAAAAAGTCCAAAAGGATGAACAAAATCAAAGAACTGAACTAACT 1031964 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 1031911 TTTGATGACGAGCTAAAAAAAGTCCAAAAGGATGAACCAAATCAAAGAACTGAACTAACT 1031970 New 1032325 CCAGAGTTCCTGACACAGCAAGATATCAGGAATCAAGTTTTGAAAAGTGCAGAGGATGCC 1032384 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 1032331 CCAGAGTTCCTGACACAGCAAGATATCAGGAATCAAGTTTTGGAAAGTGCAGAGGATGCC 1032390 New 1033055 AATTACTAATTATTGATGAAGTTCATTTACTGCACGAAGATAGAGGTTCGGTTATTGAAA 1033114 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 1033061 AATTACTAATTATTGATGAAGTTCATTTACTGCACGAAGATAGAGGTCCGGTTATTGAAA 1033120 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL109W | 303591 | 303591 | Substitution | A | C |
A single nucleotide substitution within the coding region of YGL109W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 26 is now Glutamine rather than Lysine.
New 303574 GAATGGAAGGCCAACAAAAAAATTCTTGTACAATTGCATATATTGATTCATTACAATATT 303633 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 303577 GAATGGAAGGCCAAAAAAAAAATTCTTGTACAATTGCATATATTGATTCATTACAATATT 303636 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR070W | 630688 | 630688 | Substitution | C | T |
A single nucleotide substitution within the coding region of ROM1/YGR070W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 960 is now Valine rather than Alanine.
New 630642 GTAAAAGAATCATTATGATTGCACATCATTTTTTGCACGCCGTACAATTATTGATTGTTA 630701 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 630646 GTAAAAGAATCATTATGATTGCACATCATTTTTTGCACGCCGCACAATTATTGATTGTTA 630705 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL059W | 392896 | 392896 | Insertion | A | |
392901 | 392901 | Deletion | A | |||
Nucleotide changes within the coding region of PKP2/YGL059W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 224-225 are now SI rather than VY.
New 392862 TCAAGAAGATTGATTGTAGAGGAACACGTCAGTAT-CACAGCCAACTACACTAGTGGTAA 392920 |||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| Old 392867 TCAAGAAGATTGATTGTAGAGGAACACGTC-GTATACACAGCCAACTACACTAGTGGTAA 392925 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL124C | 275965 | 275965 | Substitution | C | G |
276384 | 276384 | Substitution | A | T | ||
Nucleotide changes within the coding region of MON1/YGL124C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 113 is now Serine rather than Cysteine.
New 275925 GATTCAACAATTCGTTCGAGGACTCGCCTCTTTCGGATTGAGCCATTAGTAATATAGGTG 275984 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 275931 GATTCAACAATTCGTTCGAGGACTCGCCTCTTTCCGATTGAGCCATTAGTAATATAGGTG 275990 New 276345 TGTCCAAATAAGGACCGAAATCCTTTTTTGGACTGTTTAGTGCTCTCGTTGTATCATCAT 276404 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 276351 TGTCCAAATAAGGACCGAAATCCTTTTTTGGACAGTTTAGTGCTCTCGTTGTATCATCAT 276410 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR221C | 938725 | 938725 | Deletion | T | |
938792 | 938792 | Insertion | T | |||
Nucleotide changes within the coding region of TOS2/YGR221C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 69-91 are now EPSMQDFDPNFEGDLYYLPKMDS rather than NLLCRILTQILRAIYTIYRRWIT.
New 938681 TTCTGTGGCATTGCTGTCTGAGTTTGCAGAATTCATAGAAG-AATCCATCTTCGGTAAAT 938739 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 938684 TTCTGTGGCATTGCTGTCTGAGTTTGCAGAATTCATAGAAGTAATCCATCTTCGGTAAAT 938743 New 938740 AGTATAAATCGCCCTCAAAATTTGGGTCAAAATCCTGCATAGAAGGTTCTTTTTTGCATC 938799 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 938744 AGTATAAATCGCCCTCAAAATTTGGGTCAAAATCCTGCATAGAAGGTTC-TTTTTGCATC 938802 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR145W | 783805 | 783805 | Substitution | A | C |
A single nucleotide substitution within the coding region of ENP2/YGR145W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 678 is now Aspartic Acid rather than Glutamic Acid.
New 783751 ATTATAAATCCAGGCGTCATGATAATTCATCGGATGAAGAAGGTATTGACGAAAATGGTA 783810 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 783756 ATTATAAATCCAGGCGTCATGATAATTCATCGGATGAAGAAGGTATTGAAGAAAATGGTA 783815 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR153W | 796569 | 796570 | Substitution | AC | CA |
Nucleotide substitutions within the coding region of YGR153W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 158 is now Alanine rather than Aspartic Acid.
New 796531 TAAAACCGTGTGGTTGTCATAAATCGAGAAAAGCAAAATGCTTCAAAGAACTGGAGATGG 796590 ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 796536 TAAAACCGTGTGGTTGTCATAAATCGAGAAAAGACAAATGCTTCAAAGAACTGGAGATGG 796595 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR227W | 948219 | 948219 | Substitution | A | T |
A single nucleotide substitution within the coding region of DIE2/YGR227W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 266 is now Isoleucine rather than Lysine.
New 948200 GTTCTGCCCTATATGATAAATTTTGTTTTGTTCTTCATTTATCTGATTTGGAACAGATCC 948259 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 948203 GTTCTGCCCTATATGAAAAATTTTGTTTTGTTCTTCATTTATCTGATTTGGAACAGATCC 948262 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL063W | 384063 | 384064 | Substitution | CG | GC |
Nucleotide substitutions within the coding region of PUS2/YGL063W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 136 is now Cysteine rather than Serine.
New 384044 CGAAACGTGGGGGGATGCTACCGCGAAGACGGCTCGCAAGAGGTGTGGGATACGTTCCTG 384103 |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 384047 CGAAACGTGGGGGGATCGTACCGCGAAGACGGCTCGCAAGAGGTGTGGGATACGTTCCTG 384106 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | ARS714, tW(CCA)G1 | 286729 | 286729 | Deletion | T | |
286355 | 286355 | Insertion | C | |||
A single nucleotide insertion and a single nucleotide deletion were made in the intergenic region between ARS714 and tRNA-Trp tW(CCA)G1.
New 286305 CACCATTAACTTTACAACATTACATAATATGACATTCCACAGAACCTCTCTATTCCATTT 286364 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 286311 CACCATTAACTTTACAACATTACATAATATGACATTCCACAGAAC-TCTCTATTCCATTT 286369 New 286675 TGCATTTATCTCAGGATATAATGATCCCGTTATCCAATCGATATAGCTT-CCTCAGGTTT 286733 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 286680 TGCATTTATCTCAGGATATAATGATCCCGTTATCCAATCGATATAGCTTTCCTCAGGTTT 286739 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | ARS710 | 203957 | 203957 | Substitution | C | A |
A single nucleotide substitution was made within ARS710.
New 203926 AGATTTTTGATGTTTACATATGAGCAGTTTGATAGAAATTTTGCAATTTTTTATATTTAT 203985 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 203932 AGATTTTTGATGTTTACATATGAGCCGTTTGATAGAAATTTTGCAATTTTTTATATTTAT 203991 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL036W, YGL037C | 428252 | 428252 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs PNC1/YGL037C and YGL036W.
New 428202 ATTCACTTTTCCAGTACGTAACACCACGCGGCGCCCCTTTGTGGGGCCTGCCCCTTTTTT 428261 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 428208 ATTCACTTTTCCAGTACGTAACACCACGCGGCGCCCCTTTGTGGG-CCTGCCCCTTTTTT 428266 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | ARS734,YGR253C | 999367 | 999367 | Substitution | A | C |
999335 | 999335 | Insertion | C | |||
999271 | 999271 | Substitution | C | T | ||
Two separate single nucleotide substitutions and a single nucleotide insertion were made in the intergenic region between ORF PUP2/YGR253C and ARS734.
New 999218 AATTTCCTAGGTTACTCTTTTGCCACCGGTCTTGGTTTATGATAACCCTGTATAATGAAA 999277 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 999223 AATTTCCTAGGTTACTCTTTTGCCACCGGTCTTGGTTTATGATAACCCCGTATAATGAAA 999282 New 999318 AGCACTAAATTATCCTTACGGACTTGGGCTACATTCATGTTTGCACGCTTAATAAAAAAT 999377 ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| Old 999323 AGCACTAAATTAT-CTTACGGACTTGGGCTACATTCATGTTTGCAAGCTTAATAAAAAAT 999381 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | ARS734 | 999676 | 999676 | Deletion | T | |
A single nucleotide deletion was made within ARS734.
New 999628 CTGAGCTTTTATCTTCATTAATATATAGTAATTACAACATGTTA-TTGAAATGCACAGCA 999686 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 999632 CTGAGCTTTTATCTTCATTAATATATAGTAATTACAACATGTTATTTGAAATGCACAGCA 999691 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR216C, YGR217W | 924488 | 924488 | Insertion | C | |
924482 | 924482 | Insertion | A | |||
Two separate single nucleotide insertions were made in the intergenic region between ORFs GPI1/YGR216C and CCH1/YGR217W.
New 924451 GTAATTTGGCATGTCATTTAACTGTATAAAACCGCCCCTGAATTCGAAGGTTCCTGTTCA 924510 ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| Old 924456 GTAATTTGGCATGTCATTTAACTGTAT-AAACCG-CCCTGAATTCGAAGGTTCCTGTTCA 924513 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR054W | 598535 | 598535 | Substitution | C | T |
A single nucleotide substitution was made within ORF YGR054W. Note that the protein sequence was not affected.
New 598482 TAAAGAAATTAAGGGCTATTGAAACCTTGAAGGAAAGACAGGCCGTCGGTGACAAACTAG 598541 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 598486 TAAAGAAATTAAGGGCTATTGAAACCTTGAAGGAAAGACAGGCCGTCGGCGACAAACTAG 598545 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR236C, YGR237C | 962981 | 962981 | Deletion | T | |
A single nucleotide deletion was made in the intergenic region between ORFs SPG1/YGR236C and YGR237C.
New 962959 CCCTCACGTCGCGAAGCA-TTTTTAACAGTGTTATCCCAGTATCCCGTAATTCTTCTCTT 963017 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 962963 CCCTCACGTCGCGAAGCATTTTTTAACAGTGTTATCCCAGTATCCCGTAATTCTTCTCTT 963022 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL158W, tL(CAA)G1 | 206467 | 206467 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between tRNA-Leu tL(CAA)G1 and ORF RCK1/YGL158W.
New 206446 GAGACCCCGCCCTGCGGAGAGGGGCAAACAATTCTAGCAGAAAAAAATCAGTGGAAAAAA 206505 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 206452 GAGACCCCGCCCTGCG-AGAGGGGCAAACAATTCTAGCAGAAAAAAATCAGTGGAAAAAA 206510 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL145W | 230256 | 230256 | Substitution | C | T |
A single nucleotide substitution was made within ORF TIP20/YGL145W. Note that the protein sequence was not affected.
New 230206 TATTGTTTATAAGCATAGTCACAAGTGCATAAAAACTATGAACGGTATTGATGATCTCCT 230265 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 230211 TATTGTTTATAAGCATAGTCACAAGTGCATAAAAACTATGAACGGCATTGATGATCTCCT 230270 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL116W, YGL117W | 289567 | 289567 | Insertion | G | |
289527 | 289527 | Insertion | G | |||
289525 | 289525 | Insertion | G | |||
Three separate single nucleotide insertions were made in the intergenic region between ORFs YGL117W and CDC20/YGL116W.
New 289484 CAATTTGATTGCCGAAAGAGGCAAAACGTAAATAGGGTTGGTTTCAAATAATTAGAAGGA 289543 |||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| Old 289490 CAATTTGATTGCCGAAAGAGGCAAAACGTAAATAGG-TT-GTTTCAAATAATTAGAAGGA 289547 New 289544 GCATCGGAAAAATGCAACGAGCAAAACCTCTAGCAGGCAAAGAATTTATCACCTTTAAAA 289603 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 289548 GCATCGGAAAAATGCAACGA-CAAAACCTCTAGCAGGCAAAGAATTTATCACCTTTAAAA 289606 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL060W, YGL061C | 390008 | 390008 | Deletion | G | |
389965 | 389965 | Deletion | G | |||
Two separate single nucleotide deletions were made in the intergenic region between ORFs DUO1/YGL061C and YBP2/YGL060W.
New 389924 TCTAAAAGGCTAAAAGAACTCACCGTCAAGAGGAAGGG-CTCAGAAAGTATGGGTGAGTC 389982 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Old 389927 TCTAAAAGGCTAAAAGAACTCACCGTCAAGAGGAAGGGGCTCAGAAAGTATGGGTGAGTC 389986 New 389983 AATTGAAACAATTTGTAAAAG-CCTTGTCAGGGCTTTCCAAGAGGAGAAGGATGATTTTG 390041 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 389987 AATTGAAACAATTTGTAAAAGGCCTTGTCAGGGCTTTCCAAGAGGAGAAGGATGATTTTG 390046 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. |