Difference between revisions of "Chromosome III History"

From SGD-Wiki
Jump to: navigation, search
Line 1: Line 1:
This page lists all sequence and annotation changes that have been made to the Chromosome III systematic reference sequence since its intial release on 1996-07-31. <br>
 
*The sequence of Chromosome III has been updated '''705''' times, affecting '''132''' features. <br>
 
*The annotation of Chromosome III has been updated '''53''' times, affecting '''108''' features. <br>
 
Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site].
 
 
__FORCETOC__
 
 
 
=Sequence Changes=
 
=Sequence Changes=
  
{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
+
{|border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
 
 
 
! Date  !! Affected Features !! Start Coordinate of Change !! End Coordinate of Change !! Type of Change !! Old Sequence !! New Sequence
 
! Date  !! Affected Features !! Start Coordinate of Change !! End Coordinate of Change !! Type of Change !! Old Sequence !! New Sequence
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
+
| rowspan="3"| 2011-02-03
| [https://www.yeastgenome.org/locus/YCL002C YCL002C]
+
| rowspan="3"| [https://www.yeastgenome.org/locus/YBR068C YBR068C]
| 110880
+
| 375081
| 110880
+
| 375081
| Insertion
+
| Substitution
|  
+
| C
 +
| A
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 375272
 +
| 375272
 +
| Substitution
 +
| T
 +
| A
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 374011
 +
| 374011
 +
| Substitution
 +
| T
 
| A
 
| A
 
|-
 
|-
| || colspan="6" | A single nucleotide was inserted within ORF YCL002C, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 12 amino acids longer.
+
| || colspan="6" | Nucleotide substitutions within the coding region of BAP2/YBR068C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 139 is now Valine rather than Glutamic Acid, and residue 203 is now Tryptophan rather than Glycine.
<pre>New 110871 TATGACCAATAAGGTGACAAATTGTATCAATTTTACCCAAAAGGGCGTTGAATTAAATGGTATCTCGTAA 110940
+
<pre>New   373969  GAAGTCAAGGTCAATCTTGTCGAGGGGATTTAATAGCGTAAAATCACGGTTGTAAACCAT  374028
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+
              ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old 110871 TATGACCAAT-AGGTGACAAATTGTATCAATTTTACCCAAAAGGGCGTTGAATTAAATGGTATCTCGTAA 110939</pre>
+
Old    373966  GAAGTCAAGGTCAATCTTGTCGAGGGGATTTAATAGCGTAAAATCTCGGTTGTAAACCAT  374025
 +
New    375049 AAGAATATAAATGTCCGGATTTATTTTATCATTCCAAAATTGAATAGTCATAGACGCGGT  375108
 +
              ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
 +
Old    375046  AAGAATATAAATGTCCGGATTTATTTTATCATTCCCAAATTGAATAGTCATAGACGCGGT  375105
 +
New    375229  ATAGGTTACCGCCATCTCACCTGCAGCTTGGATCATGAAGTACGTCACGAAAGAAACCAA  375288
 +
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
 +
Old   375226  ATAGGTTACCGCCATCTCACCTGCAGCTTGGATCATGAAGTACGTCTCGAAAGAAACCAA 375285</pre>
 
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
+
| rowspan="2"| 2011-02-03
| [https://www.yeastgenome.org/locus/YCR091W YCR091W]
+
| rowspan="2"| [https://www.yeastgenome.org/locus/YBR097W YBR097W]
| 275421
+
| 439496
| 275421
+
| 439496
 +
| Substitution
 +
| T
 +
| G
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 437344
 +
| 437344
 
| Substitution
 
| Substitution
 
| A
 
| A
 
| G
 
| G
 
|-
 
|-
| || colspan="6" | A single nucleotide substitution in the coding region of KIN82/YCR091W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 341 is now Valine rather than Methionine.
+
| || colspan="6" | Nucleotide change(s) in the coding region of VPS15/YBR097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 134 is now Alanine rather than Threonine, and residue 851 is now Arginine rather than Isoleucine.
<pre>New    275400 GGTGACGTAGGTAAAGTGTATTTAGTGAGGGAACGCGATACCAACCAGATATTCGCCCTG 275459
+
<pre>New    437325  ATTCATTGCTTTCCAGTTGTTAAATGCATTAAAGGACATTCATAATCTGAATATTGTCCA  437384
               |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
+
              ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Old    275397 GGTGACGTAGGTAAAGTGTATTTAATGAGGGAACGCGATACCAACCAGATATTCGCCCTG 275456</pre>
+
Old    437319  ATTCATTGCTTTCCAGTTGTTAAATACATTAAAGGACATTCATAATCTGAATATTGTCCA  437378
 +
New    439485 CTTAACTGCTGAAGACAGAAATTGGATTGATAAGTTCCACATTATTGGGCTAACAGAAAA 439544
 +
               ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
 +
Old    439479 CTTAACTGCTGAAGACATAAATTGGATTGATAAGTTCCACATTATTGGGCTAACAGAAAA 439538</pre>
 
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2011-02-03
 
| 2011-02-03
| [https://www.yeastgenome.org/locus/YCR077C YCR077C]
+
| [https://www.yeastgenome.org/locus/YBR045C YBR045C]
| 250563
+
| 328382
| 250563
+
| 328382
| Substitution
+
| Insertion
| A
+
| || T
| T
 
 
|-
 
|-
| || colspan="6" | A single nucleotide substitution in the coding region of PAT1/YCR077C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 688 is now Aspartic Acid rather than Valine.
+
| || colspan="6" | A single nucleotide was inserted within ORF GIP1/YBR045C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 66 amino acids longer.
<pre>New    250560 ATGTGGTCGTTATATTCCCTTGGAGGGAAAATCAGCTGAATCTTACTTTCCAATGAAGTG 250619
+
<pre>New    328369 CTCAGTCTATAATTTTCTGCTTCATTTCTCTGCCTTTTATACTCTGTATATTGAAAATAA 328428
               |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
+
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    250557 ATGTGGACGTTATATTCCCTTGGAGGGAAAATCAGCTGAATCTTACTTTCCAATGAAGTG 250616</pre>
+
Old    328368 CTCAGTCTATAATTT-CTGCTTCATTTCTCTGCCTTTTATACTCTGTATATTGAAAATAA 328426</pre>
 
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2011-02-03
 
| 2011-02-03
| [https://www.yeastgenome.org/locus/YCR020W-B YCR020W-B], [https://www.yeastgenome.org/locus/YCR021C YCR021C]
+
| [https://www.yeastgenome.org/locus/YBR044C YBR044C]
| 155961
+
| 324366
| 155961
+
| 324366
 
| Insertion
 
| Insertion
|  
+
|
| TG
+
| T
 
|-
 
|-
| || colspan="6" | A dinucleotide insertion was made in the intergenic region between ORFs YCR020W-B and YCR021C.
+
| || colspan="6" | One nucleotide was inserted within ORF TCM62/YBR044C, very near its 3' end, altering its coding sequence. The start, stop, and majority of reading frame remain the same, but the C-terminus is different and the annotated protein sequence is now one amino acid shorter.
<pre>New  155941 ATTAGATTATTAATTATTGTGTTTGTGTATATAATTTATTTTGCATATTTCATAAAGAAA  156000
+
<pre>New   324349 TGTGCCGTTCAGGCTTTTTGTATACACATGTGATAATTGTATTACAGCTTGTAAGTAATT 324408
            ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
+
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old  155939  ATTAGATTATTAATTATTGTGTT--TGTATATAATTTATTTTGCATATTTCATAAAGAAA 155996</pre>
+
Old   324349 TGTGCCGTTCAGGCTTTT-GTATACACATGTGATAATTGTATTACAGCTTGTAAGTAATT 324407</pre>
 
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
+
| rowspan="2"| 2011-02-03
| [https://www.yeastgenome.org/locus/YCR019W YCR019W]
+
| rowspan="2"| [https://www.yeastgenome.org/locus/YBR007C YBR007C]
| 152641
+
| 250403
| 152641
+
| 250403
 
| Substitution
 
| Substitution
 +
| C
 +
| G
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 250039
 +
| 250039
 +
| Substitution
 +
| T
 
| G
 
| G
| A
 
 
|-
 
|-
| || colspan="6" | A single nucleotide substitution was made in the intergenic region upstream of ORF YCR019W/MAK32.
+
| || colspan="6" | Two nucleotide substitutions within the coding region of DSF2/YBR007C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 205 is now Serine rather than Arginine, and residue 327 is now Proline rather than Threonine.
<pre>New  152641 AAATTTCCGAGATCCTCAGCTGACAAATAAATGTCATATCAAGACAATAAACGGTAGTGC 152700
+
<pre>New   250012  AGACCGTTTAGGAGATGGTTTGATGGGTGTTGTATCACTCTTAGTTAACTTGAGTTTGGA  250071
            || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Old  152639  AAGTTTCCGAGATCCTCAGCTGACAAATAAATGTCATATCAAGACAATAAACGGTAGTGC 152698</pre>
+
Old    250013 AGACCGTTTAGGAGATGGTTTGATGGTTGTTGTATCACTCTTAGTTAACTTGAGTTTGGA 250072
 +
New    250372  CCTATATTTCTCGAAGTTGAAAGGATTAGGGCTATTTGTGCTTCTATTGCCATTTTCAAG 250431
 +
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
 +
Old   250373 CCTATATTTCTCGAAGTTGAAAGGATTAGGCCTATTTGTGCTTCTATTGCCATTTTCAAG 250432</pre>
 
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="2"| 2011-02-03
+
| rowspan="3"| 2011-02-03
| rowspan="2"| [https://www.yeastgenome.org/locus/YCR024C YCR024C], [https://www.yeastgenome.org/locus/YCR024C-B YCR024C-B]
+
| rowspan="3"| [https://www.yeastgenome.org/locus/YBL105C YBL105C]
| 162275
+
| 17455
| 162275
+
| 17455
 
| Substitution
 
| Substitution
 
| A
 
| A
| G
+
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 162392
+
| 15835
| 162392
+
| 15835
 
| Substitution
 
| Substitution
 +
| T
 
| C
 
| C
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 15332
 +
| 15332
 +
| Substitution
 
| G
 
| G
 +
| C
 
|-
 
|-
| || colspan="6" | Two single nucleotide substitutions were made in the intergenic region between ORFs YCR024C and YCR024C-B.
+
| || colspan="6" | The substitution of three nucleotides within the coding region of PKC1/YBL105C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 81 is now Cysteine rather than Phenylalanine, residue 621 is now Arginine rather than Lysine, and residue 789 is now Alanine rather than Proline.
<pre>New  162241 TGTTCTCTTTCTTTCTCTCTTAGTAAGCGATAAGTCGAGCTCTACTTAAATTGTGGTACG 162300
+
<pre>New   15301  TGCGGAGATTGTTGATCAGTGGTTCTGGAGGCATGAGTACTTGTAGGAGCCAAGGACACT 15360
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
+
              ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old  162237 TGTTCTCTTTCTTTCTCTCTTAGTAAGCGATAAGTCGAACTCTACTTAAATTGTGGTACG 162296
+
Old    15301  TGCGGAGATTGTTGATCAGTGGTTCTGGAGGGATGAGTACTTGTAGGAGCCAAGGACACT 15360
 +
New    15791  TAAATTTATTTAGTTTCTCACGCCCGTGCGTTTGTAGTGAAATTCTTTTATCAATAATAG 15850
 +
              |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
 +
Old   15791  TAAATTTATTTAGTTTCTCACGCCCGTGCGTTTGTAGTGAAATTTTTTTATCAATAATAG 15840
 +
New    17411  CATTTGGCGATTTGGTAGAAAGAAACCCGTATTCCTTCGAATTGCATCGCTCATTATCTT 17470
 +
              |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
 +
Old    17411  CATTTGGCGATTTGGTAGAAAGAAACCCGTATTCCTTCGAATTGAATCGCTCATTATCTT 17470</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
New  162361 TAACTATAAGTTGTGCATACTCATACTCCACACTCGACGGCCTAATCTCTGTAAGGATTG  162420
+
|- style="height:30px; width:30px; text-align:center;"
            ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
+
| 2011-02-03
Old  162357  TAACTATAAGTTGTGCATACTCATACTCCACACTCCACGGCCTAATCTCTGTAAGGATTG 162416</pre>
+
| [https://www.yeastgenome.org/locus/YBL057C YBL057C]
 +
| 113437
 +
| 113437
 +
| Deletion
 +
| G
 +
|
 +
|-
 +
| || colspan="6" | One nucleotide was deleted within ORF PTH2/YBL057C, near its 5' end, altering its coding sequence. The stop and reading frame remain the same, but the start has been moved 18 nucleotides downstream and the annotated protein sequence is now six amino acids shorter.
 +
<pre>New   113393 ATGGTGTAATTCGAAGAAACTGTCATCTTTTCCATTAAAAAG-ACGTTATCATGTTACTC 113451
 +
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
 +
Old   113395 ATGGTGTAATTCGAAGAAACTGTCATCTTTTCCATTAAAAAGGACGTTATCATGTTACTC 113454</pre>
 
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="2"| 2011-02-03
+
| rowspan="3"| 2011-02-03
| rowspan="2"| [https://www.yeastgenome.org/locus/YCL012C YCL012C]
+
| rowspan="3"| [https://www.yeastgenome.org/locus/YBL068W YBL068W]
| 101655
+
| 92918
| 101655
+
| 92920
 +
| Deletion
 +
| CCG
 +
|
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 92916
 +
| 92916
 
| Substitution
 
| Substitution
| T
+
| G
 
| A
 
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 101652
+
| 92679
| 101652
+
| 92679
 
| Substitution
 
| Substitution
 +
| C
 
| A
 
| A
| T
 
 
|-
 
|-
| || colspan="6" | Two single nucleotide substitutions were made within the intron of YCL012C.
+
| || colspan="6" | Two nucleotide substitutions and one trinucleotide deletion were made within the ORF PRS4/YBL068W, altering its coding sequence. The start, stop, and reading frame remain the same, but the annotated protein is now one amino acid shorter.
<pre>New  101641  AGCTGTTAGTATTTAGATACGGTTTGCACTTTGCATTTTCAAATGCTTAAATATACATAC  101700
+
<pre>New   92637  TTAATGATTTCTTGATGGAATTATTAATTTTAATTCATGCTTGCAAAATTGCATCTGCAA 92696
            ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
+
              |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old  101641 AGCTGTTAGTAATTTGATACGGTTTGCACTTTGCATTTTCAAATGCTTAAATATACATAC 101700</pre>
+
Old   92635  TTAATGATTTCTTGATGGAATTATTAATTTTAATTCATGCTTGCCAAATTGCATCTGCAA 92694
 +
New    92877  ACAACCTATATGCAGAACCAAGTGTTTTAAATTATATTAGAAC---GAAAACAGATTTCG 92933
 +
              ||||||||||||||||||||||||||||||||||||||||| |  ||||||||||||||
 +
Old    92875  ACAACCTATATGCAGAACCAAGTGTTTTAAATTATATTAGAGCCCGGAAAACAGATTTCG 92934</pre>
 
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2011-02-03
 
| 2011-02-03
| [https://www.yeastgenome.org/locus/YCL001W YCL001W], [https://www.yeastgenome.org/locus/YCL002C YCL002C]
+
| [https://www.yeastgenome.org/locus/YBR078W YBR078W]
| 111718
+
| 394727
| 111718
+
| 394727
 
| Insertion
 
| Insertion
|  
+
|
 
| C
 
| C
 
|-
 
|-
| || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs YCL002C and YCL001W.
+
| || colspan="6" | One nucleotide was inserted within ORF ECM33/YBR078W, very near its 3' end, altering its coding sequence. The start, stop, and vast majority of reading frame remain the same, but the C-terminus is different and the annotated protein sequence is now 39 amino acids shorter.
<pre>New  111661 AACAATAACAAGCATGTGAATGATTCAATATAATTGCTTCGCAGGGCTCCTCAACCTCTCCTCTGGAAAA  111730
+
<pre>New   394715 TGCTGCTGTTGGCGTTGCCTTACTATAAGATTAAAGCAACAATTTGTGTTTCTATTATTA 394774
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
+
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old  111660  AACAATAACAAGCATGTGAATGATTCAATATAATTGCTTCGCAGGGCTCCTCAACCTCT-CTCTGGAAAA 111728</pre>
+
Old   394710 TGCTGCTGTTGGCGTTGC-TTACTATAAGATTAAAGCAACAATTTGTGTTTCTATTATTA 394768</pre>
 
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
+
| rowspan="2"| 2011-02-03
| [https://www.yeastgenome.org/locus/YCR072C YCR072C], [https://www.yeastgenome.org/locus/YCR073C YCR073C]
+
| rowspan="2"| [https://www.yeastgenome.org/locus/YBR076W YBR076W]
| 242444
+
| 391277
| 242444
+
| 391277
 +
| Insertion
 +
|
 +
| A
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 390442
 +
| 390442
 
| Deletion
 
| Deletion
| T
+
| G
 
|  
 
|  
 
|-
 
|-
| || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs YCR072C and YCR073C.
+
| || colspan="6" | A single G nucleotide was deleted near the 3' end, and a single A nucleotide was inserted near the 5' end of ORF ECM8/YBR076W, altering its coding sequence. The ORF was extended 49 amino acids at the N-terminus and shortened 34 amino acids at the C-terminus, resulting in a protein that is 15 amino acids larger. Although this protein is altered at both ends, the central portion of the protein remains the same.
<pre>New  242401  CTTGTGATATATGTCTTTTAAAGATACTCTTTTTGAAGCTCATCGCA-TTTTTTTTTTTT 242459
+
<pre>New   390408 AAACCATCAAGAACAAAATATTCCCACAAAGGAAAATATT-CAACGATAGCGAAAATTTT 390466
            ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
+
              |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old  242397 CTTGTGATATATGTCTTTTAAAGATACTCTTTTTGAAGCTCATCGCATTTTTTTTTTTTT 242456</pre>
+
Old   390402 AAACCATCAAGAACAAAATATTCCCACAAAGGAAAATATTGCAACGATAGCGAAAATTTT 390461
 +
New    391247  CGAACGAAATGTTTATATGTCCAAGTTATAACAAAAAGCAATTGATTGTGTACGCAAGAT  391306
 +
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
 +
Old    391242  CGAACGAAATGTTTATATGTCCAAGTTATAACAAAA-GCAATTGATTGTGTACGCAAGAT 391300</pre>
 
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2006-01-12
+
| 2011-02-03
| [https://www.yeastgenome.org/locus/YCL025C YCL025C]
+
| [https://www.yeastgenome.org/locus/YBR137W YBR137W]
| 76147
+
| 513365
| 76147
+
| 513365
| Insertion
+
| Substitution
|  
+
| A
 
| G
 
| G
 
|-
 
|-
| || colspan="6" | SGD confirmed the sequence error predicted by the work of Brachat et al and Schreve et al., and has updated the systematic sequence accordingly. As a consequence of this sequence change, AGP1/YCL025C was extended on the 3' end, altering the C-terminus and increasing the size of the predicted protein from 595 to 633 amino acids
+
| || colspan="6" | A single nucleotide substitution within the coding region of YBR137W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 110 is now Glycine rather than Serine.
<pre>New: 76137 CGATCTTGTCTGCCCTGATGAACAGTTTCCAATCCTTGTGCCAG 76180
+
<pre>New   513345  CAAGTTTCTATATGGGCTGCAAGAAAGGTGACAAAACACCGGAGGAAAAGTTTTTTGTGG  513404
          ||||||||||| ||||||||||||||||||||||||||||||||
+
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Old: 76137 CGATCTTGTCT-CCCTGATGAACAGTTTCCAATCCTTGTGCCAG 76179</pre>
+
Old   513339  CAAGTTTCTATATGGGCTGCAAGAAAAGTGACAAAACACCGGAGGAAAAGTTTTTTGTGG  513398</pre>
'''Schreve JL, et al.''' (1998) The Saccharomyces cerevisiae YCC5 (YCL025c) gene encodes an amino acid permease, Agp1, which transports asparagine and glutamine. J Bacteriol 180(9):2556-9<br>
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[https://www.yeastgenome.org/reference/9573211 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9573211 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC107201 Full-Text]<br>
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
 
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="4"| 2004-02-20
+
| 2011-02-03
| rowspan="4"| [https://www.yeastgenome.org/locus/YCL012C YCL012C]
+
| [https://www.yeastgenome.org/locus/YBR121C YBR121C]
| 101615
+
| 481671
| 101615
+
| 481675
| Insertion
+
| Substitution
|  
+
| TGATG
| G
+
| GTAGT
 +
|-
 +
| || colspan="6" | Nucleotide substitutions within the coding region of GRS1/YBR121C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 563-564 are now TT rather than HH.
 +
<pre>New    481665  TTGGCGACTTCAGTAGTAACAGGAACTAAATCTTTGTGGTTAGATAAAGGAACTAAAAGA  481724
 +
              ||||||||||||  |  |||||||||||||||||||||||||||||||||||||||||||
 +
Old    481659  TTGGCGACTTCATGATGAACAGGAACTAAATCTTTGTGGTTAGATAAAGGAACTAAAAGA  481718</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 101461
+
| 2011-02-03
| 101461
+
| [https://www.yeastgenome.org/locus/YBR108W YBR108W]
| Insertion
+
| 456359
|  
+
| 456359
 +
| Substitution
 +
| C
 
| T
 
| T
 +
|-
 +
| || colspan="6" | A single nucleotide substitution within the coding region of AIM3/YBR108W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 515 is now Valine rather than Alanine.
 +
<pre>New    456345  AGGACATTATGATGTAGATGTCAACATCATGCCACCTCCAAAACCTTTCAGACATGGACT  456404
 +
              |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
 +
Old    456339  AGGACATTATGATGTAGATGCCAACATCATGCCACCTCCAAAACCTTTCAGACATGGACT  456398</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 101692
+
| 2011-02-03
| 101692
+
| [https://www.yeastgenome.org/locus/YBR295W YBR295W]
| Insertion
+
| 793986
|  
+
| 793987
| A
+
| Substitution
 +
| AC
 +
| CA
 +
|-
 +
| || colspan="6" | Nucleotide substitutions within the coding region of PCA1/YBR295W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 382 is now Histidine rather than Threonine.
 +
<pre>New    793961  GGATTGTGCTGTTACCTCAACTATTTCTGGACACTCTTCGAGTGAAATTTCAAGAATCGT  794020
 +
              |||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||
 +
Old    793955  GGATTGTGCTGTTACCTCAACTATTTCTGGAACCTCTTCGAGTGAAATTTCAAGAATCGT  794014</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| rowspan="2"| 2011-02-03
 +
| rowspan="2"| [https://www.yeastgenome.org/locus/YBR289W YBR289W]
 +
| 781354
 +
| 781354
 +
| Substitution
 +
| G
 +
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 101648
+
| 780541
| 101648
+
| 780541
| Insertion
+
| Substitution
|  
+
| C
 
| A
 
| A
 
|-
 
|-
| || colspan="6" | Four single nucleotide insertions were made in the region now spanning new feature YCL012C. This feature was independently predicted by Cliften et al. 2003 and Zhang & Dietrich 2003. The sequence changes were confirmed by Zhang and Dietrich (GenBank AY178910).
+
| || colspan="6" | Two nucleotide substitutions within the coding region of SNF5/YBR289W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 564 is now Aspartic Acid rather than Glutamic Acid.
<pre>New:   352 GTTTTCCATAATTTGTTTAATCTCATTCTTGGAGACATCATCCAAACCACCTCTTACGTC 293
+
<pre>New    780521  ACAACCTCCCACCAATGTTCAGCCAACTATTGGCCAACTTCCTCAACTTCCAAAATTAAA  780580
            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||  
+
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old: 101436 GTTTTCCATAATTTGTTTAATCTCAT-CTTGGAGACATCATCCAAACCACCTCTTACGTC 101494
+
Old    780517  ACAACCTCCCACCAATGTTCAGCCCACTATTGGCCAACTTCCTCAACTTCCAAAATTAAA  780576
 
+
New    781311  GATATTGTCGTGGGACAAAACCAGTTAATCGATCAATTTGAGTGGGACATCTCTAATAGT  781370
New:   172 TGCACGAAATTTGTCGGCTATTACAGCTGTTAGTAATTTGATACGGTTTGCACTTTGCAT 113
+
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
            | ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
+
Old   781307  GATATTGTCGTGGGACAAAACCAGTTAATCGATCAATTTGAGTGGGAGATCTCTAATAGT  781366</pre>
Old: 101615 T-CACGAAATTTGTCGGCTATTACAGCTGTTAGTA-TTTGATACGGTTTGCACTTTGCAT 101672
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
New:   112 TTTCAAATGCTTAAATATACATACCAACTTTGGTTTTCCGGTGTGCCATAAGAAGGCATA 53
 
            |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||  
 
Old: 101673 TTTCAAATGCTTAAATATAC-TACCAACTTTGGTTTTCCGGTGTGCCATAAGAAGGCATA 101731</pre>
 
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>
 
'''Zhang Z and Dietrich FS (2003)''' Verification of a new gene on Saccharomyces cerevisiae chromosome III. Yeast 20(8):731-8<br>
 
[https://www.yeastgenome.org/reference/12794934 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12794934 PubMed] | [https://doi.org/10.1002/yea.996 Full-text]
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2004-02-19
+
| 2011-02-03
| [https://www.yeastgenome.org/locus/YCL008C YCL008C]
+
| [https://www.yeastgenome.org/locus/YBR288C YBR288C]
| 105970
+
| 779354
| 105970
+
| 779356
| Deletion
+
| Substitution
| T
+
| TAC
|  
+
| ACT
 
|-
 
|-
| || colspan="6" | Based on Brachat et al. 2003 and GenBank AY260880, the T at 105970 was deleted. This change resulted in a frameshift, moving the stop 267 bp downstream, and extending the protein from 296 aa to 385 aa.
+
| || colspan="6" | Nucleotide substitutions within the coding region of APM3/YBR288C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 35-36 are now QS rather than RT.
<pre>Query:   918 AGTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGT-CAGGACGTCTATCTGTGCGT 860
+
<pre>New   779321  TCACTACTGCTATCTTCGAGCAATTGAGGACATGTGGACTGAACGCGGGTCCACAGGTGC  779380
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||  
+
              |||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||
Sbjct: 105931 AGTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGTTCAGGACGTCTATCTGTGCGT 105990</pre>
+
Old    779317  TCACTACTGCTATCTTCGAGCAATTGAGGACATGTGGTACGAACGCGGGTCCACAGGTGC  779376</pre>
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="4"| 2000-09-13
+
| rowspan="2"| 2011-02-03
| rowspan="4"| [https://www.yeastgenome.org/locus/YCR031C YCR031C], [https://www.yeastgenome.org/locus/snR189 snR189]
+
| rowspan="2"| [https://www.yeastgenome.org/locus/YBL099W YBL099W]
| 177189
+
| 38210
| 177190
+
| 38210
| Deletion
 
| AA
 
|
 
|- style="height:30px; width:30px; text-align:center;"
 
| 177166
 
| 177166
 
 
| Substitution
 
| Substitution
 +
| A
 
| T
 
| T
| G
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 177093
+
| 38067
| 177093
+
| 38067
 
| Substitution
 
| Substitution
| A
+
| C
| G
+
| T
|- style="height:30px; width:30px; text-align:center;"
 
| 177003
 
| 177004
 
| Deletion
 
| AA
 
|  
 
 
|-
 
|-
| || colspan="6" | The systematic sequence was updated in the region between features RPS14A/YCR031C and snR189. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | The substitution of 2 nucleotides within the coding region of ATP1/YBL099W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 340 is now Serine rather than Proline.
<pre>Old:   176967 CTCTCCTTGGGTTTAAAATAGAATCTTCATTAAAAAAAGTGCTTTCTGTAATATATAGTG 177026
+
<pre>New    38039   AGCCTACCCTGGTGATGTCTTTTACTTGCATTCAAGATTGCTAGAAAGAGCCGCTAAGCT  38098
              |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
+
              ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
New:   178235 CTCTCCTTGGGTTTAAAATAGAATCTTCATTAAAAA--GTGCTTTCTGTAATATATAGTG 178292
+
Old    38036   AGCCTACCCTGGTGATGTCTTTTACTTGCATCCAAGATTGCTAGAAAGAGCCGCTAAGCT  38095
 
+
New    38169   GCTTATATTCCAACCAATGTTATTTCCATTACCGATGGTCAAATTTTCTTGGAAGCTGAA  38228
Old:   177087 CCAGGAAGCGGGATGGTCTGCCGCAAGCAGACAAATTTGCCAAAATGCAGTAGAGAATGG 177146
+
              |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
+
Old    38166   GCTTATATTCCAACCAATGTTATTTCCATTACCGATGGTCAAATATTCTTGGAAGCTGAA  38225</pre>
New:   178353 CCAGGAGGCGGGATGGTCTGCCGCAAGCAGACAAATTTGCCAAAATGCAGTAGAGAATGG 178412
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
Old:   177147 CAATGCTCGTGCTGAAGGTTAAAAAAAGAACGCAAAAAAAAAAAGAGTAGTAAAATGTAC 177206
 
              ||||||||||||||||||| ||||||||||||||||||||||  ||||||||||||||||
 
New:   178413 CAATGCTCGTGCTGAAGGTGAAAAAAAGAACGCAAAAAAAAA--GAGTAGTAAAATGTAC 178470</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2000-09-13
+
| 2011-02-03
| [https://www.yeastgenome.org/locus/snR189 snR189]
+
| [https://www.yeastgenome.org/locus/YBL097W YBL097W]
| 177328
+
| 42377
| 177328
+
| 42377
 
| Substitution
 
| Substitution
| T
+
| C
 
| G
 
| G
 
|-
 
|-
| || colspan="6" | The systematic sequence was updated within feature snR189. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | A single nucleotide substitution within the coding region of BRN1/YBL097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 517 is now Glycine rather than Alanine.
<pre>Old:   177327 ATGAATAGAGATGTCAGGCCCGTGTGAAGTACTTGAAAGTAATAAGTGAGTATATAGAAT 177386
+
<pre>New    42359   CAAGATTGTTCATTAAACCGGGGCAGAAAATGAGTCTGTTCAGTCATAGGAAGCATACCA  42418
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+
              ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
New:   178591 AAGAATAGAGATGTCAGGCCCGTGTGAAGTACTTGAAAGTAATAAGTGAGTATATAGAAT 178650</pre>
+
Old    42356   CAAGATTGTTCATTAAACCGGCGCAGAAAATGAGTCTGTTCAGTCATAGGAAGCATACCA  42415</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="2"| 2000-09-13
+
| 2011-02-03
| rowspan="2"| [https://www.yeastgenome.org/locus/YCR032W YCR032W], [https://www.yeastgenome.org/locus/snR189 snR189]
+
| [https://www.yeastgenome.org/locus/YBL091C YBL091C]
| 178236
+
| 48369
| 178236
+
| 48369
| Deletion
+
| Substitution
 
| A
 
| A
|  
+
| T
|- style="height:30px; width:30px; text-align:center;"
 
| 177800
 
| 177801
 
| Substitution
 
| CA
 
| AC
 
 
|-
 
|-
| || colspan="6" | The systematic sequence was updated in the region between features snR189 and BPH1/YCR032W. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | A single nucleotide substitution within the coding region of MAP2/YBL091C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 86 is now Aspartic Acid rather than Valine.
<pre>Old:   177747 CGTTGCAAAGCTTTGTTTGCGGTATGTTAATAAAGTTACCATGAAGCTTTTTTCATGCTC 177806
+
<pre>New    48359   ACGTGATTCTTCATCCGTGGTTCTTTGCAGATTGAAATCTTGATGATAGTCCATCCACGC  48418
              ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
+
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
New:   179011 CGTTGCAAAGCTTTGTTTGCGGTATGTTAATAAAGTTACCATGAAGCTTTTTTACTGCTC 179070
+
Old    48356   ACGTGATTCTTCAACCGTGGTTCTTTGCAGATTGAAATCTTGATGATAGTCCATCCACGC  48415</pre>
 
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
Old:   178227 AAAAAAAAAACACAATACGGATATGAATTCAATTATTAATGCTGCTTCGAAAGTCTTAAG 178286
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:   179491 AAAAAAAAA-CACAATACGGATATGAATTCAATTATTAATGCTGCTTCGAAAGTCTTAAG 179549</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2000-09-13
+
| 2011-02-03
| [https://www.yeastgenome.org/locus/snR33 snR33]
+
| [https://www.yeastgenome.org/locus/YBL088C YBL088C]
| 142098
+
| 55145
| 142098
+
| 55145
 
| Substitution
 
| Substitution
 +
| A
 
| C
 
| C
| G
 
 
|-
 
|-
| || colspan="6" | The systematic sequence was updated within feature snR33. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | A single nucleotide substitution within the coding region of TEL1/YBL088C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1412 is now Cysteine rather than Phenylalanine.
<pre>Old:   142091 AAATTACCTAAATAATTTTAGAGTGACACCATCGTACAAAGAGGGCATTAAGCTTATTTT 142150
+
<pre>New    55139   GCATCAAGGCAGTATTTCCAAGTTTTTATTTTGATGAGATCCCGATGCTCTAAAAGCTTT  55198
              ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
+
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
New:   142486 AAATTACGTAAATAATTTTAGAGTGACACCATCGTACAAAGAGGGCATTAAGCTTATTTT 142545</pre>
+
Old    55136   GCATCAAGGAAGTATTTCCAAGTTTTTATTTTGATGAGATCCCGATGCTCTAAAAGCTTT  55195</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="10"| 2000-09-13
+
| 2011-02-03
| rowspan="10"| [https://www.yeastgenome.org/locus/snR33 snR33]
+
| [https://www.yeastgenome.org/locus/YBL084C YBL084C]
| 142397
+
| 68154
| 142498
+
| 68155
| Deletion
 
| AAGAAAAGCAAAAAACATATTAGCC GATAATTTCTATTTTATAAGTAAAA ACATTGGTGAGATAGTGGTAAAGAG TTAGATAATTATTGGGATTCCATTG TT
 
|
 
|- style="height:30px; width:30px; text-align:center;"
 
| 142388
 
| 142388
 
 
| Substitution
 
| Substitution
| G
+
| TG
| A
+
| GA
 +
|-
 +
| || colspan="6" | The substitution of two nucleotides within the coding region of CDC27/YBL084C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 430 is now Serine rather than Glutamine.
 +
<pre>New    68108  CGACCTTAATATTAAAGCGAAATTATACATGATTTCAGGCAGCGTAATTGAATAATCACT  68167
 +
              |||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||
 +
Old    68105  CGACCTTAATATTAAAGCGAAATTATACATGATTTCAGGCAGCGTAATTTGATAATCACT  68164</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 142382
+
| 2011-02-03
| 142382
+
| [https://www.yeastgenome.org/locus/YBR275C YBR275C]
| Substitution
+
| 754908
| A
+
| 754908
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 142301
 
| 142301
 
| Deletion
 
| A
 
|
 
|- style="height:30px; width:30px; text-align:center;"
 
| 142279
 
| 142281
 
| Deletion
 
| AAC
 
|  
 
|- style="height:30px; width:30px; text-align:center;"
 
| 142202
 
| 142202
 
 
| Substitution
 
| Substitution
 
| T
 
| T
 
| C
 
| C
 +
|-
 +
| || colspan="6" | A single nucleotide substitution within the coding region of RIF1/YBR275C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 732 is now Alanine rather than Threonine.
 +
<pre>New    754902  TACTTCAACAGCCTGGAACACAACTTTCATGATTTTATCGTATTCACGCTTGATGATCTG  754961
 +
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
 +
Old    754897  TACTTCAACAGTCTGGAACACAACTTTCATGATTTTATCGTATTCACGCTTGATGATCTG  754956</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 142186
+
| 2011-02-03
| 142186
+
| [https://www.yeastgenome.org/locus/YBR270C YBR270C]
 +
| 743936
 +
| 743938
 
| Substitution
 
| Substitution
| C
+
| GCC
| T
+
| CCG
 +
|-
 +
| || colspan="6" | Nucleotide substitutions within the coding region of BIT2/YBR270C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 152-153 are now SG rather than RA.
 +
<pre>New    743922  AGTGCCGTAGTTTTTTGACCCGCTCCTGCTTCGATTTCTCATATTATCTTTTGAATTGGT  743981
 +
              ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||
 +
Old    743917  AGTGCCGTAGTTTTTTGACGCCCTCCTGCTTCGATTTCTCATATTATCTTTTGAATTGGT  743976</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 142178
+
| 2011-02-03
| 142178
+
| [https://www.yeastgenome.org/locus/YBR266C YBR266C], [https://www.yeastgenome.org/locus/YBR267W YBR267W]
 +
| 740291
 +
| 740292
 
| Substitution
 
| Substitution
| G
+
| CG
| A
+
| GC
 +
|-
 +
| || colspan="6" | Nucleotide substitutions within the coding regions of overlapping genes REI1/YBR267W and SLM6/YBR266C resulted in altered sequences for both proteins. The start, stop, and reading frames of both proteins remain the same, but protein residues 152-153 of REI1/YBR267W are now KL rather than NV, and protein residue 31 of SLM6/YBR266C is now Serine rather than Threonine.
 +
<pre>New    740262  AGGAAGAAATGGCGGAAAGAGTAATGCAAGAAAAGCTACGCAACAGAGTCGATATTCCAC  740321
 +
              ||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||
 +
Old    740257  AGGAAGAAATGGCGGAAAGAGTAATGCAAGAAAACGTACGCAACAGAGTCGATATTCCAC  740316</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 142173
+
| 2011-02-03
| 142173
+
| [https://www.yeastgenome.org/locus/YBR265W YBR265W]
| Insertion
+
| 739341
|  
+
| 739341
 +
| Substitution
 
| A
 
| A
|- style="height:30px; width:30px; text-align:center;"
 
| 142154
 
| 142154
 
| Deletion
 
 
| T
 
| T
|
 
 
|-
 
|-
| || colspan="6" | The systematic sequence was updated in the region upstream of feature snR33. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | A single nucleotide substitution within the coding region of TSC10/YBR265W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 255 is now Aspartic Acid rather than Glutamic Acid.
<pre>Old:  142151 TTTTAATTCTTATGAAAAAAAAA-TGTGGAAGAGAGCAGAAAATTTTCATAATGAATCTC 142209
+
<pre>New    739302  CAAGCATGTGATATCATTGCCAAGTCGCTGGCCAGAGGTGATGATGACGTTTTTACAGAT  739361
              ||| ||||||||||||||||||| |||| ||||||| ||||||||||||||| |||||||
+
              |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
New:  142546 TTT-AATTCTTATGAAAAAAAAAATGTGAAAGAGAGTAGAAAATTTTCATAACGAATCTC 142604
+
Old   739297  CAAGCATGTGATATCATTGCCAAGTCGCTGGCCAGAGGTGATGAAGACGTTTTTACAGAT  739356</pre>
Old:  142270 AAAAAAAAAAACTAGTATATAAAGTAAAAAAAGATGCGCAAGCCCGGAATCGAACCGGGG 142329
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
              |||||||||  ||||||||||||||||||| ||||||||||||||||||||||||||||
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
New:  142665 AAAAAAAAA---TAGTATATAAAGTAAAAAA-GATGCGCAAGCCCGGAATCGAACCGGGG 142720
 
Old:  142330 GCCCAACGATGGCAACGTTGGATTTTACCACTAAACCACTTGCGCTAGTAATATTGATGC 142389
 
              |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
 
New:   142721 GCCCAACGATGGCAACGTTGGATTTTACCACTAAACCACTTGCGCTAGTAATCTTGATAC 142780
 
Old:  142390 ATTATTCAAGAAAAGCAAAAAACATATTAGCCGATAATTTCTATTTTATAAGTAAAAA 142447
 
              |||||||
 
New:   142781 ATGATTC--------------------------------------------------- 142787
 
Old:   142448 CATTGGTGAGATAGTGGTAAAGAGTTAGATAATTATTGGGATTCCATTGTTGAGAAAAGCAATAATATTATGTA 142521
 
                                                                |||||||||||||||||||||||
 
New:   142787 ---------------------------------------------------GAGAAAAGCAACAATATTATGTA 142810</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="4"| 2000-09-13
+
| rowspan="2"| 2011-02-03
| rowspan="4"| [https://www.yeastgenome.org/locus/YCL023C YCL023C], [https://www.yeastgenome.org/locus/YCL025C YCL025C]
+
| rowspan="2"| [https://www.yeastgenome.org/locus/YBR094W YBR094W]
| 78402
+
| 433377
| 78402
+
| 433378
| Insertion
+
| Substitution
|  
+
| CG
| CC
+
| GC
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 78400
+
| 432380
| 78400
+
| 432380
 
| Substitution
 
| Substitution
 +
| T
 
| C
 
| C
| G
+
|-
 +
| || colspan="6" | Nucleotide changes within the coding region of PBY1/YBR094W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 450 is now Alanine rather than Arginine.
 +
<pre>New    432345  GAGTGGATATTAATCGATGGAACTCCAGCATCGTGCGCAAACATCGGGCTGCACCTATTG  432404
 +
              ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
 +
Old    432339  GAGTGGATATTAATCGATGGAACTCCAGCATCGTGCGCAAATATCGGGCTGCACCTATTG  432398
 +
New    433365  ACTATTGATTTAGATTATGCTGAATTTCTAGACGACGCATTAGATGAAAATTGGGAATTA  433424
 +
              ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||
 +
Old    433359  ACTATTGATTTAGATTATCGTGAATTTCTAGACGACGCATTAGATGAAAATTGGGAATTA  433418</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 78035
+
| 2011-02-03
| 78035
+
| [https://www.yeastgenome.org/locus/YBR089C-A YBR089C-A]
| Insertion
+
| 426394
|
+
| 426396
| A
+
| Substitution
|- style="height:30px; width:30px; text-align:center;"
+
| CCG
| 78027
+
| GCC
| 78027
 
| Insertion
 
|  
 
| A
 
 
|-
 
|-
| || colspan="6" | Several sequence changes were made in the systematic sequence in the intergenic region between features YCL025C and YCL023C. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | Nucleotide substitutions within the coding region of NHP6B/YBR089C-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 30 is now Glycine rather than Arginine.
<pre>Old:  78005 AACAAATGAGTATTACGAGGAAA-TAACAAAA-GAAACTAATCACGAAGGATATGAGTCT 78062
+
<pre>New    426355  GACAATGTCTCTGTTTTCATTAGCAAAGAACATATAAGCTGACAAGCCCCTCTTAGGGGC  426414
            ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||
+
              ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||
New:   78037 AACAAATGAGTATTACGAGGAAAATAACAAAAAGAAACTAATCACGAAGGATATGAGTCT 78096
+
Old    426349  GACAATGTCTCTGTTTTCATTAGCAAAGAACATATAAGCTGACAACCGCCTCTTAGGGGC  426408</pre>
Old:   78363 CATCAACGGCAAAGTTGCAGCTTTTTGCAGCAGATCACTG--GCTTAGACGGCACCCTCA 78420
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
            ||||||||||||||||||||||||||||||||||||| ||  ||||||||||||||||||
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
New:   78397 CATCAACGGCAAAGTTGCAGCTTTTTGCAGCAGATCAGTGCCGCTTAGACGGCACCCTCA 78456</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2000-09-13
+
| rowspan="2"| 2011-02-03
| [https://www.yeastgenome.org/locus/YCR048W YCR048W], [https://www.yeastgenome.org/locus/YCR051W YCR051W]
+
| rowspan="2"| [https://www.yeastgenome.org/locus/YBL056W YBL056W]
| 212559
+
| 114870
| 212559
+
| 114870
| Insertion
 
|
 
| C
 
|-
 
| || colspan="6" | The systematic sequence was updated in the intergenic region between ORFs YCR048W and YCR051W. Note that coordinates listed below are chromosomal coordinates.
 
<pre>Old:  212547 GAATGGGCGTCCG-TCCACCGTGGTCAAAGACAGGGGCAAAGAGCTCCTAGGTCTATATA 212605
 
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
 
New:  213808 GAATGGGCGTCCGCTCCACCGTGGTCAAAGACAGGGGCAAAGAGCTCCTAGGTCTATATA 213867</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2000-09-13
 
| [https://www.yeastgenome.org/locus/YCR042C YCR042C], [https://www.yeastgenome.org/locus/YCR043C YCR043C]
 
| 204348
 
| 204348
 
| Deletion
 
| T
 
|
 
|-
 
| || colspan="6" | The systematic sequence was updated in the region between ORFs YCR042C and YCR043C. Note that coordinates listed below are chromosomal coordinates.
 
<pre>Old:  204327 TTTATTGAATTAAATAAGACTTGATTTTGTAGCACGATATCCGCAAGAATGATTCACAAC 204386
 
              ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
 
New:  205589 TTTATTGAATTAAATAAGACT-GATTTTGTAGCACGATATCCGCAAGAATGATTCACAAC 205647</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| rowspan="3"| 2000-09-13
 
| rowspan="3"| [https://www.yeastgenome.org/locus/YCR023C YCR023C], [https://www.yeastgenome.org/locus/YCR024C YCR024C]
 
| 160291
 
| 160291
 
 
| Substitution
 
| Substitution
 
| A
 
| A
 
| G
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 160135
+
| 114868
| 160135
+
| 114868
| Substitution
 
| T
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 160129
 
| 160129
 
 
| Substitution
 
| Substitution
 
| G
 
| G
| T
+
| A
 
|-
 
|-
| || colspan="6" | The systematic sequence was updated in the intergenic region between ORFs YCR023C and YCR024C. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | Two nucleotide substitutions within the coding region of PTC3/YBL056W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 369 is now Glycine rather than Aspartic Acid.
<pre>Old:  160101 TCATATGCTTACCACTTCCTAGTTCCTTGGCTAGTATTCCTTTAGGTGATCTAAATTCAA 160160
+
<pre>New    114832  CGACATGGAAATTGATGATCTTGATACCGAATTAGGCAGCAGTGCTACTCCCTCAAAGTT  114891
              |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||
+
              ||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||
New:   160385 TCATATGCTTACCACTTCCTAGTTCCTTTGCTAGCATTCCTTTAGGTGATCTAAATTCAA 160444
+
Old    114835  CGACATGGAAATTGATGATCTTGATACCGAATTGGACAGCAGTGCTACTCCCTCAAAGTT  114894</pre>
Old:   160281 ATTAACATAGATCAGGCCGAATGCCAAATGGAGTTTAGTACCTTCATATTGAAGAAAAAT 160340
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
New:   160565 ATTAACATAGGTCAGGCCGAATGCCAAATGGAGTTTAGTACCTTCATATTGAAGAAAAAT 160624</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="4"| 2000-09-13
+
| rowspan="10"| 2011-02-03
| rowspan="4"| [https://www.yeastgenome.org/locus/YCR023C YCR023C]
+
| rowspan="10"| [https://www.yeastgenome.org/locus/YBR207W YBR207W]
| 159827
+
| 636336
| 159827
+
| 636336
 
| Substitution
 
| Substitution
| T
+
| G
| C
+
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 159753
+
| 636319
| 159753
+
| 636322
 
| Substitution
 
| Substitution
| T
+
| GCTT
| C
+
| ACTG
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 159397
+
| 636306
| 159397
+
| 636309
 
| Substitution
 
| Substitution
 +
| AATA
 +
| TATG
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 636141
 +
| 636141
 +
| Substitution
 +
| A
 +
| G
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 635890
 +
| 635890
 +
| Deletion
 +
| A
 +
|
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 635882
 +
| 635882
 +
| Insertion
 +
|
 
| T
 
| T
| C
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 159255
+
| 635247
| 159255
+
| 635247
 
| Substitution
 
| Substitution
| T
 
 
| A
 
| A
|-
+
| G
| || colspan="6" | The systematic sequence was updated within ORF YCR023C. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  159201 TTGGTAGTATTCACTAGGGGACTATTTTCATCCTCTTCACTATCTTGTCCTCGATTGCTG 159260
 
              |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
 
New:  159485 TTGGTAGTATTCACTAGGGGACTATTTTCATCCTCTTCACTATCTTGTCCTCGAATGCTG 159544
 
Old:  159381 CCGTAATCTCTTCTATTTTTAAAAGCAGGATGTGTTTCTTCCAAAAACAATGTTGCATTA 159440
 
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
 
New:  159665 CCGTAATCTCTTCTATCTTTAAAAGCAGGATGTGTTTCTTCCAAAAACAATGTTGCATTA 159724
 
Old:  159741 TGATAGAAATTGTGTGAAAATCCCAGTATTAACAATGATACAGATGTTCCTATAAGCCCG 159800
 
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
 
New:  160025 TGATAGAAATTGCGTGAAAATCCCAGTATTAACAATGATACAGATGTTCCTATAAGCCCG 160084
 
Old:  159801 CAAGTCAATGTTATTTTTCTGCCATGTTTTTCAGAGAATCTACCCCAGTGGTACGCAGAT 159860
 
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
 
New:  160085 CAAGTCAATGTTATTTTTCTGCCATGCTTTTCAGAGAATCTACCCCAGTGGTACGCAGAT 160144</pre>
 
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2000-09-13
+
| 635192
| [https://www.yeastgenome.org/locus/YCL065W YCL065W]
+
| 635192
| 13811
 
| 13811
 
 
| Substitution
 
| Substitution
| C
+
| A
 
| G
 
| G
|-
 
| || colspan="6" | A single nucleotide substitution was made in the systematic sequence in the region encompassing ORF YCL065W. The C at 13811 was changed to G. This is coding nucleotide 72 (codon 24, TGC to TGG) resulting in one amino acid substitution in the predicted protein sequence (Cys to Trp). Note that coordinates listed below are chromosomal coordinates.
 
<pre>Old:  13798 GAGTGTGGTCGTGCCGGAGGTTGTTTATCTTTCGAGTACTGAATGTTGTCAGTATAGCTA 13857
 
            ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
 
New:  13809 GAGTGTGGTCGTGGCGGAGGTTGTTTATCTTTCGAGTACTGAATGTTGTCAGTATAGCTA 13868</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2000-09-13
+
| 636342
| [https://www.yeastgenome.org/locus/YCR107W YCR107W]
+
| 636342
| 312725
 
| 312725
 
 
| Substitution
 
| Substitution
| T
+
| G
 
| A
 
| A
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 635822
 +
| 635822
 +
| Substitution
 +
| C
 +
| G
 
|-
 
|-
| || colspan="6" | The systematic sequence was updated within ORF YCR107W. Note that coordinates listed below are chromosomal coordinates.
+
| || colspan="6" | Nucleotide changes within the coding region of FTH1/YBR207W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 18 is now Glu rather than Lys, residue 36 is now Gly rather than Asp, residue 228 is now Glu rather than Gln, residues 249-250 are now VF rather than YS, residue 334 is now Gly rather than Glu, residues 389-390 are now IC rather than KY, and residues 399-401 are now EKY rather than GKC.
<pre>Old:  312721 GAGCTCGTTCGGATTTTCTCAAATCAATGAACAAGAATCGAGCTTTTGAATTGCTTGATA 312780
+
<pre>New    635196  GGAATCCTTAGAAATTGTTGTCATTGTTTCTATCCTGTTGACGATCGTCAAACAAGGTCT  635255
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
+
              | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
New:   313995 GAGCACGTTCGGATTTTCTCAAATCAATGAACAAGAATCGAGCTTTTGAATTGCTTGATA 314054</pre>
+
Old   635191  GAAATCCTTAGAAATTGTTGTCATTGTTTCTATCCTGTTGACGATCGTCAAACAAGATCT  635250
 +
New    635803  ACCCAAAAAGGTGTGAAATTCAGTGAAAAGTACTCCTTCTTCATATTACCATTTATAACG  635862
 +
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
 +
Old    635798  ACCCAAAAAGGTGTGAAATTCAGTCAAAAGTACTCCTTCTTCATATTACCATTTATAACG  635857
 +
New    635863  ACTTTGAGAGAAGGGTTAGAAGCTGTTGTATTC-ATTGGAGGTATCGGTATTGACCAACC  635921
 +
              ||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||
 +
Old    635858  ACTTTGAGAGAAGGGTTAGAAGCTG-TGTATTCAATTGGAGGTATCGGTATTGACCAACC  635916
 +
New    636102  AGACTACGTCAACAAATGTAACGGTCAAGACATGAGTGAAGTAGGAAATGGACCCGGTTC  636161
 +
              |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
 +
Old    636097  AGACTACGTCAACAAATGTAACGGTCAAGACATGAGTGAAGTAGAAAATGGACCCGGTTC  636156
 +
New   636292  GCCTACTGGTTGGTATTAATATGCGCTTTGAAACTGCTAATGATAGAAGAAAAATACGGA  636351
 +
              ||||||||||||||||||| || ||||||||| || ||||||||||||| ||||| ||||
 +
Old    636287  GCCTACTGGTTGGTATTAAAATACGCTTTGAAGCTTCTAATGATAGAAGGAAAATGCGGA  636346</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2000-09-13
+
| 2011-02-03
| [https://www.yeastgenome.org/locus/YCR105W YCR105W], [https://www.yeastgenome.org/locus/YCR106W YCR106W]
+
| [https://www.yeastgenome.org/locus/YBL014C YBL014C]
| 309312
+
| 201635
| 309312
+
| 201635
 
| Substitution
 
| Substitution
 
| G
 
| G
| A
+
| C
 
|-
 
|-
| || colspan="6" | The systematic sequence was updated in the region between ORFs YCR105W and YCR106W. Note that coordinates listed below are chromosomal coordinates.
+
| || colspan="6" | A single nucleotide substitution within the coding region of RRN6/YBL014C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 39 is now Lysine rather than Asparagine.
<pre>Old:  309301 ATCATGCTTTTGCTTCGAAATCTAGAGTCCGAGCATGTCTGATGAGGTCCTCTTAAAGCA 309360
+
<pre>New    201592  CCTCGGCCAATGTATCATCTACTGGTCTTAGCCATTGTGGCTTTTCTTGCTTCTTCGTAG  201651
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
+
              |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
New:   310575 ATCATGCTTTTACTTCGAAATCTAGAGTCCGAGCATGTCTGATGAGGTCCTCTTAAAGCA 310634</pre>
+
Old    201595  CCTCGGCCAATGTATCATCTACTGGTCTTAGCCATTGTGGGTTTTCTTGCTTCTTCGTAG  201654</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2000-09-13
+
| 2011-02-03
| [https://www.yeastgenome.org/locus/YCR104W YCR104W], [https://www.yeastgenome.org/locus/YCR105W YCR105W]
+
| [https://www.yeastgenome.org/locus/YBL008W YBL008W]
| 307323
+
| 210433
| 307323
+
| 210433
| Deletion
+
| Substitution
| T
+
| A
|  
+
| G
 
|-
 
|-
| || colspan="6" | The systematic sequence was updated in the region between ORFs YCR104W and YCR105W. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | A single nucleotide substitution within the coding region of HIR1/YBL008W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 260 is now Valine rather than Methionine.
<pre>Old:  307321 TTTCGTCTCCTGTTATACGAATATTTGCATTTCTGTGCCTACTTATGTGTGTATATGTTT 307380
+
<pre>New    210412  AATGGGCCCGTAAGTTCTGTGGCAATTGTAAATAGAGGAACTTGGGATACAAATGTTAGT  210471
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   308596 TT-CGTCTCCTGTTATACGAATATTTGCATTTCTGTGCCTACTTATGTGTGTATATGTTT 308654</pre>
+
Old    210415  AATGGGCCCGTAAGTTCTATGGCAATTGTAAATAGAGGAACTTGGGATACAAATGTTAGT  210474</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="3"| 2000-09-13
+
| 2011-02-03
| rowspan="3"| [https://www.yeastgenome.org/locus/YCR102W-A YCR102W-A], [https://www.yeastgenome.org/locus/YCR104W YCR104W]
+
| [https://www.yeastgenome.org/locus/YBR043C YBR043C]
| 306173
+
| 323835
| 306173
+
| 323836
 
| Substitution
 
| Substitution
| G
+
| CG
| T
+
| GC
|- style="height:30px; width:30px; text-align:center;"
 
| 305943
 
| 305943
 
| Insertion
 
|
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
| 305908
 
| 305908
 
| Insertion
 
|
 
| C
 
 
|-
 
|-
| || colspan="6" | The systematic sequence was updated in the region between ORFs YCR102W-A and YCR104W. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | Nucleotide substitutions within the coding region of QDR3/YBR043C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 37 is now Serine rather than Threonine.
<pre>Old:  305883 GAACATCAACTTCTCTCAATACCATC-GCCTTCAGCGGCTACAATTACGTAATTGCACCA 305941
+
<pre>Query  323809  CTATAATCGTTGTGCTCGCTGTGCGGGCTGCCGCTGCTTTCATCGCAGTGCATCATAACA  323868
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
+
              |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
New:   307156 GAACATCAACTTCTCTCAATACCATCCGCCTTCAGCGGCTACAATTACGTAATTGCACCA 307215
+
Sbjct  323809  CTATAATCGTTGTGCTCGCTGTGCGGCGTGCCGCTGCTTTCATCGCAGTGCATCATAACA  323868</pre>
Old:   305942 AG-CATTCGCCGAGAGTTTACATATTTGCAGACCCTAACAGTATACGACTCCCAACACAC 306000
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
New:   307216 AGGCATTCGCCGAGAGTTTACATATTTGCAGACCCTAACAGTATACGACTCCCAACACAC 307275
 
Old:  306121 TATTCTTTTTGACCGAAAGCGGAAACTTCACAGGCGCGCGTAAAAGGGTTTTGCAAGGCA 306180
 
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
 
New:   307396 TATTCTTTTTGACCGAAAGCGGAAACTTCACAGGCGCGCGTAAAAGGGTTTTTCAAGGCA 307455</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="2"| 2000-09-13
+
| 2011-02-03
| rowspan="2"| [https://www.yeastgenome.org/locus/YCR102C YCR102C], [https://www.yeastgenome.org/locus/YCR102W-A YCR102W-A]
+
| [https://www.yeastgenome.org/locus/YBR141C YBR141C]
| 304740
+
| 527099
| 304740
+
| 527099
| Insertion
+
| Substitution
|
 
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
| 304543
 
| 304543
 
| Insertion
 
|  
 
 
| A
 
| A
 +
| G
 
|-
 
|-
| || colspan="6" | The systematic sequence was updated in the region between ORFs YCR102C and YCR102W-A. Note that coordinates listed below are chromosomal coordinates.
+
| || colspan="6" | A single nucleotide substitution within the coding region of YBR141C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 312 is now Proline rather than Serine.
<pre>Old:  304505 CGGGCGGATCCGAGACATCTTAGTCAGCTGAGACAAGAA-GGCACAGCTCTCGGACAGGA 304563
+
<pre>New    527085  AAAGCTACTCGGCTGCGGTGGAACTACCTGCAATTGATACAAACAATAGTACAACTTATT  527144
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
+
              |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
New:   305776 CGGGCGGATCCGAGACATCTTAGTCAGCTGAGACAAGAAAGGCACAGCTCTCGGACAGGA 305835
+
Old    527079  AAAGCTACTCGGCTGCGGTGAAACTACCTGCAATTGATACAAACAATAGTACAACTTATT  527138</pre>
Old:   304684 TGAACTATTGTTAATTGTATGGCGTGTGGCCTTGCTATTTCAGCAAATTTAGAGTAA-GT 304742
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
New:   305956 TGAACTATTGTTAATTGTATGGCGTGTGGCCTTGCTATTTCAGCAAATTTAGAGTAAAGT 306015</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2000-09-13
+
| 2011-02-03
| [https://www.yeastgenome.org/locus/YCR093W YCR093W]
+
| [https://www.yeastgenome.org/locus/YBR138C YBR138C]
| 282731
+
| 514965
| 282731
+
| 514966
 
| Substitution
 
| Substitution
| C
+
| AC
| T
+
| CA
 
|-
 
|-
| || colspan="6" | The systematic sequence was updated within ORF YCR093W. Note that coordinates listed below are chromosomal coordinates.
+
| || colspan="6" | Nucleotide substitutions within the coding region of YBR138C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 122 is now Leucine rather than Cysteine.
<pre>Old:  282728 GTTCAACTCAGCCTCAGCAACAACAAGCGCAAATGCCTACCCAAATCCTAACCTCCGAAC 282787
+
<pre>New    514955  TAGGCTTGGCACCTATCAATTGTGAGCGACGCTTTCTTACATTCAATAACTGTTGGTTCT  515014
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+
              |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   283999 GTTTAACTCAGCCTCAGCAACAACAAGCGCAAATGCCTACCCAAATCCTAACCTCCGAAC 284058</pre>
+
Old    514949  TAGGCTTGGCACCTATACATTGTGAGCGACGCTTTCTTACATTCAATAACTGTTGGTTCT  515008</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="2"| 2000-09-13
+
| 2011-02-03
| rowspan="2"| [https://www.yeastgenome.org/locus/YCR091W YCR091W]
+
| [https://www.yeastgenome.org/locus/YBR004C YBR004C]
| 275195
+
| 245111
| 275195
+
| 245111
| Insertion
 
|
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 274147
 
| 274147
 
 
| Substitution
 
| Substitution
| G
+
| T
 
| A
 
| A
 
|-
 
|-
| || colspan="6" | The systematic sequence was updated in the region encompassing ORF YCR091W, causing a frameshift leading to a C-terminally altered and shortened protein from aa 690 onward. The coding region of YCR091W had been annotated as 2181 nt long, but is now 2163 nt. Note that coordinates listed below are chromosomal coordinates.
+
| || colspan="6" | A single nucleotide substitution within the coding region of GPI18/YBR004C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 187 is now Serine rather than Threonine.
<pre>Old:  274089 TCAATCCTTCGAAAAAATTAGACTACTTGGCCAAGGTGACGTAGGTAAAGTGTATTTAGT 274148
+
<pre>New    245092  TACGGGCACGGAAATGGAGCATTCACGACTCCAAATACCAACAAATGCAAAAAAAAAAGA  245151
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
+
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   275359 TCAATCCTTCGAAAAAATTAGACTACTTGGCCAAGGTGACGTAGGTAAAGTGTATTTAAT 275418
+
Old    245094  TACGGGCACGGAAATGGTGCATTCACGACTCCAAATACCAACAAATGCAAAAAAAAAAGA  245153</pre>
Old:   275169 TATCTTAACCTACTCTGAAAATTATAC-TACGGAAAAATTCTATACAAAGCAACTTGTAC 275227
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
New:   276439 TATCTTAACCTACTCTGAAAATTATACCTACGGAAAAATTCTATACAAAGCAACTTGTAC 276498</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2000-09-13
+
| rowspan="8"| 2011-02-03
| [https://www.yeastgenome.org/locus/YCR088W YCR088W], [https://www.yeastgenome.org/locus/YCR089W YCR089W]
+
| rowspan="8"| [https://www.yeastgenome.org/locus/YBL106C YBL106C]
| 265773
+
| 13553
| 265773
+
| 13553
 
| Substitution
 
| Substitution
 +
| G
 
| A
 
| A
| G
 
|-
 
| || colspan="6" | The systematic sequence was updated in the region between ORFs YCR088W and YCR089W. Note that coordinates listed below are chromosomal coordinates.
 
<pre>Old:  265749 CAACAGACGGTGTGCCCGTACGGCATTGTCAAAACCTCGAACATAAAACAACACTGAAAC 265808
 
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
 
New:  267019 CAACAGACGGTGTGCCCGTACGGCGTTGTCAAAACCTCGAACATAAAACAACACTGAAAC 267078</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="2"| 2000-09-13
+
| 13492
| rowspan="2"| [https://www.yeastgenome.org/locus/YCR089W YCR089W]
+
| 13492
| 269261
 
| 269262
 
 
| Substitution
 
| Substitution
| TT
+
| A
| AA
+
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 268390
+
| 13477
| 268390
+
| 13477
 
| Substitution
 
| Substitution
 +
| G
 
| A
 
| A
| T
 
|-
 
| || colspan="6" | The systematic sequence was updated within ORF YCR089W. Note that coordinates listed below are chromosomal coordinates.
 
<pre>Old:  268389 AAGCAAACGCTTGTGCTTTCTACTGTCACAACAACGGTGAACGGTGCTGCTACGGAATAC 268448
 
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:  269659 ATGCAAACGCTTGTGCTTTCTACTGTCACAACAACGGTGAACGGTGCTGCTACGGAATAC 269718
 
Old:  269229 GTCAGTACGCAAAGTTTGCCTTTGGCATTCACTTGTTCAGAAAAACGCTCCACCACATCT 269288
 
              ||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||
 
New:  270499 GTCAGTACGCAAAGTTTGCCTTTGGCATTCACAAGTTCAGAAAAACGCTCCACCACATCT 270558</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="5"| 2000-09-13
+
| 13102
| rowspan="5"| [https://www.yeastgenome.org/locus/YCL074W YCL074W]
+
| 13102
| 3601
 
| 3601
 
 
| Substitution
 
| Substitution
 
| C
 
| C
 
| A
 
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 3551
+
| 11379
| 3551
+
| 11379
| Substitution
 
| G
 
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
| 3538
 
| 3538
 
 
| Substitution
 
| Substitution
 +
| A
 
| C
 
| C
| T
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 3209
+
| 11345
| 3209
+
| 11345
 
| Substitution
 
| Substitution
 
| A
 
| A
| T
+
| G
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 11308
 +
| 11309
 +
| Substitution
 +
| AA
 +
| TT
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 3069
+
| 11053
| 3069
+
| 11053
 
| Substitution
 
| Substitution
| G
+
| T
 
| C
 
| C
 
|-
 
|-
| || colspan="6" | Five single nucleotide substitutions were made in the systematic sequence in the region encompassing pseudogene YCL074W. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | Several nucleotide substitutions within the coding region of SRO77/YBL106C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 130 is now Isoleucine rather than Phenylalanine, residue 135 is now Serine rather than Proline, residue 260 is now Serine rather than Alanine, residue 834 is now Glycine rather than Valine, residue 858 is now Threonine rather than Serine, and 943 is now Glutamic Acid rather than Lysine.
<pre>Old:   3053 GGTCCCATCTACATTGGCGTATACGTAGACGACTTACTTGTTGCTGCTCCCTCTCCTAAA 3112
+
<pre>New   11041  ACCTGTGATCTTCCGTACCGGGAGGTAACTTTCTGGCTGCATTACTACTACTGGAAGATA  11100
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
+
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
New:   3061 GGTCCCATCTACATTGCCGTATACGTAGACGACTTACTTGTTGCTGCTCCCTCTCCTAAA 3120
+
Old    11041  ACCTGTGATCTTTCGTACCGGGAGGTAACTTTCTGGCTGCATTACTACTACTGGAAGATA  11100
Old:   3173 GTTGACAAATTCCTCGGTCTTAACATTCATCAATCGACAAACGGAGACATCACTCTCTCC 3232
+
New    11281  GTTGTGATATGTCAGCAGTATGATTCGTTCCGGTGGCACTTTCATTAAGTACTGAAATCA  11340
            |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
+
              |||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||
New:   3181 GTTGACAAATTCCTCGGTCTTAACATTCATCAATCGTCAAACGGAGACATCACTCTCTCC 3240
+
Old    11281  GTTGTGATATGTCAGCAGTATGATTCGAACCGGTGGCACTTTCATTAAGTACTGAAATCA  11340
Old:   3533 TATCGCTCTGGATCTCAGGTGGCATTAACTGTATATTGTGATGCATCTCATGGAGCTATT 3592
+
New    11341  AAGAGGCTTGGAATTTCCCTGTGCGAATGACAATGTCACCATTTTCTAATATAGATGAAT  11400
            ||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||
+
              |||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:   3541 TATCGTTCTGGATCTCAGTTGGCATTAACTGTATATTGTGATGCATCTCATGGAGCTATT 3600
+
Old    11341  AAGAAGCTTGGAATTTCCCTGTGCGAATGACAATGTCAACATTTTCTAATATAGATGAAT  11400
Old:   3593 CACGATCTCCCACACTCTACTGGGGGGTACGTGACTCTACTTGCTGGTGCTCCCGTTACG 3652
+
New    13081  TGACATCCCAAAATACCAAGGAATTATCTTCATGGACAGTTAATATATGTAAGGAATTTG  13140
            |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
+
              ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
New:   3601 CACGATCTACCACACTCTACTGGGGGGTACGTGACTCTACTTGCTGGTGCTCCCGTTACG 3660</pre>
+
Old    13081  TGACATCCCAAAATACCAAGGCATTATCTTCATGGACAGTTAATATATGTAAGGAATTTG  13140
 +
New    13441  ATCCACTCTCGAGGCCAATCAGCATCCAATCCAAGGACGGATCAGTCTCAATACAAGTGA  13500
 +
              |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||
 +
Old   13441  ATCCACTCTCGAGGCCAATCAGCATCCAATCCAAGGGCGGATCAGTCTCAAAACAAGTGA  13500
 +
New   13501  TGCTGTTTGGACAGAAAACAGTAGTTAGAATCTGTTTCGAGTGTACTGAAAGAACTATTA  13560
 +
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
 +
Old   13501  TGCTGTTTGGACAGAAAACAGTAGTTAGAATCTGTTTCGAGTGTACTGAAAGGACTATTA  13560</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2000-09-13
+
| rowspan="6"| 2011-02-03
| [https://www.yeastgenome.org/locus/YCL074W YCL074W], [https://www.yeastgenome.org/locus/YCLWomega2 YCLWomega2]
+
| rowspan="6"| [https://www.yeastgenome.org/locus/YBR203W YBR203W]
| 3858
+
| 631936
| 3858
+
| 631936
 
| Substitution
 
| Substitution
| C
+
| G
 
| A
 
| A
|-
 
| || colspan="6" | A single nucleotide substitution was made in the systematic sequence in the intergenic region between features YCL074W and YCLWomega2. The C at 3858 was changed to A. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:    3833 CATCCTGTATTTCACACGAGAGCAACACACATTGCTTTGAGATACCACAAGCTAAGAAAT 3892
 
            ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
 
New:    3841 CATCCTGTATTTCACACGAGAGCAAAACACATTGCTTTGAGATACCACAAGCTAAGAAAT 3900</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="21"| 2000-09-13
+
| 631924
| rowspan="21"| [https://www.yeastgenome.org/locus/YCL073C YCL073C], [https://www.yeastgenome.org/locus/YCLWomega2 YCLWomega2]
+
| 631924
| 5909
 
| 5909
 
 
| Substitution
 
| Substitution
| T
+
| G
| C
+
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 5833
+
| 631912
| 5833
+
| 631912
 
| Substitution
 
| Substitution
| C
+
| G
| T
+
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 5683
+
| 631907
| 5683
+
| 631907
 
| Substitution
 
| Substitution
| C
+
| G
| T
+
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 5638
+
| 631342
| 5638
+
| 631353
 
| Substitution
 
| Substitution
| T
+
| GCTGGCGAAACG
| C
+
| CGTTTCGCCAGC
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 5634
+
| 631940
| 5634
+
| 631940
 
| Substitution
 
| Substitution
 
| C
 
| C
| T
+
| A
 +
|-
 +
| || colspan="6" | Nucleotide changes within the coding region of COS111/YBR203W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 727-731 are now TFRQH rather than SWRND, residue 917 is now Asparagine rather than Serine, and residue 921 is now Glutamic Acid rather than Glycine.
 +
<pre>New    631303  TGTGTGGTGCAGGCAATATATGGTAAAGTATTTTGTAATGAGGACGTTTCGCCAGCATTT  631362
 +
              ||||||||||||||||||||||||||||||||||||||||||||  |  ||  |  ||||
 +
Old    631298  TGTGTGGTGCAGGCAATATATGGTAAAGTATTTTGTAATGAGGAGCTGGCGAAACGATTT  631357
 +
New    631903  TGTTGGCGAAAATAACTACTATGCTGAAAGCATCATATAACGACTGCTCTCTTTTAACAG  631962
 +
              ||||||||| |||| ||||||||||| ||||||||||| ||| |||||||||||||||||
 +
Old    631898  TGTTGGCGAGAATAGCTACTATGCTGGAAGCATCATATGACGCCTGCTCTCTTTTAACAG  631957</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 5631
+
| 2011-02-03
| 5631
+
| [https://www.yeastgenome.org/locus/YBR285W YBR285W]
 +
| 774080
 +
| 774080
 
| Substitution
 
| Substitution
| T
 
 
| C
 
| C
|- style="height:30px; width:30px; text-align:center;"
 
| 5615
 
| 5615
 
| Deletion
 
 
| G
 
| G
|  
+
|-
 +
| || colspan="6" | A single nucleotide substitution within the coding region of YBR285W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 55 is now Aspartic Acid rather than Histidine.
 +
<pre>New    774041  CTTAGAAAGCCCCACTGACGATAGCATGGAGGCGGACATTTCAGATAGAGAAATGGCTAC  774100
 +
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
 +
Old    774037  CTTAGAAAGCCCCACTGACGATAGCATGGAGGCGGACATTTCACATAGAGAAATGGCTAC  774096</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 5524
+
| 2011-02-03
| 5524
+
| [https://www.yeastgenome.org/locus/YBR204C YBR204C]
 +
| 633189
 +
| 633189
 
| Substitution
 
| Substitution
| C
+
| T
 
| A
 
| A
 +
|-
 +
| || colspan="6" | A single nucleotide substitution within the coding region of YBR204C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 63 is now Valine rather than Glutamic Acid.
 +
<pre>New    633163  CCTTATTCTTGAATTTCGATCCGATAGTTGTACATTAAAAAACTCCTCATGTTCTGCGAT  633222
 +
              ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
 +
Old    633158  CCTTATTCTTGAATTTCGATCCGATAGTTGTTCATTAAAAAACTCCTCATGTTCTGCGAT  633217</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 5492
+
| rowspan="3"| 2011-02-03
| 5492
+
| rowspan="3"| [https://www.yeastgenome.org/locus/YBR202W YBR202W]
 +
| 627486
 +
| 627487
 
| Substitution
 
| Substitution
| A
+
| AT
| T
+
| TA
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 5486
+
| 627433
| 5486
+
| 627439
 
| Substitution
 
| Substitution
| T
+
| ATCCGGG
| C
+
| CTTTGAA
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 5478
+
| 627421
| 5478
+
| 627421
 
| Substitution
 
| Substitution
 
| T
 
| T
| C
+
| G
 +
|-
 +
| || colspan="6" | Nucleotide changes within the coding region of MCM7/YBR202W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 552-558 is now GINTTLN rather than VINTNPG, and residue 574 is now Tyrosine rather than Isoleucine.
 +
<pre>New    627403  AACAATTTCGATATCCAAGGCGGGTATCAATACAACTTTGAACGCCAGAACCTCAATCTT  627462
 +
              ||||||||||||||||||||||| ||||||||||| |  |  ||||||||||||||||||
 +
Old    627398  AACAATTTCGATATCCAAGGCGGTTATCAATACAAATCCGGGCGCCAGAACCTCAATCTT  627457
 +
New    627463  AGCGGCAGCAAATCCGTTGTATGGTAGATATAATCCTAGATTATCACCTCTGGACAATAT  627522
 +
              ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||
 +
Old    627458  AGCGGCAGCAAATCCGTTGTATGGTAGAATTAATCCTAGATTATCACCTCTGGACAATAT  627517</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 5475
+
| 2011-02-03
| 5475
+
| [https://www.yeastgenome.org/locus/YBL080C YBL080C]
 +
| 73450
 +
| 73450
 
| Substitution
 
| Substitution
| A
+
| C
 
| G
 
| G
 +
|-
 +
| || colspan="6" | A single nucleotide substitution within the coding region of PET112/YBL080C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 415 is now Proline rather than Alanine.
 +
<pre>New    73438  CGAAAACCGGAGGAGGCAAAATTTCTTTTGCTTTGGCCAATGGAATTTGTAGCTTGTTCA  73497
 +
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
 +
Old    73435  CGAAAACCGGAGGAGCCAAAATTTCTTTTGCTTTGGCCAATGGAATTTGTAGCTTGTTCA  73494</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 5468
+
| 2011-02-03
| 5468
+
| [https://www.yeastgenome.org/locus/YBL067C YBL067C]
 +
| 95345
 +
| 95345
 
| Substitution
 
| Substitution
 +
| G
 
| T
 
| T
| G
+
|-
 +
| || colspan="6" | A single nucleotide substitution within the coding region of UBP13/YBL067C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 180 is now Glutamine rather than Histidine.
 +
<pre>New    95333  TCTTTCTTGGTTGATCAGATTCTCTTGATTTTTTTGGAAATTGCAATATATTTTCACGTA  95392
 +
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
 +
Old    95335  TCTTTCTTGGGTGATCAGATTCTCTTGATTTTTTTGGAAATTGCAATATATTTTCACGTA  95394</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 5443
+
| 2011-02-03
| 5443
+
| [https://www.yeastgenome.org/locus/YBR074W YBR074W]
 +
| 388774
 +
| 388775
 
| Substitution
 
| Substitution
| C
+
| TT
| T
+
| AA
 +
|-
 +
| || colspan="6" | Nucleotide substitutions within the coding region of YBR074W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 832 is now Asparagine rather than Phenylalanine.
 +
<pre>New    388738  ACGAACCAATAGTTGCAGAGTTACTTTTGGAGGTGAAGGAGAACAGGGCTTGCACTTTAA  388797
 +
              |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||
 +
Old    388733  ACGAACCAATAGTTGCAGAGTTACTTTTGGAGGTGAAGGAGTTCAGGGCTTGCACTTTAA  388792</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 5437
+
| 2011-02-03
| 5437
+
| [https://www.yeastgenome.org/locus/YBR073W YBR073W]
| Deletion
+
| 385360
| C
+
| 385361
|  
+
| Substitution
 +
| CG
 +
| GC
 +
|-
 +
| || colspan="6" | Nucleotide substitutions within the coding region of RDH54/YBR073W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 752 is now Alanine rather than Arginine.
 +
<pre>New    385318  TCTTGTTGAGTGCAAAATCGGGAGGTGTAGGATTGAATCTAGTCGGTGCTTCGCGACTTA  385377
 +
              |||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||
 +
Old    385313  TCTTGTTGAGTGCAAAATCGGGAGGTGTAGGATTGAATCTAGTCGGTCGTTCGCGACTTA  385367</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 5432
+
| 2011-02-03
| 5435
+
| [https://www.yeastgenome.org/locus/YBR152W YBR152W], [https://www.yeastgenome.org/locus/YBR153W YBR153W]
| Deletion
+
| 547442
| CATC
+
| 547442
|  
+
| Substitution
|- style="height:30px; width:30px; text-align:center;"
+
| A
| 5408
 
| 5408
 
| Deletion
 
 
| T
 
| T
|  
+
|-
 +
| || colspan="6" | A single nucleotide substitution was made in the intergenic region between ORFs SPP381/YBR152W and RIB7/YBR153W.
 +
<pre>New    547425  GCTTCTTTGTATTACTATCAACATTTTTAGAAGATATGTCTTTGACACCACTGTGTGAAG  547484
 +
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
 +
Old    547419  GCTTCTTTGTATTACTATCAACAATTTTAGAAGATATGTCTTTGACACCACTGTGTGAAG  547478</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 5403
+
| 2011-02-03
| 5406
+
| [https://www.yeastgenome.org/locus/YBLCtau1 YBLCtau1], [https://www.yeastgenome.org/locus/tF(GAA)B tF(GAA)B]
| Deletion
+
| 36312
| AGGA
+
| 36312
|
+
| Substitution
|- style="height:30px; width:30px; text-align:center;"
+
| T
| 5401
 
| 5401
 
| Deletion
 
| C
 
|
 
|- style="height:30px; width:30px; text-align:center;"
 
| 5398
 
| 5398
 
| Deletion
 
 
| A
 
| A
|  
+
|-
 +
| || colspan="6" | A single nucleotide substitution was made in the intergenic region between Ty4 LTR YBLCtau1 and tRNA-Phe tF(GAA)B.
 +
<pre>New    36299  TGTGCTTCAGTATTACATTTTTTGCCTTCAACGCCTTGATTGTTCTATTTTTGCTAATAA  36358
 +
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
 +
Old    36296  TGTGCTTCAGTATTACTTTTTTTGCCTTCAACGCCTTGATTGTTCTATTTTTGCTAATAA  36355</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 5394
+
| 2011-02-03
| 5394
+
| [https://www.yeastgenome.org/locus/YBL099W YBL099W], [https://www.yeastgenome.org/locus/tF(GAA)B tF(GAA)B]
 +
| 36673
 +
| 36673
 
| Substitution
 
| Substitution
 
| A
 
| A
| G
+
| T
 
|-
 
|-
| || colspan="6" | Several sequence changes were made in the systematic sequence in the intergenic region between features YCLWomega2 and YCL073C. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | A single nucleotide substitution was made in the intergenic region between tRNA-Phe tF(GAA)B and ORF ATP1/YBL099W.
<pre>Old:   5393 CAACAATCCTAGGAGTTCCAGCTCAATCGGGTATGATATCATCTCTGATACCCCCAAAATACATGGCTGTACCATT 5468
+
<pre>New   36659  ATTTATTGTAATTATTATACATTGGTCATATCAAATTCACATCAGACTTCAATTTTTCAA  36718
            | ||| || |   | |||||||||||||||||||||||    | ||||| ||||||||||||||||||||||||
+
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:    5401 CGACA-TC-T----G-TCCAGCTCAATCGGGTATGATAT----T-TGATATCCCCAAAATACATGGCTGTACCATG 5464
+
Old    36656  ATTTATTGTAATTATTAAACATTGGTCATATCAAATTCACATCAGACTTCAATTTTTCAA  36715</pre>
Old:   5469 TAAAATAAGTGGTATATTGAAGAACAGTATATTTCAGCCTATACAGGATCCTACTCTTTC 5528
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
            |||||| || ||||||| ||||| ||||||||||||||||||||||||||||||| ||||
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
New:   5465 TAAAATGAGCGGTATATCGAAGATCAGTATATTTCAGCCTATACAGGATCCTACTATTTC 5524
 
Old:    5589 GTTAGTAACATCAATATATCGCGGAGGTAGCTATCATTGTGGTAGCTAATTTAAAGGATA 5648
 
            |||||||||||||||||||||||||| ||||||||||||||| || ||| ||||||||||
 
New:   5585 GTTAGTAACATCAATATATCGCGGAG-TAGCTATCATTGTGGCAGTTAACTTAAAGGATA 5643
 
Old:   5649 TACAGTTAATTCAACAAGATTTTCAAGTCCATTTCTTTTGGGCACGCTGAACACGCTCAA 5708
 
            |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
 
New:   5644 TACAGTTAATTCAACAAGATTTTCAAGTCCATTTTTTTTGGGCACGCTGAACACGCTCAA 5703
 
Old:    5829 AGACCGTTGCCGACTCCAAGAAAACTATGATCTCAATACAGGCATAAAGAATTGTTGTAT 5888
 
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:   5824 AGACTGTTGCCGACTCCAAGAAAACTATGATCTCAATACAGGCATAAAGAATTGTTGTAT 5883
 
Old:    5889 CTGTGCCCATGTGATCTGTATCTTTTTTGCGGTACCAAAATCGCATGTTGCACTCACACT 5948
 
            |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
 
New:    5884 CTGTGCCCATGTGATCTGTACCTTTTTTGCGGTACCAAAATCGCATGTTGCACTCACACT 5943</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="13"| 2000-09-13
+
| 2011-02-03
| rowspan="13"| [https://www.yeastgenome.org/locus/YCL073C YCL073C]
+
| [https://www.yeastgenome.org/locus/YBR006W YBR006W], [https://www.yeastgenome.org/locus/YBR007C YBR007C]
 +
| 248623
 +
| 248623
 +
| Insertion
 +
|
 +
| T
 +
|-
 +
| || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs UGA2/YBR006W and DSF2/YBR007C.
 +
<pre>New    248572  GCATGTATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATTTTTTGAAAGAAAA  248631
 +
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
 +
Old    248574  GCATGTATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATTTTT-GAAAGAAAA  248632</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 7997
+
| rowspan="2"| 2011-02-03
| 7997
+
| rowspan="2"| [https://www.yeastgenome.org/locus/YBR001C YBR001C], [https://www.yeastgenome.org/locus/YBR002C YBR002C]
 +
| 241396
 +
| 241396
 
| Substitution
 
| Substitution
| C
+
| G
| T
+
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 7943
+
| 241359
| 7943
+
| 241359
 
| Substitution
 
| Substitution
| C
+
| G
| T
+
| A
 +
|-
 +
| || colspan="6" | Two separate single nucleotide substitutions were made in the intergenic region between ORFs NTH2/YBR001C and RER2/YBR002C.
 +
<pre>New    241352  AAAGGAAAAATATAAATAAATAAATAAAATTGAGAAATAAAGATATTTAGTTTTAATGGA  241411
 +
              ||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||
 +
Old    241354  AAAGGGAAAATATAAATAAATAAATAAAATTGAGAAATAAAGGATATTAGTTTTAATGGA  241413</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 7778
+
| 2011-02-03
| 7778
+
| [https://www.yeastgenome.org/locus/YBL005W YBL005W], [https://www.yeastgenome.org/locus/YBLWdelta8 YBLWdelta8]
 +
| 220413
 +
| 220414
 
| Substitution
 
| Substitution
| T
+
| AG
| C
+
| GA
 +
|-
 +
| || colspan="6" | A dinucleotide substitution was made in the intergenic region between ORF PDR3/YBL005W and Ty1 LTR YBLWdelta8.
 +
<pre>New    220372  ATGACAATACTTCATATCCCTTCTTATGAAAACGCAAAGAAAATAGGGAAGCAGAGCATA  220431
 +
              ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||
 +
Old    220375  ATGACAATACTTCATATCCCTTCTTATGAAAACGCAAAAGAAATAGGGAAGCAGAGCATA  220434</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 7451
+
| rowspan="2"| 2011-02-03
| 7451
+
| rowspan="2"| [https://www.yeastgenome.org/locus/YBL105C YBL105C], [https://www.yeastgenome.org/locus/YBL106C YBL106C]
 +
| 13982
 +
| 13982
 
| Substitution
 
| Substitution
 +
| G
 
| A
 
| A
| G
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 7445
+
| 13966
| 7445
+
| 13966
 
| Substitution
 
| Substitution
 +
| C
 
| A
 
| A
| G
+
|-
 +
| || colspan="6" | Two separate single nucleotide substitutions were made in the intergenic region between ORFs SRO77/YBL106C and PKC1/YBL105C.
 +
<pre>New    13941  AGAAATATGTTAGTAGTAATATAATACTGAGCTGTTTCTTAAATGCTTCCTTAATAATGT  14000
 +
              ||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||
 +
Old    13941  AGAAATATGTTAGTAGTAATATAATCCTGAGCTGTTTCTTAGATGCTTCCTTAATAATGT  14000</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 7415
+
| rowspan="6"| 2011-02-03
| 7415
+
| rowspan="6"| [https://www.yeastgenome.org/locus/ARS209 ARS209]
| Substitution
+
| 254720
 +
| 254720
 +
| Insertion
 +
|
 
| T
 
| T
| C
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6968
+
| 254719
| 6968
+
| 254719
| Substitution
+
| Insertion
| G
+
|
| A
+
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6533
+
| 254616
| 6533
+
| 254616
 
| Substitution
 
| Substitution
| G
+
| T
 
| A
 
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6504
+
| 254548
| 6504
+
| 254548
 +
| Insertion
 +
|
 +
| A
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 254532
 +
| 254532
 
| Substitution
 
| Substitution
| T
 
 
| C
 
| C
 +
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6490
+
| 254495
| 6490
+
| 254495
 
| Substitution
 
| Substitution
| C
+
| G
 
| T
 
| T
 +
|-
 +
| || colspan="6" | Several nucleotide changes were made within ARS209.
 +
<pre>New    254452  AAATATCCTTTTTTTTTTCTTTGCATTTGTCTTCTTTCATTTTAAATCTTCATAATCTTC  254511
 +
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
 +
Old    254453  AAATATCCTTTTTTTTTTCTTTGCATTTGTCTTCTTTCATTTGAAATCTTCATAATCTTC  254512
 +
New    254512  CGGAAAAACTAGTGATGCGAAATATTGTAGAGAAAAAGCGCAGGGCATTCCTATACTTAG  254571
 +
              ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||
 +
Old    254513  CGGAAAAACTAGTGATGCGCAATATTGTAGAGAAAA-GCGCAGGGCATTCCTATACTTAG  254571
 +
New    254572  TAATCACCATCATAACGTATTTTAAAATGAAGAAGCGAACCTCAAAGAATTTTCTATACA  254631
 +
              |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
 +
Old    254572  TAATCACCATCATAACGTATTTTAAAATGAAGAAGCGAACCTCATAGAATTTTCTATACA  254631
 +
New    254692  TATATTGCAGAAAATGTGCTAGTAATATTGTTCTCTCTGTTGTCAATGGGCTTACAATTG  254751
 +
              |||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||
 +
Old    254692  TATATTGCAGAAAATGTGCTAGTAATAT-G-TCTCTCTGTTGTCAATGGGCTTACAATTG  254749</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6484
+
| 2011-02-03
| 6484
+
| [https://www.yeastgenome.org/locus/YBR285W YBR285W], [https://www.yeastgenome.org/locus/YBR286W YBR286W]
 +
| 774430
 +
| 774430
 
| Substitution
 
| Substitution
 
| C
 
| C
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
| 6480
 
| 6480
 
| Substitution
 
 
| G
 
| G
| A
 
 
|-
 
|-
| || colspan="6" | Twelve separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL073C. These changes resulted in 4 amino acid differences in the predicted protein sequence. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | A single nucleotide substitution was made in the intergenic region between ORFs YBR285W and APE3/YBR286W.
<pre>Old:   6468 GATCAACATCCTGATTCCTTGTCACTTCGA 6497
+
<pre>New   774401  CTTATCGTCAGAAAGAGTGTTCTCTATGTTTTTGTGCTTCCATAAATATATAGTTCAAAA  774460
            |||||||||||| ||| ||||| |||||||
+
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
New:    6477 GATCAACATCCTAATTTCTTGTTACTTCGA 6506
+
Old    774397  CTTATCGTCAGAAAGAGTGTTCTCTATGTTTTTCTGCTTCCATAAATATATAGTTCAAAA  774456</pre>
Old:    6498 TTATGTTTAAAAAGTGCCTTGATTTGAGAGAAAATGTTTTCCTCATCTGGCAAGACAACC 6557
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
            |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
New:    6507 TTATGTCTAAAAAGTGCCTTGATTTGAGAGAAAATATTTTCCTCATCTGGCAAGACAACC 6566
 
Old:   6918 GTAGTCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATAGGAGACCGCTCAAACCC 6977
 
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
 
New:   6927 GTAGTCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATAGGAGACCACTCAAACCC 6986
 
Old:   7398 TTTGAATTGTGCCACTTTTGTGATGTCTCATTAGCCAACGTCAAAGGAACAAGAATACAC 7457
 
            ||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||
 
New:   7407 TTTGAATTGTGCCACTTCTGTGATGTCTCATTAGCCAACGTCAAAGGGACAAGGATACAC 7466
 
Old:    7758 TACTGGTAAAACATTCTCCATTTCAAGGAGGAGAAATCAGAAAGTATTAATGTCAGGAGC 7817
 
            |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
 
New:   7767 TACTGGTAAAACATTCTCCACTTCAAGGAGGAGAAATCAGAAAGTATTAATGTCAGGAGC 7826
 
Old:    7938 AGCCTCAGTCTTCCGAAGTGGTCAGAGAGTCTGGAGTAGACAACTTGGGATCCGACACTC 7997
 
            ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:   7947 AGCCTTAGTCTTCCGAAGTGGTCAGAGAGTCTGGAGTAGACAACTTGGGATCCGACACTT 8006</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="10"| 2000-09-13
+
| rowspan="3"| 2011-02-03
| rowspan="10"| [https://www.yeastgenome.org/locus/YCL069W YCL069W], [https://www.yeastgenome.org/locus/YCL073C YCL073C]
+
| rowspan="3"| [https://www.yeastgenome.org/locus/ARS221 ARS221]
| 8764
+
| 631981
| 8764
+
| 631981
| Substitution
 
| C
 
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
| 8733
 
| 8733
 
| Substitution
 
| T
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 8686
 
| 8686
 
 
| Substitution
 
| Substitution
 
| A
 
| A
 
| G
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 8675
+
| 631940
| 8675
+
| 631940
 
| Substitution
 
| Substitution
| T
 
 
| C
 
| C
 +
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 8585
+
| 631936
| 8585
+
| 631936
| Insertion
 
|
 
| AAA
 
|- style="height:30px; width:30px; text-align:center;"
 
| 8577
 
| 8577
 
 
| Substitution
 
| Substitution
| T
+
| G
 
| A
 
| A
 +
|-
 +
| || colspan="6" | Three single nucleotide substitutions were made within ARS221.
 +
<pre>New    631933  CATCATATAACGACTGCTCTCTTTTAACAGCATACGTTCTGTTAATTTATTTGGCCAAAT  631992
 +
              |||||||| ||| |||||||||||||||||||||||||||||||||||||||| ||||||
 +
Old    631928  CATCATATGACGCCTGCTCTCTTTTAACAGCATACGTTCTGTTAATTTATTTGACCAAAT  631987</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 8535
+
| 2011-02-03
| 8535
+
| [https://www.yeastgenome.org/locus/ARS213 ARS213]
| Substitution
+
| 390033
 +
| 390033
 +
| Insertion
 +
|
 
| C
 
| C
| T
+
|-
 +
| || colspan="6" | A single nucleotide insertion was made within ARS213.
 +
<pre>New    389998  ACTGACACTAAAAAAAGGGTCGTACGTCTTACTGGCAGCGCCGAAAAATGTTTCGAAAAT  390057
 +
              ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
 +
Old    389993  ACTGACACTAAAAAAAGGGTCGTACGTCTTACTGGCAGCGC-GAAAAATGTTTCGAAAAT  390051</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 8521
+
| rowspan="2"| 2011-02-03
| 8521
+
| rowspan="2"| [https://www.yeastgenome.org/locus/YBR201C-A YBR201C-A], [https://www.yeastgenome.org/locus/YBR202W YBR202W]
 +
| 625500
 +
| 625500
 
| Substitution
 
| Substitution
 +
| T
 
| C
 
| C
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 625435
 +
| 625435
 +
| Insertion
 +
|
 
| T
 
| T
 +
|-
 +
| || colspan="6" | A single nucleotide insertion and a single nucleotide substitution were made in the intergenic region between ORFs YBR201C-A and MCM7/YBR202W.
 +
<pre>New    625423  ATTTTCTCAATAACAGGTCGAGGCCCCTTCTACCCTTGAATGCTACTTATTACTCACTCA  625482
 +
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
 +
Old    625419  ATTTTCTCAATAACAGG-CGAGGCCCCTTCTACCCTTGAATGCTACTTATTACTCACTCA  625477
 +
New    625483  TAATACATTGTATAAGCCTTCGCGTTTTTCACGGCCTCGAAAAAATTTTTCTTAACTAAT  625542
 +
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
 +
Old    625478  TAATACATTGTATAAGCCTTCGTGTTTTTCACGGCCTCGAAAAAATTTTTCTTAACTAAT  625537</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 8365
+
| 2011-02-03
| 8366
+
| [https://www.yeastgenome.org/locus/YBR200W-A YBR200W-A], [https://www.yeastgenome.org/locus/YBR201W YBR201W]
 +
| 623444
 +
| 623444
 
| Deletion
 
| Deletion
| TT
+
| C
 
|  
 
|  
 +
|-
 +
| || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs YBR200W-A and DER1/YBR201W.
 +
<pre>New    623434  GAAGGTATAACAAAA-CAGATAGACACCTAATAAAGAACAAAATATTCCTATAGTTTTGC  623492
 +
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
 +
Old    623429  GAAGGTATAACAAAACCAGATAGACACCTAATAAAGAACAAAATATTCCTATAGTTTTGC  623488</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 8344
+
| 2011-02-03
| 8344
+
| [https://www.yeastgenome.org/locus/YBL001C YBL001C], [https://www.yeastgenome.org/locus/YBL002W YBL002W]
| Substitution
+
| 237021
| T
+
| 237021
| C
+
| Insertion
 +
|
 +
| G
 
|-
 
|-
| || colspan="6" | Several sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL073C and YCL069W. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs HTB2/YBL002W and ECM15/YBL001C.
<pre>Old:   8298 CCAACAACACTAGAACTCATCCGATAATTTATTTACTTGATTATTCTTTTTTTTTTTTTT 8357
+
<pre>New   236992  AGGGTCTAGTCTATCAGCCTCCGAAGGGAGTTGTATAAATGTATATATATAACTTTATAA  237051
            |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
+
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
New:    8307 CCAACAACACTAGAACTCATCCGATAATTTATTTACTTGATTATTCCTTTTTTTTTTTTT 8366
+
Old    236995 AGGGTCTAGTCTATCAGCCTCCGAAGG-AGTTGTATAAATGTATATATATAACTTTATAA  237053</pre>
Old:   8358 TTTCTCTTTCCAGTCCATAAAACTATTTTACTTTTCTTATTTATGTAAATAGTATTTAAGA 8418
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
            ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
New:    8367 TCTCTTT--CCAGTCCATAAAACTATTTTACTTTTCTTATTTATGTAAATAGTATTTAAGA 8425
 
Old:   8476 ATATATACTTTTACTGACACCTTTCGTCACTATTTTTTGTTTAACCTTTTTTTTGGAAG 8534
 
            ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
 
New:   8483 ATATATACTTTTACTGACACCTTTCGTCACTATTTTTTGTTTAACTTTTTTTTTGGAAG 8541
 
Old:    8535 CACTAAAATTATATGCTCGTAATTATTGAGCATCAAAAAAAATAAAAAAAA--- 8585
 
              ||||||||||||||||||||||||||||||||||||||||| ||||||||
 
New:   8542 TACTAAAATTATATGCTCGTAATTATTGAGTATCAAAAAAAAAAAAAAAAAAAA 8595
 
Old:    8640 ACTTTGACCTGTCGTCGTACAATCAACTTAGTTTCTGAAAATCCACAACGAACCAGTTAT 8699
 
            ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||
 
New:   8650 ACTTTGACCTGTCGTCGTACAATCAACTTAGTTTCCGAAAATCCACGACGAACCAGTTAT 8709
 
Old:    8700 ACCGAAGACTTTTGTACGACAAGAATACTGTACTGTCGAAACTATCTCTTTTCAAACTGA 8759
 
            ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
 
New:   8710 ACCGAAGACTTTTGTACGACAAGAATACTGTACCGTCGAAACTATCTCTTTTCAAACTGA 8769
 
Old:    8760 TGAGCGAAGCTTGTGTTTATGTCTGTTGAAACAAGGAAAAAAATGCGGTGCCTGTCGACA 8819
 
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:    8770 TGAGTGAAGCTTGTGTTTATGTCTGTTGAAACAAGGAAAAAAATGCGGTGCCTGTCGACA 8829</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="11"| 2000-09-13
+
| rowspan="2"| 2011-02-03
| rowspan="11"| [https://www.yeastgenome.org/locus/YCL073C YCL073C], [https://www.yeastgenome.org/locus/YCLWomega2 YCLWomega2]
+
| rowspan="2"| [https://www.yeastgenome.org/locus/ARS208 ARS208], [https://www.yeastgenome.org/locus/CEN2 CEN2]
| 6231
+
| 238133
| 6231
+
| 238133
 
| Substitution
 
| Substitution
| T
 
 
| G
 
| G
 +
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6226
+
| 238116
| 6226
+
| 238116
 
| Substitution
 
| Substitution
 +
| G
 
| A
 
| A
| G
+
|-
 +
| || colspan="6" | Two separate single nucleotide substitutions were made in the intergenic region between ARS208 and CEN2.
 +
<pre>New    238082  AGTACTTGCTTTCAGCAGAAAATGAAAAAAAGAACGTTCAAACAGACTGAAAATATAGCT  238141
 +
              |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||
 +
Old    238084  AGTACTTGCTTTCAGCAGAAAATGAAAAAAAGGACGTTCAAACAGACTGGAAATATAGCT  238143</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6195
+
| 2011-02-03
| 6195
+
| [https://www.yeastgenome.org/locus/YBL079W YBL079W], [https://www.yeastgenome.org/locus/YBL080C YBL080C]
| Substitution
+
| 75208
| T
+
| 75208
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 6164
 
| 6164
 
 
| Substitution
 
| Substitution
| T
 
 
| A
 
| A
 +
| G
 +
|-
 +
| || colspan="6" | A single nucleotide substitution was made in the intergenic region between ORFs PET112/YBL080C and NUP170/YBL079W.
 +
<pre>New    75178  GGAGAATTACTGGAACCTAGGATCTGACAAGCGGACAAAAAAGCAGAGTGCGTTTATTAC  75237
 +
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
 +
Old    75175  GGAGAATTACTGGAACCTAGGATCTGACAAGCGAACAAAAAAGCAGAGTGCGTTTATTAC  75234</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6090
+
| 2011-02-03
| 6090
+
| [https://www.yeastgenome.org/locus/YBL077W YBL077W], [https://www.yeastgenome.org/locus/YBL078C YBL078C]
| Substitution
+
| 80747
 +
| 80747
 +
| Deletion
 
| T
 
| T
| C
+
|  
 +
|-
 +
| || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs ATG8/YBL078C and YBL077W.
 +
<pre>New    80708  TTCAGACTTAAATGTAGACTTCATGTCTCTAGTAATTATTTT-ATTATGATTTTCTCAAC  80766
 +
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
 +
Old    80705  TTCAGACTTAAATGTAGACTTCATGTCTCTAGTAATTATTTTTATTATGATTTTCTCAAC  80764</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6055
+
| 2011-02-03
| 6055
+
| [https://www.yeastgenome.org/locus/YBL072C YBL072C]
 +
| 89277
 +
| 89277
 
| Substitution
 
| Substitution
| C
 
 
| G
 
| G
|- style="height:30px; width:30px; text-align:center;"
 
| 6014
 
| 6014
 
| Substitution
 
 
| T
 
| T
| C
+
|-
 +
| || colspan="6" | A single nucleotide substitution was made within the 5' UTR intron of ORF RPS8A/YBL072C.
 +
<pre>New    89267  GGCTTGATTTTTTGGGTACACAAAGGATTCAGTTTAGTGCACTGCTCCTGTCACAATTTA  89326
 +
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
 +
Old    89265  GGCTTGATTTTTGGGGTACACAAAGGATTCAGTTTAGTGCACTGCTCCTGTCACAATTTA  89324</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6006
+
| 2011-02-03
| 6006
+
| [https://www.yeastgenome.org/locus/YBL067C YBL067C], [https://www.yeastgenome.org/locus/YBL068W YBL068W]
| Substitution
+
| 93622
 +
| 93622
 +
| Deletion
 
| C
 
| C
 +
|
 +
|-
 +
| || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs PRS4/YBL068W and UBP13/YBL067C.
 +
<pre>New    93594  AAAGGAGACGGTGAACCTTTACCTTCC-TTGATATGCAAATATTTTTCAGCTTTTCCTAA  93652
 +
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
 +
Old    93595  AAAGGAGACGGTGAACCTTTACCTTCCCTTGATATGCAAATATTTTTCAGCTTTTCCTAA  93654</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| rowspan="4"| 2011-02-03
 +
| rowspan="4"| [https://www.yeastgenome.org/locus/YBR077C YBR077C], [https://www.yeastgenome.org/locus/YBR078W YBR078W]
 +
| 392822
 +
| 392822
 +
| Insertion
 +
|
 
| T
 
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 5990
+
| 392568
| 5990
+
| 392569
 
| Substitution
 
| Substitution
| G
+
| CG
| A
+
| GC
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 5980
+
| 392557
| 5980
+
| 392558
 
| Substitution
 
| Substitution
| G
+
| CG
| A
+
| GC
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6098
+
| 392340
| 6098
+
| 392340
| Substitution
+
| Deletion
| C
+
| TT
| T
+
|  
 
|-
 
|-
| || colspan="6" | Several sequence changes were made in the systematic sequence in the intergenic region between features YCLWomega2 and YCL073C. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | Several nucleotide changes were made in the intergenic region between ORFs SLM4/YBR077C and ECM33/YBR078W.
<pre>Old:   5949 ACGGAACACATCAACTTGTAACGACAACAATGCAAAATACCGGGAGACATATCACTTCTT 6008
+
<pre>New   392327  GATAACTGCCTTTTTTTTTT--CTTCTTATCTTCCCTTAATTAATTCATTAGAGTCTTTT  392384
            ||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||
+
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   5944 ACGGAACACATCAACTTGTAACGACAACAATACAAAATACCAGGAGACATATCACTTTTT 6003
+
Old   392321  GATAACTGCCTTTTTTTTTTTTCTTCTTATCTTCCCTTAATTAATTCATTAGAGTCTTTT  392380
Old:   6009 TTCGCTTAGAATGATTTACAATGGCATACACTTAGAAAAGTGCTATCACATGACGCCCTT 6068
+
New   392545  CACGACCCGGGTGGCTGCTGCGCCCTCGCGAAAAAGAAATGAAATGGAGTGCAAAAACGG  392604
            ||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||
+
              |||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||
New:    6004 TTCGCCTAGAATGATTTACAATGGCATACACTTAGAAAAGTGCTATGACATGACGCCCTT 6063
+
Old    392541  CACGACCCGGGTGGCTCGTGCGCCCTCCGGAAAAAGAAATGAAATGGAGTGCAAAAACGG  392600
Old:   6069 ACTAGAAGTTACATGATTCTCTTTTTTTTCCTTTCTTTCTTTCTTTTTCGGTACAACATA 6128
+
New    392805  AATGTCAAACACCTACGACTTTTCGCAATCAACGGACCTCTCTTGCATTTTTGTATTTAA  392864
            ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||
+
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
New:    6064 ACTAGAAGTTACATGATTCTCCTTTTTTTTCTTTCTTTCTTTCTTTTTCGGTACAACATA 6123
+
Old   392801  AATGTCAAACACCTACGACTTT-CGCAATCAACGGACCTCTCTTGCATTTTTGTATTTAA  392859</pre>
Old:   6129 ATTAATGCATTCATACAGAGCGCATTTCCAGCATCTTTTATTGGATAGTAACTCCTCCCG 6188
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
            ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
New:   6124 ATTAATGCATTCATACAGAGCGCATTTCCAGCATCATTTATTGGATAGTAACTCCTCCCG 6183
 
Old:   6189 CACTTTTAATATCAATGACGCTGACTCTTTTACTGACACTGATTCTTTACCGACGCTGAG 6248
 
            |||||| |||||||||||||||||||||||||||||| |||| |||||||||||||||||
 
New:   6184 CACTTTCAATATCAATGACGCTGACTCTTTTACTGACGCTGAGTCTTTACCGACGCTGAG 6243</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="16"| 2000-09-13
+
| rowspan="2"| 2011-02-03
| rowspan="16"| [https://www.yeastgenome.org/locus/YCL073C YCL073C], [https://www.yeastgenome.org/locus/YCLWomega2 YCLWomega2]
+
| rowspan="2"| [https://www.yeastgenome.org/locus/YBR072C-A YBR072C-A], [https://www.yeastgenome.org/locus/YBR072W YBR072W]
| 6466
+
| 382742
| 6466
+
| 382742
| Substitution
+
| Insertion
| A
+
|
 
| G
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6444
+
| 382729
| 6446
+
| 382729
| Deletion
+
| Insertion
| TTT
+
|
|  
+
| G
 +
|-
 +
| || colspan="6" | Two separate single nucleotide insertions were made in the intergenic region between ORFs HSP26/YBR072W and YBR072C-A.
 +
<pre>New    382719  TTGCTTGCATATGGGCTTGAAACATATGGTCATCACATCTGAGCGATTTTACCTCTTAGA  382778
 +
              |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||
 +
Old    382716  TTGCTTGCATATGG-CTTGAAACATATG-TCATCACATCTGAGCGATTTTACCTCTTAGA  382773</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6443
+
| rowspan="2"| 2011-02-03
| 6443
+
| rowspan="2"| [https://www.yeastgenome.org/locus/YBR066C YBR066C], [https://www.yeastgenome.org/locus/YBR067C YBR067C]
| Substitution
+
| 371424
| T
+
| 371424
| G
+
| Insertion
|- style="height:30px; width:30px; text-align:center;"
+
|
| 6433
 
| 6433
 
| Substitution
 
| T
 
 
| A
 
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6398
+
| 370774
| 6398
+
| 370773
 
| Substitution
 
| Substitution
 
| C
 
| C
 
| T
 
| T
 +
|-
 +
| || colspan="6" | A single nucleotide substitution and a single nucleotide insertion were made in the intergenic region between ORFs NRG2/YBR066C and TIP1/YBR067C.
 +
<pre>New    370729  TTGTTCTTCGAACAGTAGCGAGTGCTCATATGACTTGGTGCCGGAAATTCATTTGAGCTG  370788
 +
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
 +
Old    370727  TTGTTCTTCGAACAGTAGCGAGTGCTCATATGACTTGGTGCCGGAAACTCATTTGAGCTG  370786
 +
New    371389  AAGGTTATAGTCTCCTTTTTTTCTTGGCTTCGGGAAAAATACGATTTGTTTGTTATTCTA  371448
 +
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
 +
Old    371387  AAGGTTATAGTCTCCTTTTTTTCTTGGCTTCGGGAAAA-TACGATTTGTTTGTTATTCTA  371445</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6391
+
| rowspan="2"| 2011-02-03
| 6391
+
| rowspan="2"| [https://www.yeastgenome.org/locus/ARS230 ARS230], [https://www.yeastgenome.org/locus/YBL100W-C YBL100W-C]
| Substitution
+
| 28909
 +
| 28909
 +
| Insertion
 +
|
 
| A
 
| A
| G
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6377
+
| 28887
| 6377
+
| 28887
| Substitution
+
| Insertion
| A
+
|
| G
+
| AT
 +
|-
 +
| || colspan="6" | A dinucleotide insertion and a mononucleotide insertion were made in the intergenic region between ORF YBL100W-C and ARS230.
 +
<pre>New    28859  ATTACTGTTTCGGGAATATAACGTTTGATATCGCTAGCGCACCCAGATGAGAAATCCGCA  28918
 +
              |||||||||||||||||||||||||||||  |||||||||||||||||||||| ||||||
 +
Old    28859  ATTACTGTTTCGGGAATATAACGTTTGAT--CGCTAGCGCACCCAGATGAGAA-TCCGCA  28915</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6325
+
| 2011-02-03
| 6325
+
| [https://www.yeastgenome.org/locus/ARS228 ARS228]
| Substitution
+
| 792273
| A
+
| 792273
| G
+
| Insertion
 +
|
 +
| T
 +
|-
 +
| || colspan="6" | A single nucleotide insertion was made within ARS228.
 +
<pre>New    792231  TTTGTTATGAATCTGAAAAGAAAAATACTATTTTAGCAATACAATGAATTTTAAAAAGTT  792290
 +
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
 +
Old    792226  TTTGTTATGAATCTGAAAAGAAAAATACTATTTTAGCAATACAATGAA-TTTAAAAAGTT  792284</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2011-02-03
 +
| [https://www.yeastgenome.org/locus/ARS225 ARS225], [https://www.yeastgenome.org/locus/YBR275C YBR275C]
 +
| 757291
 +
| 757291
 +
| Deletion
 +
| A
 +
|
 +
|-
 +
| || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORF RIF1/YBR275C and ARS225.
 +
<pre>New    757242  ATCTTCTTGCTAACGATGAGTCGCCAATAAATAAAAAATCGACG-CGTCGGTCAATTATA  757310
 +
              |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
 +
Old    757237  ATCTTCTTGCTAACGATGAGTCGCCAATAAATAAAAAATCGACGACGTCGGTCAATTATA  757306</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6315
+
| rowspan="2"| 2011-02-03
| 6315
+
| rowspan="2"| [https://www.yeastgenome.org/locus/ARS208 ARS208]
 +
| 237892
 +
| 237892
 
| Substitution
 
| Substitution
 +
| G
 
| A
 
| A
| C
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6281
+
| 237839
| 6281
+
| 237839
 
| Substitution
 
| Substitution
| T
 
 
| G
 
| G
 +
| A
 +
|-
 +
| || colspan="6" | Two separate single nucleotide substitutions were made within ARS208.
 +
<pre>New    237832  TTGCGAAAATTATTCTTTAATAGTTTAACTAAAAGTAAAAAGTTAGAAATCATAAATAAA  237891
 +
              ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
 +
Old    237834  TTGCGGAAATTATTCTTTAATAGTTTAACTAAAAGTAAAAAGTTAGAAATCATAAATAGA  237893</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6279
+
| 2011-02-03
| 6279
+
| [https://www.yeastgenome.org/locus/YBL103C YBL103C], [https://www.yeastgenome.org/locus/YBL104C YBL104C]
| Substitution
+
| 21376
| C
+
| 21376
| T
+
| Insertion
 +
|
 +
| A
 +
|-
 +
| || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs YBL104C and RTG3/YBL103C.
 +
<pre>New    21361  CTTATGCTATCTTGAAATATATCATCGCCGTAAAGTATGATGTGTAGCGCATTAGTCTTC  21420
 +
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
 +
Old    21361  CTTATGCTATCTTGAA-TATATCATCGCCGTAAAGTATGATGTGTAGCGCATTAGTCTTC  21419</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6267
+
| rowspan="3"| 2011-02-03
| 6267
+
| rowspan="3"| [https://www.yeastgenome.org/locus/YBL102W YBL102W], [https://www.yeastgenome.org/locus/YBL103C YBL103C]
 +
| 28913
 +
| 28913
 
| Substitution
 
| Substitution
| T
 
 
| C
 
| C
 +
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6255
+
| 23855
| 6256
+
| 23856
| Substitution
+
| Deletion
| GT
 
 
| CC
 
| CC
 +
|
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6248
+
| 23947
| 6248
+
| 23947
 
| Insertion
 
| Insertion
|  
+
|
| TCTTTACCGACGCTGAG
+
| A
 +
|-
 +
| || colspan="6" | Several sequence changes were made in the intergenic region between ORFs RTG3/YBL103C and SFT2/YBL102W.
 +
<pre>New    23821  GAAGGCTTTTCTAATCACCATGGCTTTATTATTTC--AAAAGTAACTTGCGAAGAGTCAC  23878
 +
              |||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||
 +
Old    23820  GAAGGCTTTTCTAATCACCATGGCTTTATTATTTCCCAAAAGTAACTTGCGAAGAGTCAC  23879
 +
New    23879  ATCCCGCGGAACGGCCCGCAATCGTGACCCGGCAAAAGGCGATTGTAATGAAGAGGGAGT  23938
 +
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
 +
Old    23880  ATCCCGCGGAACGGCCCGCAATCGTGACCCGGCCAAAGGCGATTGTAATGAAGAGGGAGT  23939
 +
New    23939  ATTGGTCAAGACTTGTACTATACTGAAATAGGAAGAAGATTGAATAAATTTGCATTCTAA  23998
 +
              |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
 +
Old    23940  ATTGGTCA-GACTTGTACTATACTGAAATAGGAAGAAGATTGAATAAATTTGCATTCTAA  23998</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6389
+
| 2011-02-03
| 6389
+
| [https://www.yeastgenome.org/locus/YBR125C YBR125C], [https://www.yeastgenome.org/locus/YBR126C YBR126C]
 +
| 488600
 +
| 488601
 
| Substitution
 
| Substitution
| A
+
| TC
| G
+
| AT
 +
|-
 +
| || colspan="6" | A dinucleotide substitution was made in the intergenic region between ORFs PTC4/YBR125C and TPS1/YBR126C.
 +
<pre>New    488565  CGTTATGCGGTGTGAACAGCGACAATAAAAAAAAATGTGGGATAAATTATGGCTTTTTTT  488624
 +
              |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||
 +
Old    488559  CGTTATGCGGTGTGAACAGCGACAATAAAAAAAAATGTGGGTCAAATTATGGCTTTTTTT  488618</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 6261
+
| 2011-02-03
| 6261
+
| [https://www.yeastgenome.org/locus/YBR102C YBR102C], [https://www.yeastgenome.org/locus/YBR103W YBR103W]
 +
| 447535
 +
| 447536
 
| Substitution
 
| Substitution
| T
+
| CG
| C
+
| GC
 
|-
 
|-
| || colspan="6" | Several sequence changes were made in the systematic sequence in the intergenic region between features YCLWomega2 and YCL073C. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | A dinucleotide substitution was made in the intergenic region between ORFs EXO84/YBR102C and SIF2/YBR103W.
<pre>Old:   6249 -----------------TCTTTAGTG 6257
+
<pre>New   447525  AAAGGTTATGAGATATGCAAGACCATTCGTTTTGATTTGCAATTAGTGAGAACAATTTAA  447584
                              |||||| |
+
              |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:    6244 TCTTTACCGACGCTGAGTCTTTACCG 6269
+
Old   447519  AAAGGTTATGAGATATCGAAGACCATTCGTTTTGATTTGCAATTAGTGAGAACAATTTAA  447578</pre>
Old:    6258 ACGTTGAGTTTTTACCGACGCCTTTGAAAATAAAAAGTACGACACAGCTATATGCGTAGC 6317
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
            ||| ||||| ||||||||||| | ||||||||||||||||||||||||||||||||| ||
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
New:   6270 ACGCTGAGTCTTTACCGACGCTTGTGAAAATAAAAAGTACGACACAGCTATATGCGTCGC 6329
 
Old:   6318 AAGTTCAAATGTGGGTCTATCGAGCATGTTTATCCTATCCTGTTATGTCATTTTTATCGA 6377
 
            ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:   6330 AAGTTCAGATGTGGGTCTATCGAGCATGTTTATCCTATCCTGTTATGTCATTTTTATCGG 6389
 
Old:   6378 AAGTAATAAAAATATAGAAACCACTTGTTTTTGCCTTTTTTGTGATTTTGCTTTCTTTTT 6437
 
            ||||||||||| | |||||| |||||||||||||||||||||||||||||||||| ||||
 
New:   6390 AAGTAATAAAAGTGTAGAAATCACTTGTTTTTGCCTTTTTTGTGATTTTGCTTTCATTTT 6449
 
Old:    6438 TTTTTTTTTCCCTTTTTTCACCAGCTTGAGGATCAACATCCTGATTCCTTGTCACTTCGA 6497
 
            |||||    ||||||||||||||||||| ||||||||||||| ||| ||||| |||||||
 
New:   6450 TTTTTG---CCCTTTTTTCACCAGCTTGGGGATCAACATCCTAATTTCTTGTTACTTCGA 6506</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="2"| 2000-09-13
+
| rowspan="3"| 2011-02-03
| rowspan="2"| [https://www.yeastgenome.org/locus/YCL068C YCL068C]
+
| rowspan="3"| [https://www.yeastgenome.org/locus/YBR013C YBR013C], [https://www.yeastgenome.org/locus/YBRCdelta14 YBRCdelta14]
| 12268
+
| 265922
| 12268
+
| 265922
 
| Deletion
 
| Deletion
| T
+
| C
 
|  
 
|  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 12049
+
| 265905
| 12049
+
| 265905
 
| Substitution
 
| Substitution
 +
| T
 
| G
 
| G
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 265902
 +
| 265902
 +
| Deletion
 
| C
 
| C
|-
 
| || colspan="6" | Two sequence changes were made in the systematic sequence in the region encompassing ORF YCL068C. The G at 12049 was changed to C, and the T at 12268 was deleted. These changes resulted in the N-terminal elongation of the predicted protein sequence by 70 amino acids. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  12000 GACGAGGGGGCATTCTCTAGAGACACAGGCAGTTGCTTCCAGCAACTGCGGTACGGCCGT 12059
 
            ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
 
New:  12010 GACGAGGGGGCATTCTCTAGAGACACAGGCAGTTGCTTCCAGCAACTGCCGTACGGCCGT 12069
 
Old:  12240 AAGGTAGGCGAGGACATTATCTATCAGTTACAAACATCTTAGTAGTGTCTGAGGAGAGGG 12299
 
            |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
 
New:  12250 AAGGTAGGCGAGGACATTATCTATCAGT-ACAAACATCTTAGTAGTGTCTGAGGAGAGGG 12308</pre>
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2000-09-13
 
| [https://www.yeastgenome.org/locus/YCL067C YCL067C], [https://www.yeastgenome.org/locus/YCL068C YCL068C]
 
| 12340
 
| 12340
 
| Insertion
 
 
|  
 
|  
| AT
 
 
|-
 
|-
| || colspan="6" | A dinucleotide insertion was made in the systematic sequence in the intergenic region between ORFs YCL068C and YCL067C. An AT was inserted after the T at 12340. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | Several nucleotide changes were made within the intergenic region between ORF YBR013C and Ty1 LTR YBRCdelta14.
<pre>Old:  12300 TTGATTGTTTATGTATTTTTGCGAAATATATATATATATAT--TCTACACAGATATATAC 12357
+
<pre>New    265852  GATACATATCCTGAATAAGGGATATATCATTATGAGGTTAAGTGGCCTAAAA-ACGCAAT  265910
            ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
+
              |||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||
New:   12309 TTGATTGTTTATGTATTTTTGCGAAATATATATATATATATATTCTACACAGATATATAC 12368</pre>
+
Old   265850  GATACATATCCTGAATAAGGGATATATCATTATGAGGTTAAGTGGCCTAAAACACTCAAT  265909
 +
New    265911  TAATACGGATCC-TTGTACTATTAAGTCTTTTCTATCTCTGAAAATTAACTTAAGAAGCG  265969
 +
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
 +
Old    265910  TAATACGGATCCCTTGTACTATTAAGTCTTTTCTATCTCTGAAAATTAACTTAAGAAGCG  265969</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="3"| 2000-09-13
+
| 2011-02-03
| rowspan="3"| [https://www.yeastgenome.org/locus/YCL064C YCL064C]
+
| [https://www.yeastgenome.org/locus/YBR295W YBR295W], [https://www.yeastgenome.org/locus/YBR296C YBR296C]
| 16068
+
| 796707
| 16068
+
| 796707
 
| Substitution
 
| Substitution
 +
| A
 
| G
 
| G
| T
+
|-
 +
| || colspan="6" | A single nucleotide substitution was made in the intergenic region between ORFs PCA1/YBR295W and PHO89/YBR296C.
 +
<pre>New    796671  TAAATTAGAAAAAAATTAATGCATCTTTAAGGTTTTAAATTAGAAATGTTTTAACTTTAA  796730
 +
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
 +
Old    796665  TAAATTAGAAAAAAATTAATGCATCTTTAAGGTTTTAAATTAAAAATGTTTTAACTTTAA  796724</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 15921
+
| rowspan="2"| 2011-02-03
| 15921
+
| rowspan="2"| [https://www.yeastgenome.org/locus/YBR292C YBR292C], [https://www.yeastgenome.org/locus/YBR293W YBR293W]
 +
| 786761
 +
| 786761
 
| Insertion
 
| Insertion
|  
+
|
| C
+
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 15918
+
| 786736
| 15918
+
| 786737
| Deletion
+
| Substitution
| T
+
| CT
|  
+
| TC
 
|-
 
|-
| || colspan="6" | Three sequence changes were made in the systematic sequence within ORF YCL064C. The T at 15918 was deleted, a single C was inserted after the C at 15921, and the G at 16068 was changed to T. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | Several nucleotide changes were made in the intergenic region between ORFs YBR292C and YBR293W.
<pre>Old:  15898 CTTTATAGTATTAGAGGAGCTCGC-ACAAGCAATAATTATCACAATGTCATCCGCAGCTA 15956
+
<pre>New    786721  TTCCAAATCAGATTTTTTTTCGCAATGCTTAAATCTAGTAAACACAAAGTACTACCGAAA  786780
            |||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||
+
              ||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||
New:  15909 CTTTATAGTATTAGAGGAGC-CGCCACAAGCAATAATTATCACAATGTCATCCGCAGCTA 15967
+
Old    786717  TTCCAAATCAGATTTTTTTCTGCAATGCTTAAATCTAGTAAACAC-AAGTACTACCGAAA  786776
Old:  16017 CACATGCCGGTTCAATCACCATATTGAATTGATGTGTATATTTAAGACAGGGTTCAATAA 16076
+
New    786761  AACACAAAGTACTACCGAAAAGCAAGGATGGAAACTATGGCAGTATTGAAGAGACTGAAA  786820
            ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
+
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   16028 CACATGCCGGTTCAATCACCATATTGAATTGATGTGTATATTTAAGACAGGTTTCAATAA 16087</pre>
+
Old    786757  AACAC-AAGTACTACCGAAAAGCAAGGATGGAAACTATGGCAGTATTGAAGAGACTGAAA  786815</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="8"| 2000-09-13
+
| rowspan="4"| 2011-02-03
| rowspan="8"| [https://www.yeastgenome.org/locus/YCL063W YCL063W], [https://www.yeastgenome.org/locus/YCL064C YCL064C]
+
| rowspan="4"| [https://www.yeastgenome.org/locus/YBL098W YBL098W], [https://www.yeastgenome.org/locus/YBL099W YBL099W]
| 17185
+
| 38920
| 17185
+
| 38920
| Insertion
+
| Substitution
|  
+
| C
 +
| A
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 38917
 +
| 38917
 +
| Substitution
 +
| C
 
| T
 
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 17079
+
| 38800
| 17079
+
| 38800
| Insertion
+
| Substitution
|  
 
 
| C
 
| C
 +
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 17067
+
| 38728
| 17067
+
| 38728
 
| Substitution
 
| Substitution
 +
| C
 
| A
 
| A
| G
+
|-
 +
| || colspan="6" | Several single nucleotide substitutions were made in the intergenic region between ORFs ATP1/YBL099W and BNA4/YBL098W.
 +
<pre>New    38699  AAAAAAATAAAAATGAATATAAGGTACGTCTCAAAAAGAAATGTAAATATAGAAATTTTA  38758
 +
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
 +
Old    38696  AAAAAAATAAAAATGAATATAAGGTACGTCTCCAAAAGAAATGTAAATATAGAAATTTTA  38755
 +
New    38759  AAAAAAAAAACGAAAAAAAACATAACTAAATTTAAAGTGCAGCCAAACAATAACCCTGAA  38818
 +
              |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
 +
Old    38756  AAAAAAAAAACGAAAAAAAACATAACTAAATTTAAAGTGCAGCCCAACAATAACCCTGAA  38815
 +
New    38879  GTAAATAATGCCCCTACTTTTCTTCTAAGGAAATGAGTTACTACAAAAATAAGGAAATAT  38938
 +
              |||||||||||||||||||||||||||||||| |||||||| || |||||||||||||||
 +
Old    38876  GTAAATAATGCCCCTACTTTTCTTCTAAGGAAGTGAGTTACCACCAAAATAAGGAAATAT  38935</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 17045
+
| 2011-02-03
| 17045
+
| [https://www.yeastgenome.org/locus/YBL092W YBL092W], [https://www.yeastgenome.org/locus/YBL093C YBL093C]
| Insertion
+
| 45495
|
+
| 45495
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
| 17035
 
| 17035
 
| Insertion
 
|
 
| TA
 
|- style="height:30px; width:30px; text-align:center;"
 
| 17026
 
| 17026
 
| Insertion
 
|
 
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
| 16992
 
| 16992
 
 
| Substitution
 
| Substitution
| A
 
 
| T
 
| T
|- style="height:30px; width:30px; text-align:center;"
 
| 16970
 
| 16970
 
| Substitution
 
 
| A
 
| A
| T
 
 
|-
 
|-
| || colspan="6" | Several sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL064C and YCL063W. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | A single nucleotide substitution was made in the intergenic region between ORFs ROX3/YBL093C and RPL32/YBL092W.
<pre>Old:   16917 GAGAAAACTGTATAAACATTTTCCTTTTATTTGGCGATATTTATATACCTGTGATCCTCC 16976
+
<pre>New    45479   ACTGGAGAAGAGTGTTTGAATCCAGCAGAAGGTAATACGCACCTTTCTCATCTATTTGCA  45538
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
+
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
New:  16928 GAGAAAACTGTATAAACATTTTCCTTTTATTTGGCGATATTTATATACCTGTGTTCCTCC 16987
+
Old   45476   ACTGGAGAAGAGTGTTTGATTCCAGCAGAAGGTAATACGCACCTTTCTCATCTATTTGCA  45535</pre>
Old:   16977 TCATATTGTCCCTTTAATCTTATCTCATCGCAAACAATTTGATAAAGCTT-GGCACTATT 17035
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
            ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
New:   16988 TCATATTGTCCCTTTTATCTTATCTCATCGCAAACAATTTGATAAAGCTTTGGCACTATT 17047
 
Old:   17036 --ATGACACTCA-TGGAATTACATTTCCGCTGGGACTTAACAGGAGC-GCCCATGCGGAA 17091
 
              |||||||||| ||||||||||||||||||||| |||||||||||| ||||||||||||
 
New:   17048 TAATGACACTCAGTGGAATTACATTTCCGCTGGGGCTTAACAGGAGCCGCCCATGCGGAA 17107
 
Old:  17152 GAGAAAAAGAAAAATAGTAGGAACATTTCGCAAT-GATCAAAATGTAAACAGTGCAGTAA 17210
 
            |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
 
New:  17168 GAGAAAAAGAAAAATAGTAGGAACATTTCGCAATTGATCAAAATGTAAACAGTGCAGTAA 17227</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="3"| 2000-09-13
+
| 2011-02-03
| rowspan="3"| [https://www.yeastgenome.org/locus/YCL061C YCL061C]
+
| [https://www.yeastgenome.org/locus/YBL087C YBL087C], [https://www.yeastgenome.org/locus/YBL088C YBL088C]
| 21923
+
| 59406
| 21923
+
| 59406
| Substitution
 
| T
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
| 21911
 
| 21911
 
 
| Insertion
 
| Insertion
|  
+
|
 
| T
 
| T
 +
|-
 +
| || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs TEL1/YBL088C and RPL23A/YBL087C.
 +
<pre>New    59399  ATTTCCCTTTTTCTTTGAAGGCTTTTTTTTCGAATTTCCTGCTTTTTTTGCGAGGCTTTG  59458
 +
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
 +
Old    59396  ATTTCCCTTTT-CTTTGAAGGCTTTTTTTTCGAATTTCCTGCTTTTTTTGCGAGGCTTTG  59454</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 21801
+
| 2011-02-03
| 21801
+
| [https://www.yeastgenome.org/locus/YBL086C YBL086C], [https://www.yeastgenome.org/locus/YBL087C YBL087C]
 +
| 61056
 +
| 61056
 
| Deletion
 
| Deletion
| C
+
| T
 
|  
 
|  
 
|-
 
|-
| || colspan="6" | Three sequence changes were made in the systematic sequence in the region encompassing ORF YCL061C. The C at 21801 was deleted, a T was inserted after the T at 21911, and the T at 21923 was changed to G, resulting in the N-terminal extension of the predicted protein sequence by 243 amino acids. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs RPL23A/YBL087C and YBL086C.
<pre>Old:   21771 CGGATTTCTCCAGCTCTTCACCACCATCGTCAAAGATTAGAGATTAATTGAGTTGGTAAC 21830
+
<pre>New    61019   AAAAACTTGGTCTGTTGAAAATAATAACTGCATGGGTTTTT-CAAAGCAGTTGGGGGTGT  61077
            |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
+
              ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
New:   21788 CGGATTTCTCCAGCTCTTCACCACCATCGT-AAAGATTAGAGATTAATTGAGTTGGTAAC 21846
+
Old    61015   AAAAACTTGGTCTGTTGAAAATAATAACTGCATGGGTTTTTTCAAAGCAGTTGGGGGTGT  61074</pre>
Old:   21891 AATCTGTTCTTAACACGATT-AATGTGGCATTTGCAAATAAAAACCCGTTCCCAGTCAAC 21949
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
            |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
New:   21907 AATCTGTTCTTAACACGATTTAATGTGGCATTGGCAAATAAAAACCCGTTCCCAGTCAAC 21966</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="4"| 2000-09-13
+
| 2011-02-03
| rowspan="4"| [https://www.yeastgenome.org/locus/YCL051W YCL051W], [https://www.yeastgenome.org/locus/YCL052C YCL052C]
+
| [https://www.yeastgenome.org/locus/YBR205W YBR205W], [https://www.yeastgenome.org/locus/YBR207W YBR207W]
| 35577
+
| 634934
| 35577
+
| 634934
| Insertion
+
| Substitution
|  
+
| C
 
| T
 
| T
 +
|-
 +
| || colspan="6" | A single nucleotide substitution was made in the intergenic region between ORFs KTR3/YBR205W and FTH1/YBR207W.
 +
<pre>New    634903  ATATACACATAATTCAATGTAGTAGCCACCTCACTTTATTCTAGTGCCTTCTTGGGTTCA  634962
 +
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
 +
Old    634898  ATATACACATAATTCAATGTAGTAGCCACCTCACTTCATTCTAGTGCCTTCTTGGGTTCA  634957</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 35570
+
| rowspan="2"| 2011-02-03
| 35570
+
| rowspan="2"| [https://www.yeastgenome.org/locus/YBR038W YBR038W], [https://www.yeastgenome.org/locus/YBR039W YBR039W]
| Insertion
+
| 315270
|  
+
| 315271
| T
+
| Substitution
 +
| CG
 +
| GC
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 35568
+
| 315071
| 35568
+
| 315071
| Insertion
+
| Deletion
 +
| G
 
|  
 
|  
| A
+
|-
 +
| || colspan="6" | A single nucleotide deletion and a dinucleotide substitution were made in the intergenic region between ORFs CHS2/YBR038W and ATP3/YBR039W.
 +
<pre>New    315050  TGTATGAGCTGGGCATCAAGAG-CTTTTGAGATTTTCCAAGTAGTAACTCATCTTTCTGA  315108
 +
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
 +
Old    315049  TGTATGAGCTGGGCATCAAGAGGCTTTTGAGATTTTCCAAGTAGTAACTCATCTTTCTGA  315108
 +
New    315229  TCGATAAAACAAAAAAAAAGTAAGAAGATATATGAATAGGAGCTGTCGCTAGAACTAGTA  315288
 +
              |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||
 +
Old    315229  TCGATAAAACAAAAAAAAAGTAAGAAGATATATGAATAGGACGTGTCGCTAGAACTAGTA  315288</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 35506
+
| 2011-02-03
| 35506
+
| [https://www.yeastgenome.org/locus/YBR036C YBR036C], [https://www.yeastgenome.org/locus/YBR037C YBR037C]
 +
| 310457
 +
| 310457
 
| Insertion
 
| Insertion
|  
+
|
| A
+
| T
 
|-
 
|-
| || colspan="6" | Four single nucleotide insertions were made in the systematic sequence in the intergenic region between ORFs YCL052C and YCL051W. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs CSG2/YBR036C and SCO1/YBR037C.
<pre>Old:  35450 TGATCTTTTTTATCAGGGGGATCTTCAAAGAAAGGAACTTTTTTTAGGAAAAAAAAA-TA 35508
+
<pre>New    310430  TCCTTTAGAGTGAGAGAGCTTTTTTTTTTCTTGCGATACACCTTCGCCGGGTGATAGCCG  310489
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
+
              |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
New:   35467 TGATCTTTTTTATCAGGGGGATCTTCAAAGAAAGGAACTTTTTTTAGGAAAAAAAAAATA 35526
+
Old    310430  TCCTTTAGAGTGAGAGAGCTTTTTTTTT-CTTGCGATACACCTTCGCCGGGTGATAGCCG  310488</pre>
Old:   35569 -GT-CTGCTGT-AGTGTGTCCTCCAATACTCTTGCACGACAAAGTTTTAGTTATCCCCTT 35625
+
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
              || ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
+
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
New:   35587 AGTTCTGCTGTTAGTGTGTCCTCCAATACTCTTGCACGACAAAGTTTTAGTTATCCCCTT 35646</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="7"| 2000-09-13
+
| 2011-02-03
| rowspan="7"| [https://www.yeastgenome.org/locus/YCL051W YCL051W]
+
| [https://www.yeastgenome.org/locus/YBR160W YBR160W], [https://www.yeastgenome.org/locus/YBR161W YBR161W]
| 37579
+
| 561435
| 37579
+
| 561435
| Insertion
+
| Deletion
 +
| C
 
|  
 
|  
| TT
+
|-
 +
| || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs CDC28/YBR160W and CSH1/YBR161W.
 +
<pre>New    561405  GCAAATTCATTGCTCTTTGAATTTTGAAGAGTTTCA-TTGTCACCGTTGAATAACCGAGA  561463
 +
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
 +
Old    561399  GCAAATTCATTGCTCTTTGAATTTTGAAGAGTTTCACTTGTCACCGTTGAATAACCGAGA  561458</pre>
 +
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 37553
+
| 2004-07-16
| 37553
+
| [https://www.yeastgenome.org/locus/YBL066C YBL066C]
| Insertion
+
| 96812
|  
+
| 96962
| C
+
| Substitution
 +
| GTGGTTGGATAGAGAACAGTGTTAG TCCCGTAGAATCGTGGTCGTTGTTC TATGATATCAACTTTGGAACAACTC AGAGGTGGATATCCCGTCTTTTAGA GGACCGGGGTCGGACGCGGAATCCA ACTGTCATATATTGACCGAAACAAA G
 +
| GATGGTTTGGAAGTTAGAAGAAGTT ACAGTGTTAGTGCCCGTAGAAAATC GTTGGTTCGTTTTGTTGCTATTGAT ATCATTACTTTTGGAAAACAAGCTC AGAGGTGGATATGCCGTGCTTTTAG AGGAGCCGGGGTCGGAAACGACGGA ATGCAAATCTGTCATATTATTTGAC TTCGAAGCAATCG
 +
|-
 +
| || colspan="6" | SGD re-sequenced this region in S288C and found that 37 nucleotide insertions and 4 nucleotide changes were necessary to correct the reference sequence. As a consequence of these changes, SEF1/YBL066C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 1,057 to 1,148 amino acids.
 +
<pre>New:        1 TGTTTCCAGGAGTCTTCACGTTGTTTTCATTATCGATGGTTTGGAAGTTAGAAGAAGTTA 60
 +
              ||||||||||||||||||||||||||||||||||| ||||| |||  ||| ||||
 +
Current: 96777 TGTTTCCAGGAGTCTTCACGTTGTTTTCATTATCG-TGGTT-GGA---TAG-AGAA---- 96826
 +
 
 +
New:        61 CAGTGTTAGTGCCCGTAGAAAATCGTTGGTTCGTTTTGTTGCTATTGATATCATTACTTT 120
 +
              |||||||||| |||||||||  |||| || |||||  ||| ||| ||||||||  |||||
 +
Current: 96827 CAGTGTTAGT-CCCGTAGAA--TCGT-GG-TCGTT--GTT-CTA-TGATATCA--ACTTT 96875
 +
 
 +
New:      121 TGGAAAACAAGCTCAGAGGTGGATATGCCGTGCTTTTAGAGGAGCCGGGGTCGGAAACGA 180
 +
                ||||  ||| ||||||||||||||| |||| ||||||||||| |||||||||||  ||
 +
Current: 96876 -GGAA--CAA-CTCAGAGGTGGATATCCCGT-CTTTTAGAGGA-CCGGGGTCGGA--CG- 96926
 +
 
 +
New:      181 CGGAATGCAAATCTGTCATATTATTTGACTTCGAAGCAATCGGTGTACGTGAATGGGACA 240
 +
              |||||| |||  ||||||||| | |||||  |||| |||  |||||||||||||||||||
 +
Current: 96927 CGGAATCCAA--CTGTCATAT-A-TTGAC--CGAAACAAA-GGTGTACGTGAATGGGACA 96979 </pre>
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 37551
+
| 2004-07-13
| 37551
+
| [https://www.yeastgenome.org/locus/YBL067C YBL067C]
 +
| 93899
 +
| 93899
 
| Insertion
 
| Insertion
|  
+
|
 
| A
 
| A
 +
|-
 +
| || colspan="6" | The work of Kellis et al. 2003 predicted the insertion of a single nucleotide; this sequence error was confirmed in S288C by SGD. As a consequence of this sequence change, UBP13/YBL067C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 688 to 747 amino acids.
 +
<pre>New: 93883 TCGCTTTATAAAACAAAACATATGCTGTTGCCATATTTGGAGATTCACCTGTGAATTCTA 93942
 +
          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
 +
Old: 93883 TCGCTTTATAAAACAAA-CATATGCTGTTGCCATATTTGGAGATTCACCTGTGAATTCTA 93941 </pre>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
 +
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 37547
+
| 2004-07-12
| 37547
+
| [https://www.yeastgenome.org/locus/YBR062C YBR062C]
| Insertion
+
| 366383
 +
| 366383
 +
| Deletion
 +
| T
 
|  
 
|  
| A
+
|-
 +
| || colspan="6" | The work of Cliften et al. 2003 predicted that there is a sequencing error in YBR062C: an single nucleotide should be deleted 100 nt upstream of the currently annotated start site. Assuming this sequence change, Cliften et al. further propose a new intron and 5' exon, and a framechange for this ORF. When spliced, this ORF would now encode a predicted protein of 180 amino acids. This sequence error was confirmed in S288C by SGD and the coordinates have been changed accordingly (start was moved upstream 195 nt and an intron was added at relative coordinates 17-98).
 +
<pre>    New: AAAGTTTTGAAATAGACCTTGCAGTTGGGATCT-GACCTGTCTTCTCTGCTCCTCCTGTG
 +
          ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
 +
    Old: AAAGTTTTGAAATAGACCTTGCAGTTGGGATCTTGACCTGTCTTCTCTGCTCCTCCTGTG </pre>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
 
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 37504
+
| 2004-07-09
| 37504
+
| [https://www.yeastgenome.org/locus/YBR108W YBR108W]
| Substitution
+
| 457298
 +
| 457298
 +
| Insertion
 +
|
 
| G
 
| G
| A
+
|-
 +
| || colspan="6" | The work of Kellis et al. 2003 predicted the insertion of a single G after the G at chromosomal coordinate 457298. This sequence error was confirmed in strain S288C by SGD. As a consequence of this sequence change which caused a frameshift, YBR108W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 848 to 947 amino acids.
 +
<pre>New: CGGTTCGAAAAAAGTGAAGGACTCTAGCCCTGTTCCCTCAGATCTAGATGAAAAATATGT
 +
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
 +
Old: CGGTTCGAAAAAAGTGAAG-ACTCTAGCCCTGTTCCCTCAGATCTAGATGAAAAATATGT</pre>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 37463
+
| 2004-01-29
| 37463
+
| [https://www.yeastgenome.org/locus/YBL097W YBL097W]
| Substitution
+
| 40900
| T
+
| 40901
| C
+
| Deletion
|- style="height:30px; width:30px; text-align:center;"
+
| GA
| 37374
+
|  
| 37374
 
| Substitution
 
| A
 
| G
 
 
|-
 
|-
| || colspan="6" | Several sequence changes were made in the systematic sequence within ORF YCL051W, resulting in a number of amino acid changes in the predicted protein sequence. In addition, the stop site was moved upstream 9 nucleotides, shortening the coding sequence from 1761 nt to 1752 nt. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | Kellis et al. 2003 predicted and confirmed the deletion of two nucleotides (GA) at chromosomal coordinates 40900-40901. As a consequence of this deletion, YBL097W was extended at the 5' end, altering the N-terminus and increasing the predicted protein from 728 to 754 amino acids.
<pre>Old:  37366 TTGTCAACACGCAGAGAAAAGCCTCAAATGAAACTGGTGACTTAGTCTTTAGTTTATCCC 37425
+
<pre>New  61    TTTACCAATAGA--TCCACCATGATGGCAAATTTTGAAGAATGGATCAAAATGGCTACAG  118
            |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
+
            |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
New:  37387 TTGTCAACGCGCAGAGAAAAGCCTCAAATGAAACTGGTGACTTAGTCTTTAGTTTATCCC 37446
+
Old 40888  TTTACCAATAGAGATCCACCATGATGGCAAATTTTGAAGAATGGATCAAAATGGCTACAG  40947</pre>
Old:  37426 AGGATGATGACGCACTGAAAACGTTCCATGCGAGCAATAGCGCAGCAACAAGCAATGAAA 37485
+
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
            ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
+
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
New:   37447 AGGATGATGACGCACTGAAAACGTTCCATGCGAGCAACAGCGCAGCAACAAGCAATGAAA 37506
 
Old:   37486 GCTGGTGTATTAGCGATGGTGCGTTAGGAAAGCAGGCGCAGGACAGTGAAGTTAGGAGGA 37545
 
            |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
 
New:   37507 GCTGGTGTATTAGCGATGATGCGTTAGGAAAGCAGGCGCAGGACAGTGAAGTTAGGAGGA 37566
 
Old:  37546 AA-GAAA-TC-AAATTAGGACTCTTTAGACATATTTT--CAAGGAAGTAATACAACAATAT 37601
 
            || |||| || ||||||||||||||||||||||||||  ||||||||||||||||||||||
 
New:   37567 AAAGAAAATCCAAATTAGGACTCTTTAGACATATTTTTTCAAGGAAGTAATACAACAATAT 37627</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="3"| 2000-09-13
+
| 2004-01-29
| rowspan="3"| [https://www.yeastgenome.org/locus/YCL050C YCL050C], [https://www.yeastgenome.org/locus/YCL051W YCL051W]
+
| [https://www.yeastgenome.org/locus/YBL013W YBL013W]
| 37772
+
| 203180
| 37773
+
| 203180
| Deletion
+
| Insertion
| TA
+
|
|
 
|- style="height:30px; width:30px; text-align:center;"
 
| 37705
 
| 37705
 
| Substitution
 
| T
 
 
| C
 
| C
 +
|-
 +
| || colspan="6" | A single C nucleotide insertion was confirmed by sequencing genomic DNA from FY23 (S288C) and a D273-10B related strain; GenBank accession number for FY23 is AY490279. The stop codon of ORF YBL013W has been moved downstream, so that the ORF is now 1206 nucleotides long as opposed to the previously annotated 1182 nt.
 +
<pre>New  1141    GGCCAGTTCATGGCGCGCCTGCGGAAAAGATGCGGCGCCCTGAGTGAAAAGTTAGTTTTC  1200
 +
            ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
 +
Old  203163  GGCCAGTTCATGGCGCG-CTGCGGAAAAGATGCGGCGCCCTGAGTGAAAAGTTAGTTTTC  203221</pre>
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 37638
+
| 2004-01-28
| 37638
+
| [https://www.yeastgenome.org/locus/YBL006C YBL006C], [https://www.yeastgenome.org/locus/YBL006W-A YBL006W-A]
| Substitution
+
| 216785
 +
| 216785
 +
| Deletion
 
| G
 
| G
| A
+
|  
 
|-
 
|-
| || colspan="6" | Three sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL051W and YCL050C. The G at 37638 was changed to A, the T at 37705 was changed to C, and the TA dinucleotide at 37772-3 was deleted. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | Kellis et al. 2003 predicted and confirmed the deletion of a single nucleotide at 216785. As a consequence of this sequence change, YBL006C was extended at the 3' end, altering the C-terminus and increasing the predicted protein from 145 to 180 amino acids. In addition, YBL006W-A was extended at the 3' end, altering the C-terminus and increasing size of the predicted protein from 39 to 49 amino acids.
<pre>Old:  37602 TAATAATAAGTAATAAAAAGGTGAATCGTAACCTTAGCGGCATTGATTGCATGTAGT 37658
+
<pre>New 301 TCAAGTGTCGA-CTTTTCGCACCATTTCCACCGCACATTAGAATGCAAAGCTGCTCTAGA  359
            |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
+
        ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:  37628 TAATAATAAGTAATAAAAAGGTGAATCGTAACCTTAACGGCATTGATTGCATGTAGT 37684
+
Old    TCAAGTGTCGACCTTTTCGCACCATTTCCACCGCACATTAGAATGCAAAGCTGCTCTAGA</pre>
Old:  37659 TTTAATAATAAAGTGTAGAATAATAAATATAAAATTTCAAAGTCATTAGAAATAAAAA 37716
+
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
            |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
+
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
New:   37685 TTTAATAATAAAGTGTAGAATAATAAATATAAAATTTCAAAGTCATCAGAAATAAAAA 37742
 
Old:   37770 TATACATACATGTATACGTGTATACTTGTACTTGTGAAGGACTCAATAGTTGTATTCGTT 37829
 
            ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:   37796 TA--CATACATGTATACGTGTATACTTGTACTTGTGAAGGACTCAATAGTTGTATTCGTT 37853</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="6"| 2000-09-13
+
| rowspan="5"| 2004-01-26
| rowspan="6"| [https://www.yeastgenome.org/locus/YCL050C YCL050C]
+
| rowspan="5"| [https://www.yeastgenome.org/locus/YBL103C-A YBL103C-A], [https://www.yeastgenome.org/locus/YBL104C YBL104C]
| 38790
+
| 21279
| 38790
+
| 21279
| Substitution
+
| Insertion
| G
+
|
 
| T
 
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 38640
+
| 18364
| 38640
+
| 18364
| Substitution
+
| Insertion
 +
|
 
| G
 
| G
| A
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 38479
+
| 21288
| 38479
+
| 21288
| Substitution
+
| Insertion
 +
|
 
| C
 
| C
| T
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 38294
+
| 21345
| 38294
+
| 21345
| Substitution
+
| Insertion
 +
|
 
| A
 
| A
| G
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 38154
+
| 21347
| 38154
+
| 21347
| Substitution
+
| Insertion
| G
+
|
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
| 37998
 
| 37998
 
| Substitution
 
 
| A
 
| A
| G
 
 
|-
 
|-
| || colspan="6" | Six separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL050C. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | Brachat et al. 2003 and Kellis et al. 2003 predicted and confirmed DIFFERENT sequence changes for YBL104C. Brachat et al. demonstrated the insertion of a single G nt, which extended the 3' end by 141 nt and altered the C-terminus, resulting in overlapping ORF YBL103C-A becoming part of YBL104C (Cliften et al. also predicted this change).
<pre>Old:   37950 ACCTGTGGAGTTGAAACCTATCTTCATTTCATCAGAAAAGGCCTTCGAACGTGGAACGAC 38009
+
<pre>     New:       CTTCTGTCTGCATTGGATCGCGTGATTGCGTCCCATTTATTACAAAAGGTAAGTTTGACG
            |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
+
                ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
New:   37974 ACCTGTGGAGTTGAAACCTATCTTCATTTCATCAGAAAAGGCCTTCGAGCGTGGAACGAC 38033
+
Previous: 18350 CTTCTGTCTGCATTG-ATCGCGTGATTGCGTCCCATTTATTACAAAAGGTAAGTTTGACG 18408</pre>
Old:   38130 TAGGTCTTCATCAACAGTTTCTTCGGACTCCGGCATTGGCAAGACAAAATGAGCGAACGA 38189
+
Kellis et al. demonstrated the insertion of four separate nucleotides (a single T, a single C, and two separate As), which extended at the 5' end by 198 nt and altered the N-terminus. The inserted C (G on the opposite, coding strand) is the third nucleotide of the new ATG start codon.
            |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
+
<pre>    New:       ATTATCATATGACCAATGGGTCACTTTTTTGATGAGACCCATGTTTATTCTTCTATACGT
New:   38154 TAGGTCTTCATCAACAGTTTCTTCAGACTCCGGCATTGGCAAGACAAAATGAGCGAACGA 38213
+
                ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||
Old:   38250 ACATAGTCTATCTTGGAAAGTGACGAACTTTTCAGGCATTTGCAAAATTTGCAAATGTTT 38309
+
Previous: 21251 ATTATCATATGACCAATGGGTCACTTTTT-GATGAGACC-ATGTTTATTCTTCTATACGT 21308
            |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
+
    New:       TCGTGATACTGCACTTACGACTACCAGTAACATCAGAATAACCATAGAGC
New:   38274 ACATAGTCTATCTTGGAAAGTGACGAACTTTTCAGGCATTTGCAGAATTTGCAAATGTTT 38333
+
                ||||||||||||||||||||||||||||||||||||| || |||||||||
Old:   38430 CAAGGCATCAGTTTGATGTTGGTATTCGTTAGTTACCAATAAAGTGTGTCCAGGGATTAC 38489
+
Previous: 21309 TCGTGATACTGCACTTACGACTACCAGTAACATCAGA-TA-CCATAGAGC 21356</pre>
            ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
+
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
New:   38454 CAAGGCATCAGTTTGATGTTGGTATTCGTTAGTTACCAATAAAGTGTGTTCAGGGATTAC 38513
+
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
Old:   38610 CTCTGGCTTTTCGATCAGACTTGGCATGTGGCTAATCAAGTATGGCATGCTGGTTTTTGG 38669
+
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
            |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
+
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
New:   38634 CTCTGGCTTTTCGATCAGACTTGGCATGTGACTAATCAAGTATGGCATGCTGGTTTTTGG 38693
+
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
Old:   38790 GTTTACTTTTCTGTTTGTTCTAAAATCTATCTAAACTGGCTTTCAAGATCAATCTATTGT 38849
+
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+
 
New:   38814 TTTTACTTTTCTGTTTGTTCTAAAATCTATCTAAACTGGCTTTCAAGATCAATCTATTGT 38873</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2000-09-13
+
| 2004-01-21
| [https://www.yeastgenome.org/locus/ARS305 ARS305], [https://www.yeastgenome.org/locus/YCL050C YCL050C]
+
| [https://www.yeastgenome.org/locus/YBR041W YBR041W]
| 39099
+
| 320081
| 39099
+
| 320082
| Substitution
+
| Deletion
| T
+
| CC
| A
+
|  
 
|-
 
|-
| || colspan="6" | One sequence substitution was made in the systematic sequence in the intergenic region between features YCL050C and ARS305. The T at 39099 was changed to A. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | Kellis et al. 2003 and Brachat et al. 2003 independently predicted and confirmed the deletion of two C nucleotides from YBR041W. As a consequence of this change, YBR041W was extended at the 3' end, altering the C-terminus and increasing the predicted protein from 623 to 669 amino acids.
<pre>Old:   39090 GTTATGGGATTATCGTGTAAGCTGGGGTGACTTTTGAGCTATTCGCGACGCCCGACGCCG 39149
+
<pre>     New:       TCTTATGCTATGCCCCTATTTGTTAAATTTGTTGATGAAATTAAAATGACAGATAA--TC
            ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
+
                |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   39114 GTTATGGGAATATCGTGTAAGCTGGGGTGACTTTTGAGCTATTCGCGACGCCCGACGCCG 39173</pre>
+
Previous: 320025 TCTTATGCTATGCCCCTATTTGTTAAATTTGTTGATGAAATTAAAATGACAGATAACCTC 320084</pre>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
 +
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
 +
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="6"| 2000-09-13
+
| 2004-01-20
| rowspan="6"| [https://www.yeastgenome.org/locus/YCL049C YCL049C]
+
| [https://www.yeastgenome.org/locus/YBR157C YBR157C]
| 40174
+
| 553996
| 40174
+
| 553996
| Substitution
+
| Insertion
| A
+
|
| T
+
| G
 +
|-
 +
| || colspan="6" | Kellis et al. 2003 predicted and confirmed the insertion of a single G nt after the C at chromosomal coordinate 553996. As a consequence of this sequence change, YBR157C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 106 to 255 amino acids.
 +
<pre>    New:        TATGGAGGAATTTCTCCTCGTTTTCACACCATCCTTGTCTCCAGGGAAAGAGTAGGTCTT
 +
                ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
 +
Previous: 553978 TATGGAGGAATTTCTCCTC-TTTTCACACCATCCTTGTCTCCAGGGAAAGAGTAGGTCTT 554036</pre>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 40121
+
| rowspan="2"| 2004-01-09
| 40121
+
| rowspan="2"| [https://www.yeastgenome.org/locus/YBR269C YBR269C]
| Substitution
+
| 742165
| T
+
| 742165
| C
+
| Insertion
|- style="height:30px; width:30px; text-align:center;"
+
|
| 40086
 
| 40086
 
| Substitution
 
| A
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 40066
 
| 40066
 
| Substitution
 
| A
 
 
| G
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 39985
+
| 742175
| 39985
+
| 742175
| Substitution
+
| Insertion
| A
+
|
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
| 39944
 
| 39944
 
| Substitution
 
 
| G
 
| G
| A
 
 
|-
 
|-
| || colspan="6" | Six separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL049C, resulting in 4 amino acid substitutions in the predicted protein sequence. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | Kellis et al. 2003 predicted and confirmed the insertion of G after the G at chromosomal coordinate 742165, and the insertion of another G after the G at 742175. As a consequence of these sequence changes, YBR269C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 130 to 138 amino acids. This sequence change was incorporated at MIPS prior to SGD, and was verified in strain S288C.
<pre>Old:   39930 GAACCTCATTTTCCGACATTTTGGTCATGTAAGAGGCGACAGGCTCATCGCAGGTAGGTG 39989
+
<pre>     New:       ACGAATAATCGCCGTGTCTCAACGGGTCCTGCTTGGGACCCCCAACTTCACCAGTCTTGG
            |||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||
+
                ||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||
New:   39953 GAACCTCATTTTCCAACATTTTGGTCATGTAAGAGGCGACAGGCTCATCGCAGGTGGGTG 40012
+
Previous: 742141 ACGAATAATCGCCGTGTCTCAACGG-TCCTGCTTGG-ACCCCCAACTTCACCAGTCTTGG</pre>
Old:   40050 TACAATATTGTCTTTGAACGTTTGCCCAAACCATATATTTTGAATACCAAAGCTGGACCA 40109
+
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
            |||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||
+
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
New:   40073 TACAATATTGTCTTTGGACGTTTGCCCAAACCATATCTTTTGAATACCAAAGCTGGACCA 40132
 
Old:  40110 CATTGTATGGCTTAATCATTGGTGCTACCATAATACTGGATTGGGAAACAGTCTGGTTAA 40169
 
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
 
New:   40133 CATTGTATGGCCTAATCATTGGTGCTACCATAATACTGGATTGGGAAACAGTCTGGTTAA 40192
 
Old:  40170 TTTTATTCAACCAATTTTTCTTATCTAGCAATGATTTAATAAACCTGAAATCTAAATTGT 40229
 
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:   40193 TTTTTTTCAACCAATTTTTCTTATCTAGCAATGATTTAATAAACCTGAAATCTAAATTGT 40252</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="4"| 2000-09-13
+
| rowspan="2"| 2003-09-29
| rowspan="4"| [https://www.yeastgenome.org/locus/YCL042W YCL042W]
+
| rowspan="2"| [https://www.yeastgenome.org/locus/YBR074W YBR074W], [https://www.yeastgenome.org/locus/YBR075W YBR075W]
| 50702
+
| 387625
| 50702
+
| 387625
| Substitution
+
| Deletion
 
| G
 
| G
 +
|
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 387430
 +
| 387430
 +
| Deletion
 
| C
 
| C
|- style="height:30px; width:30px; text-align:center;"
 
| 50700
 
| 50700
 
| Substitution
 
| G
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 50657
 
| 50657
 
| Insertion
 
 
|  
 
|  
| GG
+
|-
 +
| || colspan="6" | Due to deletion of a C after the C at position 387430 and a deletion of G after the G at position 387625, YBR074W and YBR075W were merged. After merging YBR074W (386243 - 387484 (1-1242)) and YBR075W (387793 - 389175 (1-1383)), the coordinates of the merged ORF, YBR074W, are 386243 - 389173 (1 - 2931). YBR075W is now an alias of YBR074W. These sequence changes were verified in S288c strain by SGD.
 +
<pre>Query:  1141 TCTCGTGATAGAATGACTTGGAAATCTTATTCATGGCTATCGTGGAC-ACGCTTTCCTCT 1199
 +
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
 +
Sbjct: 387383 TCTCGTGATAGAATGACTTGGAAATCTTATTCATGGCTATCGTGGACCACGCTTTCCTCT 387442
 +
Query:  1380 AAG-CCTATCAATTATCGAATTGTTCATTATTTTATGGACCATTTTACTTTTTACGTCGA 1438
 +
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 +
Sbjct: 387623 AAGGCCTATCAATTATCGAATTGTTCATTATTTTATGGACCATTTTACTTTTTACGTCGA 387682</pre>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
 +
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
 +
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 50635
+
| 2003-01-03
| 50635
+
| [https://www.yeastgenome.org/locus/YBR098W YBR098W], [https://www.yeastgenome.org/locus/YBR100W YBR100W]
| Insertion
+
| 442868
 +
| 442868
 +
| Deletion
 +
| C
 
|  
 
|  
| C
 
 
|-
 
|-
| || colspan="6" | One single nucleotide insertion, one dinucleotide insertion, and two single nucleotide substitutions were made in the systematic sequence within ORF YCL042W, resulting in several amino acid changes in the predicted protein sequence, and increasing the size of the coding sequence from 357 nucleotides to 360 nt. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | Due to a change to the systematic sequence of chromosome II (C deletion at 442868), YBR098W and YBR100W have been merged to one single ORF of 691 aa. MMS4 is the standard name for the new, elongated ORF after merging; YBR100W and SLX2 are its aliases. The new coordinates of MMS4/YBR098W are 441473-443548, for a coding sequence of 2076 nt.  
<pre>Old:   50610 GTGGTGTGCCGACGGACGGTCAACCC-TTTCAGGGGGCCCCCTATCTTG 50657
+
We thank Jim Brown (james.brown@stanford.edu), and Kirk Ehmsen (ktehmsen@ucdavis.edu) for reporting this sequence error on Chr II, which was verified in the FY1679 (S288c derivative) strain background by SGD.
            |||||||||||||||||||||||||| ||||||||||||||||||||||
+
<pre>Old: 442861 AGAAAACCGTTTTGATTCTATATTATGATGCGCAAGAATTTTTTGAACAATACACTTCAC 442920
New:  50633 GTGGTGTGCCGACGGACGGTCAACCCCTTTCAGGGGGCCCCCTATCTTG 50681
+
            ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Old:  50658 --CGTGGTGTCACACCACGCTCAAACGGTGGGCACTAATGAAAAGGGGCCCATATAAATA 50715
+
New: 442861 AGAAAAC-GTTTTGATTCTATATTATGATGCGCAAGAATTTTTTGAACAATACACTTCAC 442919</pre>
              |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||
+
'''Xiao W, et al.''' (1998) Mms4, a putative transcriptional (co)activator, protects Saccharomyces cerevisiae cells from endogenous and environmental DNA damage. Mol Gen Genet 257(6):614-23 <br>
New:   50682 GGCGTGGTGTCACACCACGCTCAAACGGTGGGCACTAATGAAAACGCGCCCATATAAATA 50741</pre>
+
[https://www.yeastgenome.org/reference/S000044724 SGD paper] | [PubMed https://www.ncbi.nlm.nih.gov/pubmed/9604884] | [https://link.springer.com/article/10.1007%2Fs004380050689 Full-Text] <br>
 +
'''Kaliraman V, et al.''' (2001) Functional overlap between Sgs1-Top3 and the Mms4-Mus81 endonuclease. Genes Dev 15(20):2730-40 <br>
 +
[https://www.yeastgenome.org/reference/S000068964 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11641278 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC312806/ Full-Text] <br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
 +
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
 +
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="3"| 2000-09-13
+
| 2003-01-02
| rowspan="3"| [https://www.yeastgenome.org/locus/YCL037C YCL037C], [https://www.yeastgenome.org/locus/YCL038C YCL038C]
+
| [https://www.yeastgenome.org/locus/YBR086C YBR086C]
| 57211
+
| 422272
| 57211
+
| 422273
| Insertion
+
| Substitution
|  
+
| TA
| A
+
| AT
 +
|-
 +
| || colspan="6" | We received a direct notification from MIPS about the following sequence changes; we did not have this change in SGD, so the sequence was edited: The T at 422272 was changed to an A, and the A at 422273 was changed to a T. These differences changed amino acid residue 243 of IST2/YBR086C from Tyr (TAC) -> Ile (ATC). The coordinates of YBR086C are not changed due to this sequence update. References: (1) Sequence verification in FY1679 (S288c derivative strain) background by SGD, (2) Personal communication from Anna Kurlandzka (ania218@poczta.ibb.waw.pl).
 +
<pre>Old: 422221 GTAGGCAAAAAAGACAAGATGGAAATCATTGGGCCGTTATAAATTTGCTTGTAGAAAATT 422280
 +
            |||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||
 +
New: 422221 GTAGGCAAAAAAGACAAGATGGAAATCATTGGGCCGTTATAAATTTGCTTGATGAAAATT 422280</pre>
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 57043
+
| 2001-05-29
| 57043
+
| [https://www.yeastgenome.org/locus/YBL069W YBL069W]
 +
| 91711
 +
| 91711
 
| Deletion
 
| Deletion
| A
+
| C
 
|  
 
|  
 +
|-
 +
| || colspan="6" | A change was made to the systematic sequence of Chromosome II within the ORF AST1/YBL069W. The C at chromosomal coordinate 91711 was deleted, shifting the reading frame and moving the stop from 91722 to 92025:
 +
<pre>Old: 91681 TTGATTCACGGCGGTGGTGCGTACGTAACCCACTGTAGGTGATTACGTTGCCAATTATAA 91740
 +
          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
 +
New: 91681 TTGATTCACGGCGGTGGTGCGTACGTAACC-ACTGTAGGTGATTACGTTGCCAATTATAA 91739</pre>
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 56612
+
| 2001-05-29
| 56612
+
| [https://www.yeastgenome.org/locus/YBL004W YBL004W]
| Insertion
+
| 234918
|  
+
| 234918
 +
| Substitution
 +
| C
 
| A
 
| A
 
|-
 
|-
| || colspan="6" | Three sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL038C and YCL037C. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | A change was made to the systematic sequence of Chromosome II within the ORF UTP20/YBL004W. The C at chromosomal coordinate 234918 was changed to an A:
<pre>Old:   56596 ACACTACGCATCTTTCA-TAGCTGAGGTATTTTCGTTTAGGAAAATACCGTTTTAAGGAA 56654
+
<pre>Old: 234901 CAGACCGTATTAGAAAGCAGAAAGGAAAGGAGATCTAAAAGGGCAATTCTGGCTGTTAAC 234960
            ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
+
            ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   56622 ACACTACGCATCTTTCAATAGCTGAGGTATTTTCGTTTAGGAAAATACCGTTTTAAGGAA 56681
+
New: 234901 CAGACCGTATTAGAAAGAAGAAAGGAAAGGAGATCTAAAAGGGCAATTCTGGCTGTTAAC 234960</pre>
Old:  57015 TATTTTTATATCTTAAAAAAAAAAAAAAAACAAAAAAAAAAAAACATAAATATTTGTATC 57074
 
            ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
 
New:  57042 TATTTTTATATCTTAAAAAAAAAAAAAAA-CAAAAAAAAAAAAACATAAATATTTGTATC 57100
 
Old:  57195 CAAAAAAAAAAAAAAAA-CAAAAAAAAAACAGCTTTGCTGGAGGATGATTAACTTTTAAT 57253
 
            ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
 
New:  57221 CAAAAAAAAAAAAAAAAACAAAAAAAAAACAGCTTTGCTGGAGGATGATTAACTTTTAAT 57280</pre>
 
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2000-09-13
+
| rowspan="2"| 1999-04-26
| [https://www.yeastgenome.org/locus/YCL034W YCL034W]
+
| rowspan="2"| [https://www.yeastgenome.org/locus/YBR266C YBR266C], [https://www.yeastgenome.org/locus/YBR267W YBR267W]
| 61789
+
| 739912
| 61789
+
| 739912
| Insertion
+
| Deletion
 +
| A
 
|  
 
|  
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 739866
 +
| 739866
 +
| Deletion
 
| G
 
| G
 +
|
 
|-
 
|-
| || colspan="6" | A single nucleotide insertion was made in the systematic sequence in the region encompassing ORF YCL034W, extending the predicted protein sequence N-terminally by 89 amino acids. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | Two changes were made to the systematic sequence of Chromosome II within the ORF REI1/YBR267W. The G at chromosomal coordinate 739866 was deleted, and the A at 739912 was deleted; as a result, the start of YBR267W was moved 294 nt upstream.
<pre>Old:   61754 CACAACGATTATAACTATACCGTGAACCAAGAAGAA-CTGCGCGAGCACTTAGAAAGAAA 61812
+
Note that the deletion at 739912 also affects the overlapping ORF SLM6/YBR266C; as a result, the stop of YBR266C was moved 111 nt upstream:
            |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
+
<pre>Old: 739860 GAGCAGGCGGGCCCACATGAAGTCCGATTGGCATCGCTACAATTTGAAAAGAACGTGTTG 739919
New:   61781 CACAACGATTATAACTATACCGTGAACCAAGAAGAAGCTGCGCGAGCACTTAGAAAGAAA 61840</pre>
+
            |||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||
 
+
New: 739860 GAGCAG-CGGGCCCACATGAAGTCCGATTGGCATCGCTACAATTTGAAAAGA-CGTGTTG 739917</pre>
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 2000-09-13
+
| 1999-04-26
| [https://www.yeastgenome.org/locus/YCL030C YCL030C]
+
| [https://www.yeastgenome.org/locus/YBR201W YBR201W]
| 67181
+
| 623651
| 67181
+
| 623651
| Substitution
+
| Deletion
| C
+
| A
| G
+
|  
 
|-
 
|-
| || colspan="6" | One sequence change was made in the systematic sequence in the region encompassing ORF YCL030C, resulting in one amino acid substitution. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | A change was made to the systematic sequence of Chromosome II in the region upstream of the ORF DER1/YBR201W. The A at chromosomal coordinate 623651 was deleted. As a result, the start of YBR201W was moved upstream 210 nucleotides, increasing the size of the predicted protein from 141 to 211 amino acids.
<pre>Old:   67153 TAATTTCAGAAGTCTTTTGGATTGGTCTCCTCAAAGCCTTCTGCACACCAACTTTGTCGG 67212
+
<pre>Old: 623640 GATCCAGGGAAAGGTAGTGTACAGTTATGATTTAGTATTCAAAAAGGGACAATATGGAAG 623699
            |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
+
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   67181 TAATTTCAGAAGTCTTTTGGATTGGTCTGCTCAAAGCCTTCTGCACACCAACTTTGTCGG 67240</pre>
+
New: 623640 GATCCAGGGAA-GGTAGTGTACAGTTATGATTTAGTATTCAAAAAGGGACAATATGGAAG 623698</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="3"| 2000-09-13
+
| 1999-04-26
| rowspan="3"| [https://www.yeastgenome.org/locus/YCL029C YCL029C]
+
| [https://www.yeastgenome.org/locus/YBR294W YBR294W]
| 69717
+
| 791709
| 69717
+
| 791709
 
| Substitution
 
| Substitution
 
| T
 
| T
 
| C
 
| C
 +
|-
 +
| || colspan="6" | A change was made to the systematic sequence of Chromosome II within the ORF SUL1/YBR294W. The T at chromosomal coordinate 791709 was changed to a C:
 +
<pre>Old: 791700 TATGTGCTGTAACTGGGACAAATTTACCGTTTTTTCATATCGATATACCCGATTTTTCTA 791759
 +
            ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
 +
New: 791700 TATGTGCTGCAACTGGGACAAATTTACCGTTTTTTCATATCGATATACCCGATTTTTCTA 791759</pre>
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 69690
+
| rowspan="3"| 1999-04-26
| 69690
+
| rowspan="3"| [https://www.yeastgenome.org/locus/YBR069C YBR069C], [https://www.yeastgenome.org/locus/YBR070C YBR070C]
| Substitution
+
| 378824
| G
+
| 378824
| A
+
| Insertion
 +
|
 +
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 69624
+
| 378810
| 69624
+
| 378810
| Substitution
+
| Insertion
| C
+
|
 
| T
 
| T
|-
 
| || colspan="6" | Three sequence changes were made in the systematic sequence in the region encompassing ORF YCL029C. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  69613 AGCGGTTCCATCGTCGTTCTTCTCGAGGTTTGCGATATCGATGCCTTCTCGATCAATGAT 69672
 
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
 
New:  69641 AGCGGTTCCATTGTCGTTCTTCTCGAGGTTTGCGATATCGATGCCTTCTCGATCAATGAT 69700
 
Old:  69673 GCGACTTTTTGCAACTGGATAAATAGTCCACTTTGAGGATACTCTGTTTGAAAATACTTC 69732
 
            ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||
 
New:  69701 GCGACTTTTTGCAACTGAATAAATAGTCCACTTTGAGGATACTCCGTTTGAAAATACTTC 69760</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="10"| 2000-09-13
+
| 378815
| rowspan="10"| [https://www.yeastgenome.org/locus/YCL028W YCL028W]
+
| 378815
| 71366
 
| 71366
 
 
| Deletion
 
| Deletion
 
| C
 
| C
 
|  
 
|  
 +
|-
 +
| || colspan="6" | Three changes were made to the systematic sequence of Chromosome II in the intergenic region between the ORFs TAT1/YBR069C and ALG14/YBR070C. A single T was inserted after the T at chromosomal coordinate 378810, the C at 378815 was deleted, and a C was inserted after the G at 378824:
 +
<pre>Old: 378781 GCCGGCCCTGACTGACCTTTTTTGTATTTT-GGCCCGTCCCGGCG-GGCGAAGAGTGAGAC 378839
 +
            |||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||
 +
New: 378781 GCCGGCCCTGACTGACCTTTTTTGTATTTTTGGCC-GTCCCGGCGCGGCGAAGAGTGAGAC 378840</pre>
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 71282
+
| 1999-04-23
| 71282
+
| [https://www.yeastgenome.org/locus/YBL067C YBL067C]
 +
| 94040
 +
| 94040
 
| Substitution
 
| Substitution
| T
+
| G
 
| C
 
| C
 +
|-
 +
| || colspan="6" | A change was made to the systematic sequence of Chromosome II within the ORF UBP13/YBL067C. The G at chromosomal coordinate 94040 was changed to a C:
 +
<pre>Old: 94021 CATAATGGCCGTGTTGTGGGCCACCGCCCATATGAACGACAATCCCAGCCAATTCATACT 94080
 +
          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
 +
New: 94021 CATAATGGCCGTGTTGTGGCCCACCGCCCATATGAACGACAATCCCAGCCAATTCATACT 94080</pre>
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 71219
+
| rowspan="4"| 1999-04-23
| 71219
+
| rowspan="4"| [https://www.yeastgenome.org/locus/YBR006W YBR006W]
 +
| 247367
 +
| 247367
 
| Substitution
 
| Substitution
 +
| C
 
| T
 
| T
| C
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 71213
+
| 248539
| 71213
+
| 248539
 
| Substitution
 
| Substitution
 
| A
 
| A
| G
+
| T
|- style="height:30px; width:30px; text-align:center;"
 
| 71201
 
| 71201
 
| Substitution
 
| C
 
| G
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 71195
+
| 248278
| 71195
+
| 248278
 
| Substitution
 
| Substitution
 
| A
 
| A
| G
+
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 71051
+
| 247262
| 71051
+
| 247262
 
| Substitution
 
| Substitution
 
| C
 
| C
| T
+
| G
 +
|-
 +
| || colspan="6" | Three single nucleotide (nt) substitutions were made to the systematic sequence of Chromosome II within the ORF UGA2/YBR006W, and one substitution was made in the adjacent intergenic region. The C at chromosomal coordinate 247262 was changed to a G, the C at 247367 was changed to a T, the A at 248278 was changed to a T (destroying the stop codon), and the A at 248539 was changed to a T. As a result, the stop was moved 186 nucleotides downstream, increasing the size of the coding sequence from 1308 nt to 1494 nt.
 +
<pre>Old: 247261 TCGCAACCATCATTACTTTAGAAAATGGTAAAGCTCTAGGGGAAGCTAAAGGAGAAATCA 247320
 +
            | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 +
New: 247261 TGGCAACCATCATTACTTTAGAAAATGGTAAAGCTCTAGGGGAAGCTAAAGGAGAAATCA 247320
 +
Old: 247321 AATACGCGGCTTCGTATTTTGAGTGGTACGCCGAGGAAGCACCCCGCTTATATGGTGCTA 247380
 +
            |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
 +
New: 247321 AATACGCGGCTTCGTATTTTGAGTGGTACGCCGAGGAAGCACCCCGTTTATATGGTGCTA 247380
 +
Old: 248221 CTAATGATACTGAGTTTGGTTTAGCAGCATATGTCTTTTCTAAAAATGTCAACACTTAAT 248280
 +
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
 +
New: 248221 CTAATGATACTGAGTTTGGTTTAGCAGCATATGTCTTTTCTAAAAATGTCAACACTTTAT 248280
 +
Old: 248521 GTATATATCTATTGCATGAATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATT 248580
 +
            |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
 +
New: 248521 GTATATATCTATTGCATGTATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATT 248580</pre>
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 70808
+
| 1999-04-23
| 70808
+
| [https://www.yeastgenome.org/locus/YBL066C YBL066C]
 +
| 97484
 +
| 97485
 
| Substitution
 
| Substitution
| T
+
| TG
| C
+
| GC
 +
|-
 +
| || colspan="6" | A change was made to the systematic sequence of Chromosome II within the ORF SEF1/YBL066C. The two nucleotides TG at positions 575 and 576 (chromosomal coordinates 97484-97485) were changed to GC, altering translation by changing amino acid 192 from Gln (CAA) to Ala (GCA). Note that this ORF is on the Crick strand.
 +
<pre>Old: 97441 AGAACCGTCAGAATCTCCGTTATTTGTCTTGGCTAGCTTTTCTTGCTGCTTTAAGGCATT 97500
 +
          |||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||
 +
New: 97441 AGAACCGTCAGAATCTCCGTTATTTGTCTTGGCTAGCTTTTCTGCCTGCTTTAAGGCATT 97500</pre>
 +
'''Cherry JM, et al.''' (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America <br>
 +
[https://www.yeastgenome.org/reference/S000076263 SGD paper]
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 70757
+
| 1999-04-22
| 70757
+
| [https://www.yeastgenome.org/locus/YBL033C YBL033C]
 +
| 159114
 +
| 159114
 
| Substitution
 
| Substitution
| T
 
 
| C
 
| C
|- style="height:30px; width:30px; text-align:center;"
 
| 70742
 
| 70742
 
| Substitution
 
| A
 
 
| G
 
| G
 
|-
 
|-
| || colspan="6" | Several sequence changes were made in the systematic sequence in the region encompassing ORF YCL028W. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | The C at chromosomal coordinate 159114 within the ORF RIB1/YBL033C was changed to a G, altering translation by changing amino acid 181 from Lys (AAG) to Asn (AAC). Note that this ORF is on the Crick strand:
<pre>Old:   70693 ATCAGCAAGGTCAAAATCAAAGCTCCGGTGGTTCCTCCTTTGGAGCACTAGCTTCTATGG 70752
+
<pre>Old: 159061 CGACCCTCTTGTCTTAGATACACGATAACACCATGGCCGTTTCCACCTTTGATCTTGCTT 159120
            ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
+
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
New:   70721 ATCAGCAAGGTCAAAATCAAAGCTCCGGTGGTTCCTCCTTTGGAGCACTGGCTTCTATGG 70780
+
New: 159061 CGACCCTCTTGTCTTAGATACACGATAACACCATGGCCGTTTCCACCTTTGATGTTGCTT 159120</pre>
Old:   70753 CAAGTTCTTTTATGCATTCCAATAATAATCAGAACTCCAACAATAGTCAACAGGGTTATA 70812
+
'''Cherry JM, et al.''' (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America <br>
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||
+
[https://www.yeastgenome.org/reference/S000076263 SGD paper]
New:   70781 CAAGCTCTTTTATGCATTCCAATAATAATCAGAACTCCAACAATAGTCAACAGGGCTATA 70840
 
Old:  70993 ATCAACAAGGCCAAAACAACCAGCAGCAATACCAGCAACAAGGCCAAAACTATCAGCACC 71052
 
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
 
New:  71021 ATCAACAAGGCCAAAACAACCAGCAGCAATACCAGCAACAAGGCCAAAACTATCAGCATC 71080
 
Old:  71173 AGGCTAATGAGTATGGTAGACCACAACACAATGGTCAACAACAATCTAATGAGTACGGAA 71232
 
            |||||||||||||||||||||| ||||| ||||||||||| ||||| |||||||||||||
 
New:  71201 AGGCTAATGAGTATGGTAGACCGCAACAGAATGGTCAACAGCAATCCAATGAGTACGGAA 71260
 
Old:  71233 GACCGCAATACGGCGGAAACCAGAACTCCAATGGACAGCACGAATCCTTTAATTTTTCTG 71292
 
            ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
 
New:  71261 GACCGCAATACGGCGGAAACCAGAACTCCAATGGACAGCACGAATCCTTCAATTTTTCTG 71320
 
Old:  71353 TCGCCTTCTATCCCTTTGTTTACGTATTTGTTTATATATATAACTTTAT 71401
 
            ||||||||||||| |||||||||||||||||||||||||||||||||||
 
New:  71381 TCGCCTTCTATCC-TTTGTTTACGTATTTGTTTATATATATAACTTTAT 71428</pre>
 
  
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="3"| 2000-09-13
+
| rowspan="6"| 1998-09-13
| rowspan="3"| [https://www.yeastgenome.org/locus/YCL027W YCL027W], [https://www.yeastgenome.org/locus/YCL028W YCL028W]
+
| rowspan="6"| [https://www.yeastgenome.org/locus/YBL101C YBL101C]
| 71729
+
| 25408
| 71729
+
| 25408
 
| Insertion
 
| Insertion
|  
+
|
| T
+
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 71608
+
| 28272
| 71608
+
| 28272
| Substitution
+
| Insertion
| A
+
|
| T
+
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 71408
+
| 28296
| 71408
+
| 28296
 
| Insertion
 
| Insertion
 +
|
 +
| C
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 25394
 +
| 25394
 +
| Deletion
 +
| T
 
|  
 
|  
| T
 
|-
 
| || colspan="6" | Three sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL028W and YCL027W. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  71368 TTGTTTACGTATTTGTTTATATATATAACTTTATTTTTTTT-ATT 71411
 
            ||||||||||||||||||||||||||||||||||||||||| |||
 
New:  71396 TTGTTTACGTATTTGTTTATATATATAACTTTATTTTTTTTTATT 71439
 
Old:  71592 ACAAACATGAAACGTCAGTAATTTGAAACAAATAACGTAATTCTCGGGATTGGTTTTATT 71651
 
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
 
New:  71620 ACAAACATGAAACGTCTGTAATTTGAAACAAATAACGTAATTCTCGGGATTGGTTTTATT 71679
 
Old:  71712 GACATCCTTTATCTTTTT-CCTTTAAGAGCAGGATATAAGCCATCAAGTTTCTGAAAATC 71770
 
            |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
 
New:  71740 GACATCCTTTATCTTTTTTCCTTTAAGAGCAGGATATAAGCCATCAAGTTTCTGAAAATC 71799</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="6"| 2000-09-13
+
| 28306
| rowspan="6"| [https://www.yeastgenome.org/locus/YCL027W YCL027W]
+
| 28306
| 73226
 
| 73226
 
 
| Substitution
 
| Substitution
 
| A
 
| A
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
| 73218
 
| 73218
 
| Substitution
 
 
| G
 
| G
| A
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 73204
+
| 28302
| 73204
+
| 28302
| Substitution
+
| Insertion
| G
+
|
| A
+
| GG
 +
|-
 +
| || colspan="6" | Six changes were made to the systematic sequence of Chromosome II within the ORF ECM21/YBL101C and in the adjacent intergenic region. Within the ORF, the T at chromosomal coordinate 25394 was deleted, and a single C was inserted after the C at 25408:
 +
<pre>Old: 25381 CGGCATCATCGCTTGTATCCGGATGGCC-ACTAACTGACGTAGTTCTTGATAAGTTCAAT 25439
 +
          ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||
 +
New: 25381 CGGCATCATCGCT-GTATCCGGATGGCCCACTAACTGACGTAGTTCTTGATAAGTTCAAT 25439</pre>
 +
Upstream of the ORF, a single G was inserted after the G at 28272, a single C was inserted after the C at 28296, two nucleotides (nt) GG were inserted after the G at 28302, and the A at 28306 was changed to a G:
 +
<pre>Old: 28260 TTTTTCGCCACCG-TCTTGATGTTATAAACGGCATGCC-AATAGG--TAGAGAAAAATCT 28315
 +
          ||||||||||||| |||||||||||||||||||||||| ||||||  ||| |||||||||
 +
New: 28260 TTTTTCGCCACCGGTCTTGATGTTATAAACGGCATGCCCAATAGGGGTAGGGAAAAATCT 28319</pre>
 +
The start site of YBL101C was then moved upstream, extending the size of the coding region from 3234 nt to 3354 nt, and the size of the predicted protein from 728 amino acids (aa) to 754 aa.
 +
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| 73066
+
| 1997-07-27
| 73066
+
| [https://www.yeastgenome.org/locus/YBL091C YBL091C]
 +
| 48615
 +
| 48615
 
| Substitution
 
| Substitution
 
| A
 
| A
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
| 72757
 
| 72757
 
| Substitution
 
| C
 
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
| 72161
 
| 72161
 
| Substitution
 
 
| C
 
| C
| T
 
 
|-
 
|-
| || colspan="6" | Several sequence changes were made in the systematic sequence in the region encompassing ORF YCL027W. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | The A at chromosomal coordinate 48615 (upstream of the Crick strand ORF MAP2/YBL091C at coordinates 48402-47353) was changed to a C, and the start site of YBL091C was then moved 216 nucleotides (nt) upstream to the newly-created start codon, extending the size of the coding sequence from 1050 nt to 1266 nt, the size of the predicted protein from 349 amino acids (aa) to 421 aa. Note that the sequence presented below is from the Watson strand:
<pre>Old:  72131 CGCCGCACTAATTGGTTCTCACGGTTATTTCGGCAGAGTAAGTGTGAGGATCAGAATTCA 72190
+
<pre>New: 48600 TATTTCAGCGTCTGTCATTTTTCAATACGGTAGAGCTTCTACAGTACTTGTTGATGTAAA 48659
            |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
+
          ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
New:   72160 CGCCGCACTAATTGGTTCTCACGGTTATTTTGGCAGAGTAAGTGTGAGGATCAGAATTCA 72219
+
Old: 48600 TATTTCAGCGTCTGTAATTTTTCAATACGGTAGAGCTTCTACAGTACTTGTTGATGTAAA 48659</pre>
Old:  72731 AACACGCCTCTGGATGCAAATGACAGCGTGAATAACTTGGGTAATACCACGCCAGATTCA 72790
 
            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
 
New:  72760 AACACGCCTCTGGATGCAAATGACAGTGTGAATAACTTGGGTAATACCACGCCAGATTCA 72819
 
Old:   73031 CCATTGCCGCTTACTCCAAACTCCAAATATAATGGAGAGGCTAGCGTCCAATTAGGGAAG 73090
 
            ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
 
New:  73060 CCATTGCCGCTTACTCCAAACTCCAAATATAATGGGGAGGCTAGCGTCCAATTAGGGAAG 73119
 
Old:  73151 GGTGAAAAAGTTAAAATTCTGGCCACTCATACCGATGGATGGTGTCTGGTAGAGAAGTGT 73210
 
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
 
New:  73180 GGTGAAAAAGTTAAAATTCTGGCCACTCATACCGATGGATGGTGTCTGGTAGAAAAGTGT 73239
 
|
 
Old:  73211 AATACACGAAAGGGTACTATTCACGTCAGTGTTGACGATAAAAGATACCTCAATGAAGAT 73270
 
            ||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||
 
New:  73240 AATACACAAAAGGGTTCTATTCACGTCAGTGTTGACGATAAAAGATACCTCAATGAAGAT 73299</pre>
 
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
|- style="height:30px; width:30px; text-align:center;"
| rowspan="3"| 2000-09-13
+
| 1997-07-27
| rowspan="3"| [https://www.yeastgenome.org/locus/YCL026C-A YCL026C-A]
+
| [https://www.yeastgenome.org/locus/YBL103C YBL103C]
| 74943
+
| 22603
| 74943
+
| 22603
 
| Insertion
 
| Insertion
|  
+
|
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
| 74813
 
| 74813
 
| Insertion
 
|
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 74935
 
| 74935
 
| Insertion
 
|
 
| T
 
|-
 
| || colspan="6" | Three sequence changes were made in the systematic sequence in the region encompassing ORF YCL026C-A. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  74890 GAGCGGCGCATGTTGGGAAAGCGG-TGCCAAGGCTGGAAAATCTCTT-GCAGTTTT-CAG 74946
 
            |||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |||
 
New:  74919 GAGCGGCGCATGTTGGGAAAGCGGCTGCCAAGGCTGGAAAATCTCTTTGCAGTTTTTCAG 74978</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| rowspan="4"| 2000-09-13
 
| rowspan="4"| [https://www.yeastgenome.org/locus/YCL025C YCL025C], [https://www.yeastgenome.org/locus/YCL026C-A YCL026C-A]
 
| 76114
 
| 76115
 
| Substitution
 
| GG
 
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
| 75986
 
| 75986
 
| Insertion
 
|
 
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
| 75831
 
| 75831
 
| Substitution
 
| T
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 75514
 
| 75514
 
| Substitution
 
| A
 
 
| G
 
| G
 
|-
 
|-
| || colspan="6" | Several sequence changes were made in the systematic sequence in the intergenic region between features YCL026C-A and YCL025C. Note that coordinates listed are chromosomal coordinates.
+
| || colspan="6" | A single G was inserted after the G at chromosomal coordinate 22603 within the ORF RTG3/YBL103C, shifting the frame and extending the 3' end by 510 nucleotides:
<pre>Old:   75487 AATTGAAAAATTATTCGGAAGAGCATTAACAAATATTGATTAATAATCAAGTAACACTCG 75546
+
<pre>New: 22561 TACCTAGGTCATCGTAATTCAATAAAGATGGTGGAACCAACTGGCCGAGTTCTTTTATCT 22620
            ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
+
          ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
New:  75519 AATTGAAAAATTATTCGGAAGAGCATTGACAAATATTGATTAATAATCAAGTAACACTCG 75578
+
Old: 22561 TACCTAGGTCATCGTAATTCAATAAAGATGGTGGAACCAACTG-CCGAGTTCTTTTATCT 22619</pre>
Old:   75787 TTTTTCTCTCACTTCATATTATTTCACTTATATTTTCCTCTCCATTTCCATCACGCAATC 75846
 
            |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
 
New:  75819 TTTTTCTCTCACTTCATATTATTTCACTTATATTTTCCTCTCCACTTCCATCACGCAATC 75878
 
Old:  75967 GAAGTAAATGCTTTTTTTTT-AACACCAGAAGGCAACGACCCTTTTCCAATAAGGTCCGT 76025
 
            |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
 
New:  75999 GAAGTAAATGCTTTTTTTTTTAACACCAGAAGGCAACGACCCTTTTCCAATAAGGTCCGT 76058
 
Old:  76086 GTCTATGAGAATCTAGGTCGATCTTGTCGGCCCTGATGAACAGTTTCCAATCCTTGTGCC 76145
 
            ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||
 
New:  76119 GTCTATGAGAATCTAGGTCGATCTTGTCT-CCCTGATGAACAGTTTCCAATCCTTGTGCC 76177</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| rowspan="5"| 2000-09-13
 
| rowspan="5"| [https://www.yeastgenome.org/locus/YCL025C YCL025C]
 
| 77472
 
| 77472
 
| Substitution
 
| G
 
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
| 77320
 
| 77320
 
| Insertion
 
|
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
| 77297
 
| 77297
 
| Deletion
 
| A
 
|
 
|- style="height:30px; width:30px; text-align:center;"
 
| 76165
 
| 76165
 
| Substitution
 
| T
 
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
| 76940
 
| 76940
 
| Substitution
 
| A
 
| G
 
|-
 
| || colspan="6" | Five sequence changes were made in the systematic sequence in the region encompassing ORF YCL025C. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  76146 AGACCTTGTAGCCGACATATAGTGCAATCAAGATTGGCATAGCCAAGTAGTTTTCGAAAA 76205
 
            ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
 
New:  76178 AGACCTTGTAGCCGACATAAAGTGCAATCAAGATTGGCATAGCCAAGTAGTTTTCGAAAA 76237
 
Old:  76926 TCACTAATGTTGCAACAACACCTTTAAATCTGTCAATGGCATGTTTACCATTGAAAGCGC 76985
 
            |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
 
New:  76958 TCACTAATGTTGCAGCAACACCTTTAAATCTGTCAATGGCATGTTTACCATTGAAAGCGC 77017
 
Old:  77286 CAAACCCAAAAACCATCATCCACAAGGAAACTGGG-TATGCATTGTAGCCACCAGTCAAG 77344
 
            ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||
 
New:  77318 CAAACCCAAAA-CCATCATCCACAAGGAAACTGGGGTATGCATTGTAGCCACCAGTCAAG 77376
 
Old:  77465 CCGACCAGTAACCCAGTACCGATACCCGTACCCAACGCAATCATCAGAACATGTCTAGGC 77524
 
            ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:  77497 CCGACCAATAACCCAGTACCGATACCCGTACCCAACGCAATCATCAGAACATGTCTAGGC 77556</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2000-09-13
 
| [https://www.yeastgenome.org/locus/tQ(UUG)C tQ(UUG)C]
 
| 168331
 
| 168335
 
| Deletion
 
| AGGTG
 
|
 
|-
 
| || colspan="6" | The systematic sequence was updated in the region encompassing feature tQ(UUG)C. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  168303 TGCTACTAGCATTTTATCACATGAGGTGAGGTGTAAGAAGATGACATAAAGATTGAGATA 168362
 
              ||||||||||||||||||||||||||||    |||||||||||||||||||||||||||
 
New:  169609 TGCTACTAGCATTTTATCACATGAGGTG-----TAAGAAGATGACATAAAGATTGAGATA 169663</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| rowspan="8"| 2000-09-13
 
| rowspan="8"| [https://www.yeastgenome.org/locus/YCRWdelta11 YCRWdelta11], [https://www.yeastgenome.org/locus/tQ(UUG)C tQ(UUG)C]
 
| 168881
 
| 168881
 
| Substitution
 
| C
 
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
| 168787
 
| 168787
 
| Substitution
 
| A
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
| 168685
 
| 168685
 
| Substitution
 
| T
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 168682
 
| 168682
 
| Substitution
 
| T
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 168541
 
| 168541
 
| Substitution
 
| C
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
| 168465
 
| 168465
 
| Substitution
 
| C
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
| 168442
 
| 168442
 
| Substitution
 
| T
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
| 168368
 
| 168368
 
| Substitution
 
| C
 
| A
 
|-
 
| || colspan="6" | The systematic sequence was updated in the region encompassing features tQ(UUG)C and YCRWdelta11. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  168363 CAGTCCTCAAACCTAATGGAAGCGAAATGCAGGGATTGATAATGTAATAAGATAATGAAA 168422
 
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:  169664 CAGTCATCAAACCTAATGGAAGCGAAATGCAGGGATTGATAATGTAATAAGATAATGAAA 169723
 
Old:  168423 CATAAGAAACAGAAGGTAGTAGTATTATTATGTAGAAATACCCATTCCATTTTAAGGATT 168482
 
              ||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||
 
New:  169724 CATAAGAAACAGAAGGTAGGAGTATTATTATGTAGAAATACCGATTCCATTTTAAGGATT 169783
 
Old:  168483 CCTATGTCCTCGAGTAGAACGTCTAGTATATACGAAATATTATACCCTTTAAAAAACACT 168542
 
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
 
New:  169784 CCTATGTCCTCGAGTAGAACGTCTAGTATATACGAAATATTATACCCTTTAAAAAACAGT 169843
 
Old:  168663 CTGATCTCCCAATGAAGAATTGTGTCAGGTCATCTCGTCCTCAATTTCTAACCAAAATTG 168722
 
              ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||
 
New:  169964 CTGATCTCCCAATGAAGAACTGCGTCAGGTCATCTCGTCCTCAATTTCTAACCAAAATTG 170023
 
Old:  168783 CACAACACGGTAAACCAACTTGTGTCATATTTAAGAGAAATATTAAAACGCTAAGAAGAT 168842
 
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:  170084 CACAGCACGGTAAACCAACTTGTGTCATATTTAAGAGAAATATTAAAACGCTAAGAAGAT 170143
 
Old:  168843 AGCTCCCATAATAGAAGTACAAGTTATATTTATCGTTGCCCAACTGCAGAAGTTAAATAA 168902
 
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
 
New:  170144 AGCTCCCATAATAGAAGTACAAGTTATATTTATCGTTGTCCAACTGCAGAAGTTAAATAA 170203</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| rowspan="8"| 2000-09-13
 
| rowspan="8"| [https://www.yeastgenome.org/locus/YCRWdelta11 YCRWdelta11], [https://www.yeastgenome.org/locus/tQ(UUG)C tQ(UUG)C]
 
| 169454
 
| 169454
 
| Substitution
 
| G
 
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
| 169337
 
| 169337
 
| Substitution
 
| G
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 169259
 
| 169259
 
| Substitution
 
| T
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 169250
 
| 169250
 
| Substitution
 
| G
 
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
| 169110
 
| 169110
 
| Insertion
 
|
 
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
| 169071
 
| 169071
 
| Substitution
 
| G
 
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
| 168967
 
| 168967
 
| Substitution
 
| C
 
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
| 168933
 
| 168933
 
| Insertion
 
|
 
| A
 
|-
 
| || colspan="6" | The systematic sequence was updated in the region encompassing features tQ(UUG)C and YCRWdelta11. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  168903 AGGTAAATAAATCGAGCTAAGAGAAAAAAAA-GTATAGGCAAAATTCCGACCGGAGCTAG 168961
 
              ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
 
New:  170204 AGGTAAATAAATCGAGCTAAGAGAAAAAAAAAGTATAGGCAAAATTCCGACCGGAGCTAG 170263
 
Old:  168962 CTTTACCTTGCTCCTCCACCTAAGTCACCTGCTCAGGTCACTCAAGTTCACAATCTTCTG 169021
 
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:  170264 CTTTATCTTGCTCCTCCACCTAAGTCACCTGCTCAGGTCACTCAAGTTCACAATCTTCTG 170323
 
Old:  169022 AGAGGATAGATAAAGGAAAAATTGGAACAGATCTTTTCATGGCCTGGCAGTTGTCTGTGG 169081
 
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
 
New:  170324 AGAGGATAGATAAAGGAAAAATTGGAACAGATCTTTTCATGGCCTGGCAATTGTCTGTGG 170383
 
Old:  169082 ATTGGTAAAGCTCTGTCAGTGAAAAAAAA-GTTCTCGCTCCTTCTTGGTCTCTTCTATTT 169140
 
              ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
 
New:  170384 ATTGGTAAAGCTCTGTCAGTGAAAAAAAAAGTTCTCGCTCCTTCTTGGTCTCTTCTATTG 170443
 
Old:  169201 ATAATCTTGAAATTTGAAGTTTCTAAAATGCATCAGACATGGTGTCGTAGTTAGTTGATT 169260
 
              ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
 
New:  170504 ATAATCTTGAAATTTGAAGTTTCTAAAATGCATCAGACATGGTGTCGTAATTAGTTGACT 170563
 
Old:  169321 AAAATACTTACTAAACGTTTTCGAATAAGTTAGCAAGAAGCTTTTAAAAACATAGACTTA 169380
 
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
 
New:  170624 AAAATACTTACTAAACCTTTTCGAATAAGTTAGCAAGAAGCTTTTAAAAACATAGACTTA 170683
 
Old:  169441 TGCATGATGAAAAGCTAAGTAGACCTCTTTAGAAGTGTCTTAGCGGCTATTGTTCATGAT 169500
 
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
 
New:  170744 TGCATGATGAAAAACTAAGTAGACCTCTTTAGAAGTGTCTTAGCGGCTATTGTTCATGAT 170803</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2000-09-13
 
| [https://www.yeastgenome.org/locus/tN(GUU)C tN(GUU)C]
 
| 127750
 
| 127750
 
| Insertion
 
|
 
| C
 
|-
 
| || colspan="6" | The systematic sequence was updated in the region encompassing feature tN(GUU)C. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  127693 CTTTACTTGGAGTTTCGATTTTAAGAATTTTTTATCATTTTTTTTTTTTGACGATTTC-T 127751
 
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
 
New:  128086 CTTTACTTGGAGTTTCGATTTTAAGAATTTTTTATCATTTTTTTTTTTTGACGATTTCCT 128145</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| rowspan="3"| 2000-09-13
 
| rowspan="3"| [https://www.yeastgenome.org/locus/YCR016W YCR016W], [https://www.yeastgenome.org/locus/tG(GCC)C tG(GCC)C]
 
| 143330
 
| 143330
 
| Substitution
 
| T
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 143280
 
| 143281
 
| Substitution
 
| GG
 
| CA
 
|- style="height:30px; width:30px; text-align:center;"
 
| 143021
 
| 143021
 
| Substitution
 
| A
 
| G
 
|-
 
| || colspan="6" | The systematic sequence was updated in the intergenic region between features tG(GCC)C and YCR016W. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  143002 GCAAACGCTTTTGTTATTGAGAACAGGAATACCAACCGTTCTCATGGAAAATAGCAAAGT 143061
 
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
 
New:  143291 GCAAACGCTTTTGTTATTGGGAACAGGAATACCAACCGTTCTCATGGAAAATAGCAAAGT 143350
 
Old:  143242 GAAAAGAGATGAGCTAAATTCAAATATCAAAGTACTGTGGTAAGTGCTTTCTTTATCGAC 143301
 
              ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||
 
New:  143531 GAAAAGAGATGAGCTAAATTCAAATATCAAAGTACTGTCATAAGTGCTTTCTTTATCGAC 143590
 
Old:  143302 AAATTACAAGCAGAAGAAACATTCACTTTACAATTAAATGTCCGAAAATCACGTTCCTGC 143361
 
              |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
 
New:  143591 AAATTACAAGCAGAAGAAACATTCACTTCACAATTAAATGTCCGAAAATCACGTTCCTGC 143650</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2000-09-13
 
| [https://www.yeastgenome.org/locus/YCLCdelta1 YCLCdelta1], [https://www.yeastgenome.org/locus/tE(UUC)C tE(UUC)C]
 
| 82662
 
| 82662
 
| Insertion
 
|
 
| GTTGGAATAGAAATCAACTATCATC TACTAACTAGTATTTACATTACTAG TATATTATCATATACGGTGTTAGAA GATGACGCAAATGATGAGAAATAGT CATCTAAATTAGTGGAAGCTGAAAC GCAAGGATTGATAATGTAATAGGAT CAATGAATATAAACATATAAAACGG AATGAGGAATAATCGTAATATTAGT ATGTAGAAATATAGATTCCATTTTG AGGATTCCTATATCCTCGAGGAGAA CTTCTAGTATATTCTGTATACCTAA TATTATAGCCTTTATCAACAATGGA ATCCCAACAATTATCTCAACATTCA CCCATTTCTCAAGTACT
 
|-
 
| || colspan="6" | A large insertion was made in the systematic sequence in the intergenic region between tRNA-Glu and YCLCdelta1. The following sequence was inserted after the TAAAATATTTCCTCTTTAGTACT ending at 82662:
 
GTTGGAATAGAAATCAACTATCATCTACTAACTAGTATTTACATTACTAG
 
TATATTATCATATACGGTGTTAGAAGATGACGCAAATGATGAGAAATAGT
 
CATCTAAATTAGTGGAAGCTGAAACGCAAGGATTGATAATGTAATAGGAT
 
CAATGAATATAAACATATAAAACGGAATGAGGAATAATCGTAATATTAGT
 
ATGTAGAAATATAGATTCCATTTTGAGGATTCCTATATCCTCGAGGAGAA
 
CTTCTAGTATATTCTGTATACCTAATATTATAGCCTTTATCAACAATGGA
 
ATCCCAACAATTATCTCAACATTCACCCATTTCTCAAGTACT
 
|- style="height:30px; width:30px; text-align:center;"
 
| rowspan="3"| 2000-09-13
 
| rowspan="3"| [https://www.yeastgenome.org/locus/snR43 snR43]
 
| 107612
 
| 107612
 
| Insertion
 
|
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
| 107595
 
| 107595
 
| Deletion
 
| T
 
|
 
|- style="height:30px; width:30px; text-align:center;"
 
| 107522
 
| 107522
 
| Insertion
 
|
 
| A
 
|-
 
| || colspan="6" | The systematic sequence was updated in the region encompassing feature snR43. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  107467 TTTAAAGTAATTTCTTCTTTTTTTATAGTGAGAAATCTCAAAAGAAAAAAAAAAAA-TAA 107525
 
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
 
New:  107852 TTTAAAGTAATTTCTTCTTTTTTTATAGTGAGAAATCTCAAAAGAAAAAAAAAAAAATAA 107911
 
Old:  107586 TCAGCAACTTGTAGGAGGAGAAAGCAG-TATATAACTAGCCGCAATATGTTTGTGGTGGA 107644
 
              ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||
 
New:  107972 TCAGCAACT-GTAGGAGGAGAAAGCAGGTATATAACTAGCCGCAATATGTTTGTGGTGGA 108030</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| rowspan="2"| 2000-09-13
 
| rowspan="2"| [https://www.yeastgenome.org/locus/YCRWdelta11 YCRWdelta11]
 
| 169686
 
| 169686
 
| Substitution
 
| C
 
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
| 169575
 
| 169575
 
| Substitution
 
| T
 
| C
 
|-
 
| || colspan="6" | The systematic sequence was updated in the region encompassing feature YCRWdelta11. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  169561 AGAATCGAATGTATTTATCGGAAAGGATTTGAAATTTCGGCCATTTCCTCATTATGAAGT 169620
 
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
 
New:  170864 AGAATCGAATGTATCTATCGGAAAGGATTTGAAATTTCGGCCATTTCCTCATTATGAAGT 170923
 
Old:  169681 TCTTCCCCGGGCATGTCATTAGCATCTATATAAGGAACCTGTTTCTTAGACAAATTCTCT 169740
 
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:  170984 TCTTCTCCGGGCATGTCATTAGCATCTATATAAGGAACCTGTTTCTTAGACAAATTCTCT 171043</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2000-09-13
 
| [https://www.yeastgenome.org/locus/YCL022C YCL022C], [https://www.yeastgenome.org/locus/YCL024W YCL024W]
 
| 81861
 
| 81861
 
| Insertion
 
|
 
| C
 
|-
 
| || colspan="6" | One sequence change was made in the systematic sequence in the region encompassing overlapping features YCL024W and YCL022C. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  81841 ATAACGACACAGTGAATGCCC-TACTACAGTAAAAAAGCCACCTAACAGCGTACTCTT 81897
 
            ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
 
New:  81877 ATAACGACACAGTGAATGCCCCTACTACAGTAAAAAAGCCACCTAACAGCGTACTCTT 81934</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| rowspan="3"| 2000-09-13
 
| rowspan="3"| [https://www.yeastgenome.org/locus/YCL019W YCL019W], [https://www.yeastgenome.org/locus/YCL020W YCL020W]
 
| 86316
 
| 86316
 
| Substitution
 
| A
 
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
| 86092
 
| 86093
 
| Substitution
 
| CG
 
| GC
 
|- style="height:30px; width:30px; text-align:center;"
 
| 85235
 
| 85235
 
| Substitution
 
| T
 
| A
 
|-
 
| || colspan="6" | Several sequence changes were made in the systematic sequence in the region encompassing overlapping features YCL019W and YCL020W. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  85213 CACCACACACTTTAACATCAGATGAAAACTTTTCTACATGGGTTAAATTTTACATCAGAT 85272
 
            |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
 
New:  85600 CACCACACACTTTAACATCAGAAGAAAACTTTTCTACATGGGTTAAATTTTACATCAGAT 85659
 
Old:  86053 AATGACGAACTACCTGATCACCTTCTTATTGATTCAGGACGTTCGCAAACGCTTGTCAGA 86112
 
            |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||
 
New:  86440 AATGACGAACTACCTGATCACCTTCTTATTGATTCAGGAGCTTCGCAAACGCTTGTCAGA 86499
 
Old:  86293 GAGCTGGCTAATCAAAATATTACAGCCTGCTTTACCAGAAACACTTTAGAAAGATCGGAT 86352
 
            ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
 
New:  86680 GAGCTGGCTAATCAAAATATTACTGCCTGCTTTACCAGAAACACTTTAGAAAGATCGGAT 86739</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| rowspan="5"| 2000-09-13
 
| rowspan="5"| [https://www.yeastgenome.org/locus/YCL019W YCL019W]
 
| 89727
 
| 89727
 
| Substitution
 
| G
 
| A
 
|- style="height:30px; width:30px; text-align:center;"
 
| 89452
 
| 89452
 
| Deletion
 
| C
 
|
 
|- style="height:30px; width:30px; text-align:center;"
 
| 89442
 
| 89442
 
| Insertion
 
|
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 87159
 
| 87161
 
| Deletion
 
| CGC
 
|
 
|- style="height:30px; width:30px; text-align:center;"
 
| 86598
 
| 86599
 
| Substitution
 
| AT
 
| TA
 
|-
 
| || colspan="6" | Several sequence changes were made in the systematic sequence in the region encompassing feature YCL019W. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  86593 AACGCATGCACATATCAATGTCCTGACTGTCTAATCGGCAAAAGCACGAAACATAGACAT 86652
 
            |||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:  86980 AACGCTAGCACATATCAATGTCCTGACTGTCTAATCGGCAAAAGCACGAAACATAGACAT 87039
 
Old:  87133 GTCTCACCAAAAAACGATAAATCCGCCGCAAGACAACATGCAGGTTTAGCTGGACTGGAC 87192
 
            ||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||
 
New:  87520 GTCTCACCAAAAAACGATAAATCCGC---AAGACAACATGCAGGTTTAGCTGGACTGGAC 87576
 
Old:  89413 AGATTTGACTTACTATACTACATCAACACA-TTGCTCAACCATATACTATTCCCCTCTAG 89471
 
            |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||
 
New:  89797 AGATTTGACTTACTATACTACATCAACACACTTGCTCAAC-ATATACTATTCCCCTCTAG 89855
 
Old:  89712 AGCAGAAATACACGCGGTCAGTGAAGCTATTCCGCTATTGAATAACCTCAGTCACCTTGT 89771
 
            ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
 
New:  90096 AGCAGAAATACACGCAGTCAGTGAAGCTATTCCGCTATTGAATAACCTCAGTCACCTTGT 90155</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| rowspan="3"| 2000-09-13
 
| rowspan="3"| [https://www.yeastgenome.org/locus/YCL018W YCL018W]
 
| 91985
 
| 91985
 
| Substitution
 
| G
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 91144
 
| 91144
 
| Substitution
 
| T
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 91106
 
| 91106
 
| Substitution
 
| C
 
| T
 
|-
 
| || colspan="6" | Three single nucleotide sequence changes were made in the systematic sequence within ORF YCL018W. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  91092 GATGCTACAGGTGTCCCACTTCCAGATGAGGCGCTGGAAGCCTCCAAGAAGGTTGATGCC 91151
 
            |||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||
 
New:  91476 GATGCTACAGGTGTTCCACTTCCAGATGAGGCGCTGGAAGCCTCCAAGAAGGCTGATGCC 91535
 
Old:  91932 GTTTTGGATGCAGGTATCAGAACTGGTGATTTAGGTGGTTCCAACAGTACCACGGAAGTC 91991
 
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
 
New:  92316 GTTTTGGATGCAGGTATCAGAACTGGTGATTTAGGTGGTTCCAACAGTACCACCGAAGTC 92375</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| rowspan="5"| 2000-09-13
 
| rowspan="5"| [https://www.yeastgenome.org/locus/YCL017C YCL017C]
 
| 94143
 
| 94143
 
| Deletion
 
| A
 
|
 
|- style="height:30px; width:30px; text-align:center;"
 
| 94140
 
| 94141
 
| Substitution
 
| AT
 
| TA
 
|- style="height:30px; width:30px; text-align:center;"
 
| 94104
 
| 94104
 
| Deletion
 
| C
 
|
 
|- style="height:30px; width:30px; text-align:center;"
 
| 93964
 
| 93964
 
| Insertion
 
|
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 93438
 
| 93438
 
| Substitution
 
| A
 
| G
 
|-
 
| || colspan="6" | A single nucleotide substitution was made in the systematic sequence within the ORF YCL017C. Several sequence changes were also made in the region upstream of YCL017C. Note that coordinates listed are chromosomal coordinates.
 
Within YCL017C
 
<pre>Old:  93432 CTACGTAAGCTCTAGCATTTTCCACAGCAGTATTTGTTTCCCAACCGTAAGAGTGAGTGT 93491
 
            |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:  93816 CTACGTGAGCTCTAGCATTTTCCACAGCAGTATTTGTTTCCCAACCGTAAGAGTGAGTGT 93875
 
Upstream of YCL017C
 
Old:  93912 TATGCGATATATTTTAATGAAAATGATGTATCTGAAATAGAAAATATAACACA-TAATGA 93970
 
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
 
New:  94296 TATGCGATATATTTTAATGAAAATGATGTATCTGAAATAGAAAATATAACACACTAATGA 94355
 
Old:  94091 GGTAATAGGGTGCCATAATAGTATTGTAATATATATAAATATATAAAGCATCATATGATA 94150
 
            ||||||||||||| |||||||||||||||||||||||||||||||||||  | |||||||
 
New:  94476 GGTAATAGGGTGC-ATAATAGTATTGTAATATATATAAATATATAAAGCTAC-TATGATA 94533</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2000-09-13
 
| [https://www.yeastgenome.org/locus/YCL016C YCL016C]
 
| 95200
 
| 95200
 
| Deletion
 
| G
 
|
 
|-
 
| || colspan="6" | A sequence change was made in the systematic sequence in the region encompassing feature YCL016C, and the start of YCL016C was moved 213 nt upstream, extending the protein N-terminally by 71 amino acids. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  95171 AGAACTGTGTTTGAATGTTTGCGCTGCTTGCAGCACCCAAGTCTTGTCGTGCGAACACAG 95230
 
            ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
 
New:  95554 AGAACTGTGTTTGAATGTTTGCGCTGCTT-CAGCACCCAAGTCTTGTCGTGCGAACACAG 95612</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| rowspan="4"| 2000-09-13
 
| rowspan="4"| [https://www.yeastgenome.org/locus/YCL012W YCL012W], [https://www.yeastgenome.org/locus/YCL014W YCL014W]
 
| 100016
 
| 100016
 
| Deletion
 
| C
 
|
 
|- style="height:30px; width:30px; text-align:center;"
 
| 99907
 
| 99907
 
| Insertion
 
|
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 97118
 
| 97118
 
| Substitution
 
| C
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
| 96751
 
| 96751
 
| Substitution
 
| C
 
| A
 
|-
 
| || colspan="6" | Several sequence changes were made in the systematic sequence in the region encompassing feature YCL014W, resulting in the merge of ORF YCL012W into YCL014W. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  96731 CAATTTGGTAGAATTTTTGCCAAAATTCCTGATCGCCTTGAGAGTCAGAGTACTCAATGA 96790
 
            |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
 
New:  97113 CAATTTGGTAGAATTTTTGCAAAAATTCCTGATCGCCTTGAGAGTCAGAGTACTCAATGA 97172
 
Old:  97091 ACCTCAGGAAAAACTACTGAAGCTAAACTTAATTATAGAGAGATTGTGGAAGTCGAAAAA 97150
 
            ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
 
New:  97473 ACCTCAGGAAAAACTACTGAAGCTAAAGTTAATTATAGAGAGATTGTGGAAGTCGAAAAA 97532
 
Old:    99851 TGACAAATTCTTCGAAATTGAAGAAGAACTTAAGGAAGAATTGAAGGGCAGCAAAAC-GG 99909
 
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
 
New:  100233 TGACAAATTCTTCGAAATTGAAGAAGAACTTAAGGAAGAATTGAAGGGCAGCAAAACCGG 100292
 
Old:    99970 AGCATTCAAAGTTATTAGAACATCGCCTGTGAGAATTATCGGAAGGCACTTTTGAAGACA 100029
 
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
 
New:  100353 AGCATTCAAAGTTATTAGAACATCGCCTGTGAGAATTATCGGAAGG-ACTTTTGAAGACA 100411</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| rowspan="3"| 2000-09-13
 
| rowspan="3"| [https://www.yeastgenome.org/locus/YCL011C YCL011C]
 
| 101542
 
| 101542
 
| Substitution
 
| A
 
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
| 101506
 
| 101506
 
| Insertion
 
|
 
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
| 101485
 
| 101485
 
| Insertion
 
|
 
| A
 
|-
 
| || colspan="6" | Several sequence changes were made in the systematic sequence in the region downstream of feature YCL011C. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  101470 ATATTCAGTTTAGAAT-CCCTTTTTTTTTTTTTTTTTT-CTTCGCTTTTCGCATCTCATC 101527
 
              |||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||
 
New:  101852 ATATTCAGTTTAGAATACCCTTTTTTTTTTTTTTTTTTTCTTCGCTTTTCGCATCTCATC 101911
 
Old:  101528 GCTGGAAGTGGTGCACTTTTACAGGGATTAAATAAGGTTATTCTTTTTGGTCAAAATGAT 101587
 
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
 
New:  101912 GCTGGAAGTGGTGCTCTTTTACAGGGATTAAATAAGGTTATTCTTTTTGGTCAAAATGAT 101971</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2000-09-13
 
| [https://www.yeastgenome.org/locus/YCL009C YCL009C], [https://www.yeastgenome.org/locus/YCL010C YCL010C]
 
| 104419
 
| 104419
 
| Substitution
 
| T
 
| C
 
|-
 
| || colspan="6" | The systematic sequence was updated within ORF YCL009C. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  104408 TTTGCAGACAATTCCACAATACAGCTTGTTTCGCTGATGTCGACGACACGACCTCCAAAG 104467
 
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
 
New:  104792 TTTGCAGACAACTCCACAATACAGCTTGTTTCGCTGATGTCGACGACACGACCTCCAAAG 104851</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2000-09-13
 
| [https://www.yeastgenome.org/locus/YCL008C YCL008C], [https://www.yeastgenome.org/locus/YCL009C YCL009C]
 
| 105585
 
| 105585
 
| Insertion
 
|
 
| T
 
|-
 
| || colspan="6" | The systematic sequence was updated in the intergenic region between features YCL009C and YCL008C. Note that coordinates listed are chromosomal coordinates. This change is the exact reciprocal of the sequence change made on 1998-02-26.
 
<pre>Old:  105548 GTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGT-CAGGACGTCTATCTGTGCGTT 105606
 
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
 
New:  105932 GTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGTTCAGGACGTCTATCTGTGCGTT 105991</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| rowspan="7"| 2000-09-13
 
| rowspan="7"| [https://www.yeastgenome.org/locus/YCL005W YCL005W]
 
| 108457
 
| 108457
 
| Substitution
 
| G
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 108385
 
| 108385
 
| Deletion
 
| A
 
|
 
|- style="height:30px; width:30px; text-align:center;"
 
| 107780
 
| 107780
 
| Insertion
 
|
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
| 107769
 
| 107769
 
| Insertion
 
|
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
| 107767
 
| 107767
 
| Insertion
 
|
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
| 107745
 
| 107745
 
| Insertion
 
|
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
| 107739
 
| 107739
 
| Deletion
 
| A
 
|
 
|-
 
| || colspan="6" | The systematic sequence was updated in the region encompassing feature YCL005W, and at the same time the stop site for YCL005W was moved 6 nucleotides downstream, increasing the length of the coding region from 765 to 771 nt. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  107705 GCCTTTATCAATTTTCGTATGGAATGGGTTTCAGACTTGTG-CATTGCCTATCAACATCC 107763
 
              |||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||
 
New:  108091 GCCTTTATCAATTTTCGTATGGAATGGGTTTCAG-CTTGTGGCATTGCCTATCAACATCC 108149
 
Old:  107764 CATT-AG-TTGTTCCTGGG-ACGTCGCTGAGCCGTTTAGTTGCACAAACAAGCACATTAG 107820
 
              |||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||
 
New:  108150 CATTGAGGTTGTTCCTGGGGACGTCGCTGAGCCGTTTAGTTGCACAAACAAGCACATTAG 108209
 
Old:  108361 TCGTTAATATAAAGATTTTACGAAAGGAATTCTAGGTGATATTGCAATTACTTCTTCTCA 108420
 
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
 
New:  108750 TCGTTAATATAAAGATTTTACGAA-GGAATTCTAGGTGATATTGCAATTACTTCTTCTCA 108808
 
Old:  108421 TGCACTAACAAGTGAATGATAGAAATATGTTGAGTTGCTAACTGCCTGATTTTAAATAAG 108480
 
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
 
New:  108809 TGCACTAACAAGTGAATGATAGAAATATGTTGAGTTCCTAACTGCCTGATTTTAAATAAG 108868</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| rowspan="6"| 2000-09-13
 
| rowspan="6"| [https://www.yeastgenome.org/locus/YCL004W YCL004W]
 
| 110557
 
| 110557
 
| Deletion
 
| A
 
|
 
|- style="height:30px; width:30px; text-align:center;"
 
| 110330
 
| 110331
 
| Substitution
 
| GA
 
| AG
 
|- style="height:30px; width:30px; text-align:center;"
 
| 110286
 
| 110286
 
| Insertion
 
|
 
| TCTAT
 
|- style="height:30px; width:30px; text-align:center;"
 
| 110100
 
| 110100
 
| Insertion
 
|
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
| 109996
 
| 109996
 
| Deletion
 
| C
 
|
 
|- style="height:30px; width:30px; text-align:center;"
 
| 109930
 
| 109930
 
| Deletion
 
| C
 
|
 
|-
 
| || colspan="6" | The systematic sequence was updated in the region encompassing feature YCL004W. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  109921 TGCTATTACCATTAAGAGAATGGCAAAGAGGCGTAGTAAATAAGCCGAATGGTTGGTCAT 109980
 
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:  110309 TGCTATTAC-ATTAAGAGAATGGCAAAGAGGCGTAGTAAATAAGCCGAATGGTTGGTCAT 110367
 
Old:  109981 ATCACGCAAAAGGTACTTTGGCTTTCCGCTCGTGATAAAAATGATGCTAACAATTGGAAA 110040
 
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
 
New:  110368 ATCACGCAAAAGGTA-TTTGGCTTTCCGCTCGTGATAAAAATGATGCTAACAATTGGAAA 110426
 
Old:  110101 -AATCGAATGCTCTCATTATTACAAGAGATGAAGAGCTAAGAAAAAAAATGAAAGCAGAG 110159
 
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:  110487 GAATCGAATGCTCTCATTATTACAAGAGATGAAGAGCTAAGAAAAAAAATGAAAGCAGAG 110546
 
Old:  110280 ATTCTAT-----CATAGTATGTCGCCTGTAAATATGGAAAAATAAAAGAAAAAATGATAA 110334
 
              |||||||    |||||||||||||||||||||||||||||||||||||||||||  |||
 
New:  110667 ATTCTATTCTATCATAGTATGTCGCCTGTAAATATGGAAAAATAAAAGAAAAAATAGTAA 110726
 
Old:  110515 AGGGCGTTGAATTAAATGGTATCTCGTAAAACAATGCATTGGATCGGTATTACCAGTCTA 110574
 
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
 
New:  110907 AGGGCGTTGAATTAAATGGTATCTCGTAAAACAATGCATTGG-TCGGTATTACCAGTCTA 110965</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2000-09-13
 
| [https://www.yeastgenome.org/locus/YCL002C YCL002C]
 
| 111325
 
| 111325
 
| Deletion
 
| C
 
|
 
|-
 
| || colspan="6" | The systematic sequence was updated in the region encompassing feature YCL002C. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  111295 TAATTGCTTCGCAGGGCTCCTCAACCTCTCCTCTGGAAAACCTTACCTCAATGAGGTTAA 111354
 
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
 
New:  111686 TAATTGCTTCGCAGGGCTCCTCAACCTCTC-TCTGGAAAACCTTACCTCAATGAGGTTAA 111744</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2000-09-13
 
| [https://www.yeastgenome.org/locus/YCL001W-A YCL001W-A], [https://www.yeastgenome.org/locus/YCL001W-B YCL001W-B]
 
| 113232
 
| 113232
 
| Insertion
 
|
 
| AG
 
|-
 
| || colspan="6" | The systematic sequence was updated in the region between YCL001W-A and YCL001W-B. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  113215 AGAAGGAGCAAATAAGCC--TTTTAAGGAACCGAGATAAGCTGTTTTCGCCCATTGTTCT 113272
 
              ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||
 
New:  113605 AGAAGGAGCAAATAAGCCAGTTTTAAGGAACCGAGATAAGCTGTTTTCGCCCATTGTTCT 113664</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2000-09-13
 
| [https://www.yeastgenome.org/locus/YCR061W YCR061W]
 
| 225653
 
| 225673
 
| Substitution
 
| AAATTCTCACCGGCCCCAAGG
 
| CGCGTTTATGTTCATAGGAACCGGA T
 
|-
 
| || colspan="6" | The systematic sequence was updated in the region encompassing ORF YCR061W. Note that coordinates listed below are chromosomal coordinates.
 
<pre>Old:  225625 CTGCCAAGGATTTACAGCATGTGTCGATAAA-TTC-T---CACCGGCCCCAAGGTGTGTG 225679
 
              ||||||||||||||||||||||||||||    ||  |  ||  ||  ||    ||||||
 
New:  226888 CTGCCAAGGATTTACAGCATGTGTCGATCGCGTTTATGTTCATAGGAACCGGATTGTGTG 226947</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2000-09-13
 
| [https://www.yeastgenome.org/locus/YCR060W YCR060W]
 
| 223942
 
| 223942
 
| Substitution
 
| C
 
| T
 
|-
 
| || colspan="6" | The systematic sequence was updated downstream of ORF YCR060W. Note that coordinates listed below are chromosomal coordinates.
 
<pre>Old:  223885 TGTATTGGCAACTAACGGAACTAAGGCAACATATCTTGCATATTGCAATGTTCACTACAT 223944
 
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
 
New:  225148 TGTATTGGCAACTAACGGAACTAAGGCAACATATCTTGCATATTGCAATGTTCACTATAT 225207</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2000-09-13
 
| [https://www.yeastgenome.org/locus/YCR057C YCR057C], [https://www.yeastgenome.org/locus/YCR059C YCR059C]
 
| 222085
 
| 222085
 
| Insertion
 
|
 
| T
 
|-
 
| || colspan="6" | The systematic sequence was updated in the region between features YCR057C and YCR059C. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  222026 TATTGATATTATACTAGTTATTGTACATACCTAGAACTATACTCGAAACTTTTTTTTTTT 222085
 
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:  223288 TATTGATATTATACTAGTTATTGTACATACCTAGAACTATACTCGAAACTTTTTTTTTTT 223347
 
Old:  222086 -CATCTTTCAGCTCATCGCAAAATTTTTCCAAAAAATTTCAAAAAGAACTCCCGTCGCAT 222144
 
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:  223348 TCATCTTTCAGCTCATCGCAAAATTTTTCCAAAAAATTTCAAAAAGAACTCCCGTCGCAT 223407</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2000-09-13
 
| [https://www.yeastgenome.org/locus/YCR054C YCR054C], [https://www.yeastgenome.org/locus/YCR057C YCR057C]
 
| 219173
 
| 219173
 
| Substitution
 
| G
 
| A
 
|-
 
| || colspan="6" | The systematic sequence was updated in the region betweeen ORFs YCR054C and YCR057C. Note that coordinates listed below are chromosomal coordinates. Note also that this same change was made on 1997-07-27, but changed back to its original state on 1998-02-26, so that this current change restores one originally made on 1997-07-27.
 
<pre>Old:  219146 CATGATGTGAATGTGCATAAATAGAGGGCAGTGAATATTTTTCAAGGAAGCTCTTTCTCA 219205
 
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
 
New:  220408 CATGATGTGAATGTGCATAAATAGAGGACAGTGAATATTTTTCAAGGAAGCTCTTTCTCA 220467</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| rowspan="3"| 2000-09-13
 
| rowspan="3"| [https://www.yeastgenome.org/locus/YCR079W YCR079W]
 
| 252912
 
| 252912
 
| Insertion
 
|
 
| G
 
|- style="height:30px; width:30px; text-align:center;"
 
| 252844
 
| 252844
 
| Insertion
 
|
 
| C
 
|- style="height:30px; width:30px; text-align:center;"
 
| 252813
 
| 252813
 
| Insertion
 
|
 
| G
 
|-
 
| || colspan="6" | The systematic sequence was updated within ORF YCR079W, causing frameshifts leading to a C-terminally altered and extended protein from amino acid 415 onward. The annotated coding region has been extended from 1308 nt to 1329 nt. Note that coordinates listed below are chromosomal coordinates.
 
<pre>Old:  252792 GTGGTTAGGCTTTCCAATTGGG-CAACTGGCCCAATGTTGACAGAACTGGCCCC-AAAGA 252849
 
              |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||
 
New:  254059 GTGGTTAGGCTTTCCAATTGGGGCAACTGGCCCAATGTTGACAGAACTGGCCCCCAAAGA 254118
 
A single nucleotide insertion has also been made immediately downstream of the newly-extended YCR079W coding region.
 
Old:  252910 GTG-AAACAAGTCCTAGATAATCATCTTTTGTATTTTTTTTCTTCCTTTTATTAGTATGT 252968
 
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:  254179 GTGGAAACAAGTCCTAGATAATCATCTTTTGTATTTTTTTTCTTCCTTTTATTAGTATGT 254238</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| rowspan="3"| 2000-09-13
 
| rowspan="3"| [https://www.yeastgenome.org/locus/YCR077C YCR077C]
 
| 250109
 
| 250111
 
| Deletion
 
| AAG
 
|
 
|- style="height:30px; width:30px; text-align:center;"
 
| 249242
 
| 249242
 
| Insertion
 
|
 
| T
 
|- style="height:30px; width:30px; text-align:center;"
 
| 249237
 
| 249237
 
| Deletion
 
| G
 
|
 
|-
 
| || colspan="6" | The systematic sequence was updated within ORF YCR077C. As a result, the annotated stop site was moved 1 codon upstream, reducing the length of the coding region from 2394 nt to 2391 nt. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  249193 TGGTGGTTTAGCTTTCCACTTAGTGCTAAACTAGCTAGGAACTGGCCAAA-GTATGCTTC 249251
 
              |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||
 
New:  250463 TGGTGGTTTAGCTTTCCACTTAGTGCTAAACTAGCTAGGAACTG-CCAAATGTATGCTTC 250521
 
Old:  250092 CGCATCGGGGTCAGAAGAAGGCTGTTGTCTGGGGATCTGCAGTTGTCTTCTTGGATTCTT 250151
 
              |||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||
 
New:  251362 CGCATCGGGGTCAGAAG---GCTGTTGTCTGGGGATCTGCAGTTGTCTTCTTGGATTCTT 251418</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2000-09-13
 
| [https://www.yeastgenome.org/locus/YCR073W-A YCR073W-A], [https://www.yeastgenome.org/locus/YCR075C YCR075C]
 
| 246726
 
| 246726
 
| Insertion
 
|
 
| AT
 
|-
 
| || colspan="6" | The systematic sequence was updated in the region between ORFs YCR073W-A and YCR075C. Note that coordinates listed are chromosomal coordinates.
 
<pre>Old:  246675 ACATACATACATATATTTATGTATATTTATGTATATATATATATATATATAT--GCGTAA 246732
 
              ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
 
New:  247943 ACATACATACATATATTTATGTATATTTATGTATATATATATATATATATATATGCGTAA 248002</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2000-09-13
 
| [https://www.yeastgenome.org/locus/YCR073W-A YCR073W-A]
 
| 246199
 
| 246199
 
| Substitution
 
| T
 
| C
 
|-
 
| || colspan="6" | The systematic sequence was updated in the region encompassing ORF YCR073W-A. Note that coordinates listed below are chromosomal coordinates.
 
<pre>Old:  246195 TGCGTTGATAACTATGAAAAGGTGCTAATCCGCGGGTTTGCCGGTAGAGATTCCGTCAAA 246254
 
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:  247463 TGCGCTGATAACTATGAAAAGGTGCTAATCCGCGGGTTTGCCGGTAGAGATTCCGTCAAA 247522</pre>
 
 
 
|- style="height:30px; width:30px; text-align:center;"
 
| 2000-09-13
 
| [https://www.yeastgenome.org/locus/YCR073C YCR073C]
 
| 241455
 
| 241455
 
| Deletion
 
| G
 
|
 
|-
 
| || colspan="6" | The systematic sequence was updated within ORF YCR073C. As a result, YCR073C was extended at the 3' end, so that the coding region increased in length from 3945 nt to 3996 nt. Note that coordinates listed below are chromosomal coordinates.
 
<pre>Old:  241395 GTAGTTCCACAGCAGTAGCCCTCATAGTGGGGTCTTGAACCAAACACCTTTCCAAGAAGG 241454
 
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 
New:  242664 GTAGTTCCACAGCAGTAGCCCTCATAGTGGGGTCTTGAACCAAACACCTTTCCAAGAAGG 242723