Chromosome III History

From SGD-Wiki
Jump to: navigation, search

This page lists all sequence and annotation changes that have been made to the Chromosome III systematic reference sequence since its intial release on 1996-07-31.

  • The sequence of Chromosome III has been updated 705 times, affecting 132 features.
  • The annotation of Chromosome III has been updated 53 times, affecting 108 features.

Current and past versions can be obtained from SGD's Download site.

Sequence Changes

Date Affected Features Start Coordinate of Change End Coordinate of Change Type of Change Old Sequence New Sequence
2011-02-03 YCL002C 110880 110880 Insertion A
A single nucleotide was inserted within ORF YCL002C, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 12 amino acids longer.
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD paper | PubMed | Full-Text

2011-02-03 YCR091W 275421 275421 Substitution A G
A single nucleotide substitution in the coding region of KIN82/YCR091W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 341 is now Valine rather than Methionine.
               |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD paper | PubMed | Full-Text

2011-02-03 YCR077C 250563 250563 Substitution A T
A single nucleotide substitution in the coding region of PAT1/YCR077C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 688 is now Aspartic Acid rather than Valine.
               |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD paper | PubMed | Full-Text

2011-02-03 YCR020W-B, YCR021C 155961 155961 Insertion TG
A dinucleotide insertion was made in the intergenic region between ORFs YCR020W-B and YCR021C.
             |||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD paper | PubMed | Full-Text

2011-02-03 YCR019W 152641 152641 Substitution G A
A single nucleotide substitution was made in the intergenic region upstream of ORF YCR019W/MAK32.
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD paper | PubMed | Full-Text

2011-02-03 YCR024C, YCR024C-B 162275 162275 Substitution A G
162392 162392 Substitution C G
Two single nucleotide substitutions were made in the intergenic region between ORFs YCR024C and YCR024C-B.
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||

             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD paper | PubMed | Full-Text

2011-02-03 YCL012C 101655 101655 Substitution T A
101652 101652 Substitution A T
Two single nucleotide substitutions were made within the intron of YCL012C.
             ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD paper | PubMed | Full-Text

2011-02-03 YCL001W, YCL002C 111718 111718 Insertion C
A single nucleotide insertion was made in the intergenic region between ORFs YCL002C and YCL001W.
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD paper | PubMed | Full-Text

2011-02-03 YCR072C, YCR073C 242444 242444 Deletion T
A single nucleotide deletion was made in the intergenic region between ORFs YCR072C and YCR073C.
             ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD paper | PubMed | Full-Text

2006-01-12 YCL025C 76147 76147 Insertion G
SGD confirmed the sequence error predicted by the work of Brachat et al and Schreve et al., and has updated the systematic sequence accordingly. As a consequence of this sequence change, AGP1/YCL025C was extended on the 3' end, altering the C-terminus and increasing the size of the predicted protein from 595 to 633 amino acids
           ||||||||||| ||||||||||||||||||||||||||||||||

Schreve JL, et al. (1998) The Saccharomyces cerevisiae YCC5 (YCL025c) gene encodes an amino acid permease, Agp1, which transports asparagine and glutamine. J Bacteriol 180(9):2556-9
SGD paper | PubMed | Full-Text
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text

2004-02-20 YCL012C 101615 101615 Insertion G
101461 101461 Insertion T
101692 101692 Insertion A
101648 101648 Insertion A
Four single nucleotide insertions were made in the region now spanning new feature YCL012C. This feature was independently predicted by Cliften et al. 2003 and Zhang & Dietrich 2003. The sequence changes were confirmed by Zhang and Dietrich (GenBank AY178910).
            |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| 

            | ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| 

            |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| 

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement
Zhang Z and Dietrich FS (2003) Verification of a new gene on Saccharomyces cerevisiae chromosome III. Yeast 20(8):731-8
SGD paper | PubMed | Full-text

2004-02-19 YCL008C 105970 105970 Deletion T
Based on Brachat et al. 2003 and GenBank AY260880, the T at 105970 was deleted. This change resulted in a frameshift, moving the stop 267 bp downstream, and extending the protein from 296 aa to 385 aa.
              ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| 

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text

2000-09-13 YCR031C, snR189 177189 177190 Deletion AA
177166 177166 Substitution T G
177093 177093 Substitution A G
177003 177004 Deletion AA
The systematic sequence was updated in the region between features RPS14A/YCR031C and snR189. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||

              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||

              ||||||||||||||||||| ||||||||||||||||||||||  ||||||||||||||||
2000-09-13 snR189 177328 177328 Substitution T G
The systematic sequence was updated within feature snR189. Note that coordinates listed are chromosomal coordinates.
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR032W, snR189 178236 178236 Deletion A
177800 177801 Substitution CA AC
The systematic sequence was updated in the region between features snR189 and BPH1/YCR032W. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||

              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 snR33 142098 142098 Substitution C G
The systematic sequence was updated within feature snR33. Note that coordinates listed are chromosomal coordinates.
              ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
142388 142388 Substitution G A
142382 142382 Substitution A C
142301 142301 Deletion A
142279 142281 Deletion AAC
142202 142202 Substitution T C
142186 142186 Substitution C T
142178 142178 Substitution G A
142173 142173 Insertion A
142154 142154 Deletion T
The systematic sequence was updated in the region upstream of feature snR33. Note that coordinates listed are chromosomal coordinates.
              ||| ||||||||||||||||||| |||| ||||||| ||||||||||||||| |||||||
              |||||||||   ||||||||||||||||||| ||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
New:   142781 ATGATTC--------------------------------------------------- 142787
New:   142787 ---------------------------------------------------GAGAAAAGCAACAATATTATGTA 142810
2000-09-13 YCL023C, YCL025C 78402 78402 Insertion CC
78400 78400 Substitution C G
78035 78035 Insertion A
78027 78027 Insertion A
Several sequence changes were made in the systematic sequence in the intergenic region between features YCL025C and YCL023C. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||||| ||  ||||||||||||||||||
2000-09-13 YCR048W, YCR051W 212559 212559 Insertion C
The systematic sequence was updated in the intergenic region between ORFs YCR048W and YCR051W. Note that coordinates listed below are chromosomal coordinates.
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR042C, YCR043C 204348 204348 Deletion T
The systematic sequence was updated in the region between ORFs YCR042C and YCR043C. Note that coordinates listed below are chromosomal coordinates.
              ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR023C, YCR024C 160291 160291 Substitution A G
160135 160135 Substitution T C
160129 160129 Substitution G T
The systematic sequence was updated in the intergenic region between ORFs YCR023C and YCR024C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR023C 159827 159827 Substitution T C
159753 159753 Substitution T C
159397 159397 Substitution T C
159255 159255 Substitution T A
The systematic sequence was updated within ORF YCR023C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
2000-09-13 YCL065W 13811 13811 Substitution C G
A single nucleotide substitution was made in the systematic sequence in the region encompassing ORF YCL065W. The C at 13811 was changed to G. This is coding nucleotide 72 (codon 24, TGC to TGG) resulting in one amino acid substitution in the predicted protein sequence (Cys to Trp). Note that coordinates listed below are chromosomal coordinates.
             ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR107W 312725 312725 Substitution T A
The systematic sequence was updated within ORF YCR107W. Note that coordinates listed below are chromosomal coordinates.
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR105W, YCR106W 309312 309312 Substitution G A
The systematic sequence was updated in the region between ORFs YCR105W and YCR106W. Note that coordinates listed below are chromosomal coordinates.
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR104W, YCR105W 307323 307323 Deletion T
The systematic sequence was updated in the region between ORFs YCR104W and YCR105W. Note that coordinates listed are chromosomal coordinates.
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR102W-A, YCR104W 306173 306173 Substitution G T
305943 305943 Insertion G
305908 305908 Insertion C
The systematic sequence was updated in the region between ORFs YCR102W-A and YCR104W. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
2000-09-13 YCR102C, YCR102W-A 304740 304740 Insertion A
304543 304543 Insertion A
The systematic sequence was updated in the region between ORFs YCR102C and YCR102W-A. Note that coordinates listed below are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
2000-09-13 YCR093W 282731 282731 Substitution C T
The systematic sequence was updated within ORF YCR093W. Note that coordinates listed below are chromosomal coordinates.
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR091W 275195 275195 Insertion C
274147 274147 Substitution G A
The systematic sequence was updated in the region encompassing ORF YCR091W, causing a frameshift leading to a C-terminally altered and shortened protein from aa 690 onward. The coding region of YCR091W had been annotated as 2181 nt long, but is now 2163 nt. Note that coordinates listed below are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
2000-09-13 YCR088W, YCR089W 265773 265773 Substitution A G
The systematic sequence was updated in the region between ORFs YCR088W and YCR089W. Note that coordinates listed below are chromosomal coordinates.
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
2000-09-13 YCR089W 269261 269262 Substitution TT AA
268390 268390 Substitution A T
The systematic sequence was updated within ORF YCR089W. Note that coordinates listed below are chromosomal coordinates.
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||
2000-09-13 YCL074W 3601 3601 Substitution C A
3551 3551 Substitution G T
3538 3538 Substitution C T
3209 3209 Substitution A T
3069 3069 Substitution G C
Five single nucleotide substitutions were made in the systematic sequence in the region encompassing pseudogene YCL074W. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
             ||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCL074W, YCLWomega2 3858 3858 Substitution C A
A single nucleotide substitution was made in the systematic sequence in the intergenic region between features YCL074W and YCLWomega2. The C at 3858 was changed to A. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
2000-09-13 YCL073C, YCLWomega2 5909 5909 Substitution T C
5833 5833 Substitution C T
5683 5683 Substitution C T
5638 5638 Substitution T C
5634 5634 Substitution C T
5631 5631 Substitution T C
5615 5615 Deletion G
5524 5524 Substitution C A
5492 5492 Substitution A T
5486 5486 Substitution T C
5478 5478 Substitution T C
5475 5475 Substitution A G
5468 5468 Substitution T G
5443 5443 Substitution C T
5437 5437 Deletion C
5432 5435 Deletion CATC
5408 5408 Deletion T
5403 5406 Deletion AGGA
5401 5401 Deletion C
5398 5398 Deletion A
5394 5394 Substitution A G
Several sequence changes were made in the systematic sequence in the intergenic region between features YCLWomega2 and YCL073C. Note that coordinates listed are chromosomal coordinates.
             | ||| || |    | |||||||||||||||||||||||    | ||||| ||||||||||||||||||||||||
             |||||| || ||||||| ||||| ||||||||||||||||||||||||||||||| ||||
             |||||||||||||||||||||||||| ||||||||||||||| || ||| ||||||||||
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
2000-09-13 YCL073C
7997 7997 Substitution C T
7943 7943 Substitution C T
7778 7778 Substitution T C
7451 7451 Substitution A G
7445 7445 Substitution A G
7415 7415 Substitution T C
6968 6968 Substitution G A
6533 6533 Substitution G A
6504 6504 Substitution T C
6490 6490 Substitution C T
6484 6484 Substitution C T
6480 6480 Substitution G A
Twelve separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL073C. These changes resulted in 4 amino acid differences in the predicted protein sequence. Note that coordinates listed are chromosomal coordinates.
             |||||||||||| ||| ||||| |||||||
             |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
             ||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
             ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCL069W, YCL073C 8764 8764 Substitution C T
8733 8733 Substitution T C
8686 8686 Substitution A G
8675 8675 Substitution T C
8585 8585 Insertion AAA
8577 8577 Substitution T A
8535 8535 Substitution C T
8521 8521 Substitution C T
8365 8366 Deletion TT
8344 8344 Substitution T C
Several sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL073C and YCL069W. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
             |||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
              ||||||||||||||||||||||||||||||||||||||||| ||||||||
             ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||
             ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCL073C, YCLWomega2 6231 6231 Substitution T G
6226 6226 Substitution A G
6195 6195 Substitution T C
6164 6164 Substitution T A
6090 6090 Substitution T C
6055 6055 Substitution C G
6014 6014 Substitution T C
6006 6006 Substitution C T
5990 5990 Substitution G A
5980 5980 Substitution G A
6098 6098 Substitution C T
Several sequence changes were made in the systematic sequence in the intergenic region between features YCLWomega2 and YCL073C. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||
             ||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||
             ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
             |||||| |||||||||||||||||||||||||||||| |||| |||||||||||||||||
2000-09-13 YCL073C, YCLWomega2 6466 6466 Substitution A G
6444 6446 Deletion TTT
6443 6443 Substitution T G
6433 6433 Substitution T A
6398 6398 Substitution C T
6391 6391 Substitution A G
6377 6377 Substitution A G
6325 6325 Substitution A G
6315 6315 Substitution A C
6281 6281 Substitution T G
6279 6279 Substitution C T
6267 6267 Substitution T C
6255 6256 Substitution GT CC
6248 6248 Insertion TCTTTACCGACGCTGAG
6389 6389 Substitution A G
6261 6261 Substitution T C
Several sequence changes were made in the systematic sequence in the intergenic region between features YCLWomega2 and YCL073C. Note that coordinates listed are chromosomal coordinates.
Old:    6249 -----------------TCTTTAGTG 6257
                              ||||||  |
             ||| ||||| ||||||||||| | ||||||||||||||||||||||||||||||||| ||
             ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
             ||||||||||| | |||||| |||||||||||||||||||||||||||||||||| ||||
             |||||    ||||||||||||||||||| ||||||||||||| ||| ||||| |||||||
2000-09-13 YCL068C 12268 12268 Deletion T
12049 12049 Substitution G C
Two sequence changes were made in the systematic sequence in the region encompassing ORF YCL068C. The G at 12049 was changed to C, and the T at 12268 was deleted. These changes resulted in the N-terminal elongation of the predicted protein sequence by 70 amino acids. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
2000-09-13 YCL067C, YCL068C 12340 12340 Insertion AT
A dinucleotide insertion was made in the systematic sequence in the intergenic region between ORFs YCL068C and YCL067C. An AT was inserted after the T at 12340. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||
2000-09-13 YCL064C 16068 16068 Substitution G T
15921 15921 Insertion C
15918 15918 Deletion T
Three sequence changes were made in the systematic sequence within ORF YCL064C. The T at 15918 was deleted, a single C was inserted after the C at 15921, and the G at 16068 was changed to T. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
2000-09-13 YCL063W, YCL064C 17185 17185 Insertion T
17079 17079 Insertion C
17067 17067 Substitution A G
17045 17045 Insertion G
17035 17035 Insertion TA
17026 17026 Insertion T
16992 16992 Substitution A T
16970 16970 Substitution A T
Several sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL064C and YCL063W. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
             ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||
               |||||||||| ||||||||||||||||||||| |||||||||||| ||||||||||||
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
2000-09-13 YCL061C 21923 21923 Substitution T G
21911 21911 Insertion T
21801 21801 Deletion C
Three sequence changes were made in the systematic sequence in the region encompassing ORF YCL061C. The C at 21801 was deleted, a T was inserted after the T at 21911, and the T at 21923 was changed to G, resulting in the N-terminal extension of the predicted protein sequence by 243 amino acids. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
             |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||
2000-09-13 YCL051W, YCL052C 35577 35577 Insertion T
35570 35570 Insertion T
35568 35568 Insertion A
35506 35506 Insertion A
Four single nucleotide insertions were made in the systematic sequence in the intergenic region between ORFs YCL052C and YCL051W. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
              || ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCL051W 37579 37579 Insertion TT
37553 37553 Insertion C
37551 37551 Insertion A
37547 37547 Insertion A
37504 37504 Substitution G A
37463 37463 Substitution T C
37374 37374 Substitution A G
Several sequence changes were made in the systematic sequence within ORF YCL051W, resulting in a number of amino acid changes in the predicted protein sequence. In addition, the stop site was moved upstream 9 nucleotides, shortening the coding sequence from 1761 nt to 1752 nt. Note that coordinates listed are chromosomal coordinates.
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
             || |||| || ||||||||||||||||||||||||||  ||||||||||||||||||||||
2000-09-13 YCL050C, YCL051W 37772 37773 Deletion TA
37705 37705 Substitution T C
37638 37638 Substitution G A
Three sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL051W and YCL050C. The G at 37638 was changed to A, the T at 37705 was changed to C, and the TA dinucleotide at 37772-3 was deleted. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
             ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCL050C 38790 38790 Substitution G T
38640 38640 Substitution G A
38479 38479 Substitution C T
38294 38294 Substitution A G
38154 38154 Substitution G A
37998 37998 Substitution A G
Six separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL050C. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
             |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
2000-09-13 ARS305, YCL050C 39099 39099 Substitution T A
One sequence substitution was made in the systematic sequence in the intergenic region between features YCL050C and ARS305. The T at 39099 was changed to A. Note that coordinates listed are chromosomal coordinates.
             ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCL049C 40174 40174 Substitution A T
40121 40121 Substitution T C
40086 40086 Substitution A C
40066 40066 Substitution A G
39985 39985 Substitution A G
39944 39944 Substitution G A
Six separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL049C, resulting in 4 amino acid substitutions in the predicted protein sequence. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||
             |||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||
             ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCL042W 50702 50702 Substitution G C
50700 50700 Substitution G C
50657 50657 Insertion GG
50635 50635 Insertion C
One single nucleotide insertion, one dinucleotide insertion, and two single nucleotide substitutions were made in the systematic sequence within ORF YCL042W, resulting in several amino acid changes in the predicted protein sequence, and increasing the size of the coding sequence from 357 nucleotides to 360 nt. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||| ||||||||||||||||||||||
               |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||
2000-09-13 YCL037C, YCL038C 57211 57211 Insertion A
57043 57043 Deletion A
56612 56612 Insertion A
Three sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL038C and YCL037C. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCL034W 61789 61789 Insertion G
A single nucleotide insertion was made in the systematic sequence in the region encompassing ORF YCL034W, extending the predicted protein sequence N-terminally by 89 amino acids. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
2000-09-13 YCL030C 67181 67181 Substitution C G
One sequence change was made in the systematic sequence in the region encompassing ORF YCL030C, resulting in one amino acid substitution. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
2000-09-13 YCL029C 69717 69717 Substitution T C
69690 69690 Substitution G A
69624 69624 Substitution C T
Three sequence changes were made in the systematic sequence in the region encompassing ORF YCL029C. Note that coordinates listed are chromosomal coordinates.
             ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||
2000-09-13 YCL028W 71366 71366 Deletion C
71282 71282 Substitution T C
71219 71219 Substitution T C
71213 71213 Substitution A G
71201 71201 Substitution C G
71195 71195 Substitution A G
71051 71051 Substitution C T
70808 70808 Substitution T C
70757 70757 Substitution T C
70742 70742 Substitution A G
Several sequence changes were made in the systematic sequence in the region encompassing ORF YCL028W. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
             |||||||||||||||||||||| ||||| ||||||||||| ||||| |||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
             ||||||||||||| |||||||||||||||||||||||||||||||||||
2000-09-13 YCL027W, YCL028W 71729 71729 Insertion T
71608 71608 Substitution A T
71408 71408 Insertion T
Three sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL028W and YCL027W. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||||||||||||||| |||
             |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCL027W 73226 73226 Substitution A T
73218 73218 Substitution G A
73204 73204 Substitution G A
73066 73066 Substitution A G
72757 72757 Substitution C T
72161 72161 Substitution C T
Several sequence changes were made in the systematic sequence in the region encompassing ORF YCL027W. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
             |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
             ||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCL026C-A 74943 74943 Insertion T
74813 74813 Insertion C
74935 74935 Insertion T
Three sequence changes were made in the systematic sequence in the region encompassing ORF YCL026C-A. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |||
2000-09-13 YCL025C, YCL026C-A 76114 76115 Substitution GG T
75986 75986 Insertion T
75831 75831 Substitution T C
75514 75514 Substitution A G
Several sequence changes were made in the systematic sequence in the intergenic region between features YCL026C-A and YCL025C. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||
2000-09-13 YCL025C 77472 77472 Substitution G A
77320 77320 Insertion G
77297 77297 Deletion A
76165 76165 Substitution T A
76940 76940 Substitution A G
Five sequence changes were made in the systematic sequence in the region encompassing ORF YCL025C. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
             |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
             ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||
             ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 tQ(UUG)C 168331 168335 Deletion AGGTG
The systematic sequence was updated in the region encompassing feature tQ(UUG)C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||     |||||||||||||||||||||||||||
2000-09-13 YCRWdelta11, tQ(UUG)C 168881 168881 Substitution C T
168787 168787 Substitution A G
168685 168685 Substitution T C
168682 168682 Substitution T C
168541 168541 Substitution C G
168465 168465 Substitution C G
168442 168442 Substitution T G
168368 168368 Substitution C A
The systematic sequence was updated in the region encompassing features tQ(UUG)C and YCRWdelta11. Note that coordinates listed are chromosomal coordinates.
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
              ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
2000-09-13 YCRWdelta11, tQ(UUG)C 169454 169454 Substitution G A
169337 169337 Substitution G C
169259 169259 Substitution T C
169250 169250 Substitution G A
169110 169110 Insertion A
169071 169071 Substitution G A
168967 168967 Substitution C T
168933 168933 Insertion A
The systematic sequence was updated in the region encompassing features tQ(UUG)C and YCRWdelta11. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
              ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 tN(GUU)C 127750 127750 Insertion C
The systematic sequence was updated in the region encompassing feature tN(GUU)C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
2000-09-13 YCR016W, tG(GCC)C 143330 143330 Substitution T C
143280 143281 Substitution GG CA
143021 143021 Substitution A G
The systematic sequence was updated in the intergenic region between features tG(GCC)C and YCR016W. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||
              |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
A large insertion was made in the systematic sequence in the intergenic region between tRNA-Glu and YCLCdelta1. The following sequence was inserted after the TAAAATATTTCCTCTTTAGTACT ending at 82662:


2000-09-13 snR43 107612 107612 Insertion G
107595 107595 Deletion T
107522 107522 Insertion A
The systematic sequence was updated in the region encompassing feature snR43. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
              ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||
2000-09-13 YCRWdelta11 169686 169686 Substitution C T
169575 169575 Substitution T C
The systematic sequence was updated in the region encompassing feature YCRWdelta11. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCL022C, YCL024W 81861 81861 Insertion C
One sequence change was made in the systematic sequence in the region encompassing overlapping features YCL024W and YCL022C. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
2000-09-13 YCL019W, YCL020W 86316 86316 Substitution A T
86092 86093 Substitution CG GC
85235 85235 Substitution T A
Several sequence changes were made in the systematic sequence in the region encompassing overlapping features YCL019W and YCL020W. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||
             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
2000-09-13 YCL019W 89727 89727 Substitution G A
89452 89452 Deletion C
89442 89442 Insertion C
87159 87161 Deletion CGC
86598 86599 Substitution AT TA
Several sequence changes were made in the systematic sequence in the region encompassing feature YCL019W. Note that coordinates listed are chromosomal coordinates.
             |||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||
             ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCL018W 91985 91985 Substitution G C
91144 91144 Substitution T C
91106 91106 Substitution C T
Three single nucleotide sequence changes were made in the systematic sequence within ORF YCL018W. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
2000-09-13 YCL017C 94143 94143 Deletion A
94140 94141 Substitution AT TA
94104 94104 Deletion C
93964 93964 Insertion C
93438 93438 Substitution A G
A single nucleotide substitution was made in the systematic sequence within the ORF YCL017C. Several sequence changes were also made in the region upstream of YCL017C. Note that coordinates listed are chromosomal coordinates.

Within YCL017C

             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Upstream of YCL017C
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
             ||||||||||||| |||||||||||||||||||||||||||||||||||  | |||||||
2000-09-13 YCL016C 95200 95200 Deletion G
A sequence change was made in the systematic sequence in the region encompassing feature YCL016C, and the start of YCL016C was moved 213 nt upstream, extending the protein N-terminally by 71 amino acids. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
2000-09-13 YCL012W, YCL014W 100016 100016 Deletion C
99907 99907 Insertion C
97118 97118 Substitution C G
96751 96751 Substitution C A
Several sequence changes were made in the systematic sequence in the region encompassing feature YCL014W, resulting in the merge of ORF YCL012W into YCL014W. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
2000-09-13 YCL011C 101542 101542 Substitution A T
101506 101506 Insertion T
101485 101485 Insertion A
Several sequence changes were made in the systematic sequence in the region downstream of feature YCL011C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCL009C, YCL010C 104419 104419 Substitution T C
The systematic sequence was updated within ORF YCL009C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCL008C, YCL009C 105585 105585 Insertion T
The systematic sequence was updated in the intergenic region between features YCL009C and YCL008C. Note that coordinates listed are chromosomal coordinates. This change is the exact reciprocal of the sequence change made on 1998-02-26.
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
2000-09-13 YCL005W 108457 108457 Substitution G C
108385 108385 Deletion A
107780 107780 Insertion G
107769 107769 Insertion G
107767 107767 Insertion G
107745 107745 Insertion G
107739 107739 Deletion A
The systematic sequence was updated in the region encompassing feature YCL005W, and at the same time the stop site for YCL005W was moved 6 nucleotides downstream, increasing the length of the coding region from 765 to 771 nt. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||
              |||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
2000-09-13 YCL004W 110557 110557 Deletion A
110330 110331 Substitution GA AG
110286 110286 Insertion TCTAT
110100 110100 Insertion G
109996 109996 Deletion C
109930 109930 Deletion C
The systematic sequence was updated in the region encompassing feature YCL004W. Note that coordinates listed are chromosomal coordinates.
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
              |||||||     |||||||||||||||||||||||||||||||||||||||||||  |||
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
2000-09-13 YCL002C 111325 111325 Deletion C
The systematic sequence was updated in the region encompassing feature YCL002C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
2000-09-13 YCL001W-A, YCL001W-B 113232 113232 Insertion AG
The systematic sequence was updated in the region between YCL001W-A and YCL001W-B. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||
The systematic sequence was updated in the region encompassing ORF YCR061W. Note that coordinates listed below are chromosomal coordinates.
              ||||||||||||||||||||||||||||    ||  |   ||  ||  ||    ||||||
2000-09-13 YCR060W 223942 223942 Substitution C T
The systematic sequence was updated downstream of ORF YCR060W. Note that coordinates listed below are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
2000-09-13 YCR057C, YCR059C 222085 222085 Insertion T
The systematic sequence was updated in the region between features YCR057C and YCR059C. Note that coordinates listed are chromosomal coordinates.
2000-09-13 YCR054C, YCR057C 219173 219173 Substitution G A
The systematic sequence was updated in the region betweeen ORFs YCR054C and YCR057C. Note that coordinates listed below are chromosomal coordinates. Note also that this same change was made on 1997-07-27, but changed back to its original state on 1998-02-26, so that this current change restores one originally made on 1997-07-27.
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
2000-09-13 YCR079W 252912 252912 Insertion G
252844 252844 Insertion C
252813 252813 Insertion G
The systematic sequence was updated within ORF YCR079W, causing frameshifts leading to a C-terminally altered and extended protein from amino acid 415 onward. The annotated coding region has been extended from 1308 nt to 1329 nt. Note that coordinates listed below are chromosomal coordinates.
              |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||
A single nucleotide insertion has also been made immediately downstream of the newly-extended YCR079W coding region.
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR077C 250109 250111 Deletion AAG
249242 249242 Insertion T
249237 249237 Deletion G
The systematic sequence was updated within ORF YCR077C. As a result, the annotated stop site was moved 1 codon upstream, reducing the length of the coding region from 2394 nt to 2391 nt. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||
              |||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR073W-A, YCR075C 246726 246726 Insertion AT
The systematic sequence was updated in the region between ORFs YCR073W-A and YCR075C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
2000-09-13 YCR073W-A 246199 246199 Substitution T C
The systematic sequence was updated in the region encompassing ORF YCR073W-A. Note that coordinates listed below are chromosomal coordinates.
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR073C 241455 241455 Deletion G
The systematic sequence was updated within ORF YCR073C. As a result, YCR073C was extended at the 3' end, so that the coding region increased in length from 3945 nt to 3996 nt. Note that coordinates listed below are chromosomal coordinates.
2000-09-13 YCR071C, YCR072C 239746 239746 Substitution T C
239394 239394 Insertion C
The systematic sequence was updated in the region between ORFs YCR071C and YCR072C. Note that coordinates listed below are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
The systematic sequence was updated within ORF YCR072C. Note that coordinates listed below are chromosomal coordinates.
              ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
2000-09-13 YCR071C 238910 238910 Insertion A
The systematic sequence was updated within ORF YCR071C. One nucleotide was inserted causing a frameshift, leading to a C-terminally altered and elongated protein from amino acid 120 onward. The annotated coding region has been increased in length from 366 nt to 441 nt. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
2000-09-13 YCR068W 236904 236904 Insertion C
The systematic sequence was updated within ORF YCR068W. Due to the single nucleotide insertion and resulting frameshift, the annotated stop site of YCR068W was moved downstream, increasing the length of the coding region from 1290 nt to 1563 nt. This annotation change incorporates the area that some had originally referred to as YCR068W-A into YCR068W. ORF YCR068W-A was originally included in the annotation data collected by MIPS on behalf of the European Yeast Chromosome III Sequencing project (see GenBank accession X59720). However, YCR068W-A was never included in SGD as an independent ORF. Note that coordinates listed are chromosomal coordinates.
              ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR067C, YCR068W 235515 235515 Deletion T
235421 235421 Insertion C
The systematic sequence was updated in the region between ORFs YCR067C and YCR068W. Note that coordinates listed below are chromosomal coordinates.
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
2000-09-13 YCR065W 230014 230014 Deletion T
229749 229749 Deletion T
The systematic reference sequence of Chromosome III was updated in the region downstream of ORF YCR065W.
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR063W, YCR065W 227805 227805 Insertion C
The systematic sequence was updated in the region between ORFs YCR063W and YCR065W. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
2000-09-13 YCR065W 229501 229501 Deletion A
The systematic sequence was updated within ORF YCR065W. Note that coordinates listed below are chromosomal coordinates. As a result, the annotated stop site of YCR065W has been moved downstream, increasing the size of the coding region from 1599 nt to 1695 nt.
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
2000-09-13 TEL03L 838 838 Insertion AC
814 814 Insertion A
786 786 Insertion C
784 784 Insertion C
783 783 Insertion C
770 770 Insertion C
459 459 Substitution G C
Several sequence changes were made in the systematic sequence in the region encompassing TEL03L. Note that coordinates listed below are chromosomal coordinates.
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
             |||| | || |||||||||||||||||||||||||||| |||||||||||||||||||||
             |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 ARS310
166780 166780 Substitution A G
166754 166755 Deletion AG
166730 166730 Deletion A
The systematic sequence was updated in the region encompassing feature ARS310. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||| |||||||||||||||||||||||  |||||
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
2000-09-13 ARS306
74317 74317 Substitution G A
74306 74306 Substitution C G
74298 74298 Substitution A C
74045 74045 Substitution C T
73973 73973 Substitution C T
73948 73948 Deletion C
73729 73729 Insertion G
74173 74173 Substitution T C
Several sequence changes were made in the systematic sequence in the region upstream of ARS306. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
             |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
             ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
             |||||||| ||||||| |||||||||| ||||||||||||||||||||||||||||||||
2000-09-13 ARS306
74548 74548 Substitution C T
74476 74476 Substitution T C
Two sequence changes were made in the systematic sequence in the region encompassing feature ARS306. Note that coordinates listed are chromosomal coordinates.
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
2000-09-13 ARS305
39622 39622 Deletion G
39583 39583 Substitution G A
39528 39528 Substitution C T
39515 39516 Substitution AA TC
39500 39501 Substitution CC GA
39488 39488 Substitution G A
39302 39302 Substitution G T
39241 39241 Substitution C T
Several sequence changes were made in the systematic sequence in the region encompassing feature ARS305. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||| |||||||||||  ||||||||
             |||||  ||||||||||| |||||||||||||||||||||||||||||||||||||||||
             ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||
2000-09-13 ARS304 30504 30505 Substitution GT TG
A dinucleotide substitution was made in the systematic sequence in the region encompassing feature ARS304. The GT at 30504-5 was changed to TG. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||
2000-09-13 ARS300, YCL076W, YCLWTy5-1 1435 1435 Insertion C
A single nucleotide insertion was made in the systematic sequence in the region encompassing overlapping features ARS300, YCLWTy5-1, and YCL076W. A single C was inserted after the T at 1435. This change resulted in the predicted protein encoded by YCL076W being elongated at the N-terminal end by 51 amino acids. Note that coordinates listed are chromosomal coordinates.
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR037C, YCR038C 196266 196266 Substitution C T
196035 196035 Substitution C T
The systematic sequence was updated in the region between ORFs YCR037C and YCR038C. Coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
2000-09-13 YCR038C 198169 198169 Deletion T
197950 197950 Substitution G C
197810 197810 Substitution A G
197077 197077 Substitution G A
196838 196839 Substitution CA AC
The systematic sequence was updated within ORF YCR038C. In addition, the start codon has been shifted forward 312 nt, leading to an N-terminal extension of the protein by 104 aa. Note that coordinates listed below are chromosomal coordinates.
              |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
2000-09-13 YCR037C 195701 195701 Substitution G A
195060 195060 Substitution T C
The systematic sequence was updated within ORF YCR037C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR036W 192927 192927 Substitution T C
192557 192557 Substitution A G
192329 192329 Substitution T C
The systematic sequence was updated within ORF YCR036W. Coordinates listed are chromosomal coordinates.
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
2000-09-13 YCR035C, YCR036W 191836 191836 Substitution A C
191795 191795 Substitution G A
The systematic sequence was updated in the region between ORFs YCR035C and YCR036W. Note that coordinates listed are chromosomal coordinates.
              |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||
2000-09-13 YCR035C 191444 191444 Substitution A C
190661 190661 Substitution T C
The systematic sequence was updated within ORF YCR035C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR033W 186465 186465 Substitution T C
186429 186429 Substitution T A
186384 186384 Substitution A G
186341 186341 Substitution A G
186130 186130 Substitution A G
The systematic sequence was updated within ORF YCR033W. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR033W 187293 187293 Substitution C T
187147 187147 Substitution T C
186975 186975 Substitution A G
186931 186931 Substitution T C
186792 186792 Substitution G A
186661 186661 Substitution A G
186582 186582 Substitution A G
186541 186541 Substitution G A
186521 186521 Substitution C T
The systematic sequence was updated within ORF YCR033W. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
              |||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||
              |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR033W 187787 187787 Substitution G A
187781 187781 Substitution G C
187769 187769 Substitution C A
187754 187754 Substitution A G
187708 187708 Substitution A G
187683 187683 Substitution T C
187633 187633 Substitution A C
187515 187515 Substitution T G
187431 187431 Substitution G C
The systematic sequence was updated in the region encompassing ORF YCR033W. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
              | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
              || ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR032W 180194 180194 Substitution A G
179802 179802 Substitution C T
179509 179509 Substitution A G
179446 179446 Substitution G A
179030 179030 Substitution A G
178856 178856 Substitution A G
The systematic sequence was updated within ORF YCR032W. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
2000-09-13 YCR032W 181660 181660 Substitution G C
181383 181383 Substitution A C
181159 181159 Substitution A G
180414 180414 Substitution G A
180366 180366 Substitution C T
180312 180312 Substitution A G
180249 180249 Substitution C T
The systematic sequence was updated within ORF YCR032W. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR032W 183669 183669 Substitution T C
183603 183603 Substitution A C
182862 182862 Substitution C T
182364 182364 Substitution T C
182114 182114 Substitution T C
The systematic sequence was updated within ORF YCR032W. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
2000-09-13 YCR032W 184616 184616 Substitution G A
184599 184599 Substitution A G
184565 184565 Substitution C A
184290 184290 Substitution A G
184287 184287 Substitution G A
184197 184197 Substitution A G
184086 184086 Substitution T C
183870 183870 Substitution T C
The systematic sequence was updated within ORF YCR032W. Note that coordinates listed are chromosomal coordinates.
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
               || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
              |||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||
2000-09-13 YCR032W 178761 178761 Substitution C T
The systematic sequence was updated within ORF BPH1/YCR032W. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
2000-09-13 YCR032W 184966 184966 Substitution A T
184926 184926 Substitution A G
184835 184835 Substitution C T
184757 184757 Substitution G C
The systematic sequence was updated in the region between ORFs YCR032W and YCR033W. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
              |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR030C, YCR031C 176123 176123 Substitution A G
176049 176049 Substitution G A
176015 176015 Substitution C T
175724 175724 Insertion A
175572 175573 Substitution CG GC
The systematic sequence was updated in the region between features YCR030C and YCR031C. Coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
              |||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
2000-09-13 YCR031C 176781 176781 Substitution T A
176452 176452 Substitution T C
176423 176423 Substitution C T
The systematic sequence was updated within ORF YCR031C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
              ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
2000-09-13 YCR030C 174294 174294 Substitution C T
174084 174084 Substitution C T
The systematic sequence was updated within ORF YCR030C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
2000-09-13 YCR028C-A 171856 171856 Substitution T G
The systematic sequence was updated within ORF YCR028C-A. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
2000-09-13 YCR028C-A 172693 172693 Substitution G A
172674 172674 Deletion G
172671 172671 Insertion G
172578 172578 Substitution A G
172366 172366 Substitution A T
172290 172290 Substitution C T
172287 172287 Insertion T
172172 172172 Substitution A T
The systematic sequence was updated in the region upstream of feature YCR028C-A. Note that coordinates listed are chromosomal coordinates.
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
              ||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||
2000-09-13 YCR028C 171051 171051 Substitution T C
170931 170931 Substitution C G
170814 170814 Substitution T C
170811 170811 Substitution A G
170781 170781 Substitution G A
170309 170309 Substitution G A
170253 170253 Substitution A G
169896 169896 Substitution T G
The systematic sequence was updated within ORF YCR028C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
              |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
              |||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
171513 171513 Deletion T
171364 171364 Substitution C G
171315 171315 Substitution T C
The systematic sequence was updated in the region between features YCR028C and YCR028C-A. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||

New:   172962 ------------------------------------ 172962
2000-09-13 YCR027C 167958 167958 Substitution A G
167813 167813 Substitution G A
The systematic sequence was updated in the region upstream of feature YCR027C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
2000-09-13 YCR026C, YCR027C 166449 166449 Substitution C T
166424 166424 Substitution G A
166359 166359 Substitution G A
166292 166292 Substitution G A
166125 166125 Substitution A G
The systematic sequence was updated in the intergenic region between features YCR026C and YCR027C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||
2000-09-13 YCR027C 167438 167438 Substitution C T
The systematic sequence was updated within ORF YCR027C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR027C 168120 168120 Substitution A G
168108 168108 Substitution G A
168105 168105 Substitution A T
The systematic sequence was updated in the region between features YCR027C and YCR028CC. Note that coordinates listed are chromosomal coordinates.
Old:   168081 AGGACCAGGACTTCTTGTAG--------------------------------------- 168100
Old:   168101 -----------------------TATCAACGTTCTAGATACCAACATATCAATATAAAAAT 168138
                                     |||| || ||||||||||| ||||||||||||||||||
2000-09-13 YCR027C 168256 168256 Substitution C T
168225 168225 Substitution G A
168191 168191 Substitution G A
168152 168152 Substitution T A
The systematic sequence was updated in the region between features YCR027C and YCR028C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Old:   168201 AATGGGTGAATAATTTGAATGGTTGGAAAT------------------------------------- 168230
              |||||||||||||||||||||||| |||||
Old:   168231 ----------------------------------------------CTATTCTCGGTA 168242
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR025C, YCR026C 163801 163801 Substitution A G
The systematic sequence was updated in the intergenic region between features YCR025C and YCR026C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
2000-09-13 YCR026C 165146 165148 Deletion GTC
165115 165115 Substitution C A
164991 164991 Substitution A G
164308 164308 Substitution G A
163985 163985 Substitution G A
163957 163957 Substitution T G
The systematic sequence was updated within ORF YCR026C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||
              ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
              |||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR026C 165958 165958 Substitution G A
165731 165731 Substitution C T
165693 165693 Substitution G A
165417 165417 Substitution T C
165304 165304 Substitution T C
The systematic sequence was updated within ORF YCR026C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
              |||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||
              ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
2000-09-13 YCR025C 163524 163524 Substitution A G
163465 163465 Substitution G T
163407 163407 Substitution G T
The systematic sequence was updated within ORF YCR025C. Note that coordinates listed are chromosomal coordinates.
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR024C 161457 161457 Substitution T G
The systematic sequence was updated in the region encompassing feature YCR024C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
2000-09-13 YCR020W-B, YCR021C 155666 155668 Deletion TGA
155664 155664 Substitution A G
155675 155676 Deletion GT
The systematic sequence was updated in the intergenic region between features YCR020W-B and YCR021C. Note that coordinates listed are chromosomal coordinates.
              ||| |   ||||||  ||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR018C-A, YCR019W 152251 152251 Substitution G A
152172 152172 Substitution A G
151974 151974 Substitution C T
151794 151794 Insertion A
The systematic sequence was updated in the intergenic region between features YCR018C-A and YCR019W. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR017C, YCR018C 147840 147840 Substitution A C
147746 147746 Substitution C T
147587 147587 Substitution T C
The systematic sequence was updated in the intergenic region between features YCR017C and YCR018C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
2000-09-13 YCR018C 148295 148295 Substitution A T
148293 148293 Substitution A G
147977 147977 Substitution C T
147959 147959 Deletion A
The systematic sequence was updated within ORF YCR018C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||
              ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCR017C 147292 147292 Substitution G A
146654 146654 Substitution T C
146473 146473 Substitution A C
146354 146354 Substitution A G
146175 146175 Substitution G A
146125 146125 Substitution G A
The systematic sequence was updated within ORF YCR017C. Note that coordinates listed are chromosomal coordinates.
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
2000-09-13 YCR016W, YCR017C 144420 144420 Substitution G A
144253 144253 Substitution G A
The systematic sequence was updated in the intergenic region between features YCR016W and YCR017C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
2000-09-13 YCR017C 145975 145975 Substitution G A
145693 145693 Substitution A G
145440 145440 Substitution C T
145378 145378 Substitution T C
144760 144760 Substitution G A
144722 144722 Substitution T C
The systematic sequence was updated within ORF YCR017C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
2000-09-13 YCR016W 144137 144137 Substitution T C
143973 143973 Substitution G A
143830 143830 Substitution T C
143548 143548 Substitution A G
The systematic sequence was updated within ORF YCR016W. Note that coordinates listed are chromosomal coordinates.
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
2000-09-13 YCR014C, YCR015C 140692 140692 Substitution C T
140577 140577 Substitution C T
The systematic sequence was updated in the intergenic region between features YCR014C and YCR015C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
              ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
2000-09-13 YCR015C 141398 141398 Substitution A T
141089 141089 Substitution G A
The systematic sequence was updated in the region encompassing feature YCR015C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
2000-09-13 YCR014C 140388 140389 Substitution TA CC
140065 140065 Substitution C T
140029 140029 Substitution A G
140021 140021 Substitution T C
139720 139720 Substitution T C
139624 139624 Substitution A G
139180 139180 Substitution G C
139087 139087 Substitution G T
The systematic sequence was updated in the region encompassing feature YCR014C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||
2000-09-13 YCR012W 137641 137642 Substitution GC CG
The systematic sequence was updated within ORF YCR012W. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||
2000-09-13 YCR011C, YCR012W 136620 136620 Substitution C T
The systematic sequence was updated in the intergenic region between features YCR011C and YCR012W. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
2000-09-13 YCR011C 136388 136388 Substitution C T
136317 136317 Substitution C T
The systematic sequence was updated within ORF YCR011C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
2000-09-13 YCR010C 132954 132954 Insertion G
The systematic sequence was updated in the region upstream of ORF YCR010C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
2000-09-13 YCR005C 120772 120772 Substitution A G
The systematic sequence was updated within ORF YCR005C. The T at coding coordinate 1158 was changed to a C, resulting in a silent substitution within codon 386, which codes for threonine. Note that coordinates listed below are chromosomal coordinates, and the Watson strand is shown (YCR005C is a Crick strand ORF).
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
2000-09-13 YCLWdelta5 90740 90741 Substitution CG GC
A sequence change was made in the systematic sequence in the region encompassing feature YCLWdelta5. Note that coordinates listed are chromosomal coordinates.
             ||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13 YCLWdelta3 84337 84337 Insertion T
One sequence change was made in the systematic sequence in the region encompassing feature YCLWdelta3. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
2000-09-13 YCLWdelta2a 84108 84108 Substitution G A
One sequence change was made in the systematic sequence in the region encompassing feature YCLWdelta2a. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
2000-09-13 YCLCdelta1 83955 83955 Deletion C
83361 83361 Insertion GC
83354 83354 Insertion C
83352 83352 Substitution T A
83348 83348 Substitution T AA
83341 83341 Insertion T
83337 83337 Insertion T
83333 83333 Insertion T
83323 83323 Insertion A
83270 83271 Substitution GA AG
Several sequence changes were made in the systematic sequence in the region downstream of YCLCdelta1. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||
             |||||||||||||||||||||| |||||||||| |||| |||| ||||||  ||| || |
             ||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
             | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1998-02-26 YCL001W 112875 112875 Insertion C
112536 112536 Insertion CA
112535 112535 Insertion T
112504 112504 Insertion C
112498 112498 Insertion C
Five separate insertions were made in the systematic sequence in the region downstream of ORF YCL001W. Single C nucleotides were inserted after the Cs at chromosomal coordinates 112498, 112504, and 112875, a T was inserted after the T at 112535, and a CA was inserted after the C at 112536. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
              ||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
1998-02-26 YCL001W, YCL002C 111893 111893 Deletion T
111859 111859 Deletion C
111841 111842 Substitution TT G
Three separate sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL002C and YCL001W. The TT at chromosomal coordinate 111841 was changed to G, and the C at 111859 and the T at 111893 were removed. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
              |||||||||||||||||||  |||||||||||||||| ||||||||||||||||||||||
              ||||||||||| ||||||||||||||||||||||||||||
1998-02-26 YCR057C 221416 221416 Insertion G
220246 220246 Insertion T
The systematic reference sequence of Chromosome III was updated within ORF YCR057C: A single T was inserted after the T at chromosomal coordinate 220246, and a single G was inserted after the G at chromosomal coordinate 221416. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
1998-02-26 YCR057C 221662 221662 Insertion C
The systematic reference sequence of Chromosome III was updated in the region upstream of ORF YCR057C: A single C was inserted after the G at 221662. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
1998-02-26 YCR054C, YCR055C 219175 219175 Substitution A G
A single nucleotide substitution was made in the systematic sequence in the region between ORFs YCR054C and YCR055C. The A at chromosomal coordinate 219175 was changed to G. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
              |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
1998-02-26 YCR080W, YCR081W 253653 253653 Substitution G C
253512 253512 Deletion A
253495 253495 Deletion A
Two single nucleotide deletions were made in the systematic sequence within ORF YCR080W: The A at chromosomal coordinate 253495 was removed, as was the A at 253512.
              ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||

One single nucleotide substitution was made in the region between ORFs YCR080W and YCR081W: The G at 253653 was changed to C.

              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.

1998-02-26 YCR068W 237282 237282 Deletion C
One single nucleotide deletion was made in the systematic sequence in the region downstream of ORF YCR068W. The C at chromosomal coordinate 237282 was removed. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
1998-02-26 ARS307
109254 109254 Insertion A
108840 108840 Substitution C G
108792 108792 Deletion G
Three single nucleotide changes were made to the systematic sequence in the region encompassing ARS307. The G at chromosomal coordinate 108792 was deleted, the C at 108840 was changed to G, and an A was inserted after the T at 109254. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
1998-02-26 YCR028C-A 173209 173209 Insertion G
A single nucleotide insertion was made in the systematic sequence in the region encompassing ORF YCR028C-A. A single G was inserted after the G at chromosomal coordinate 173209. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
1998-02-26 YCR024C-A, YCR025C 163259 163259 Substitution G A
A single nucleotide substitution was made in the systematic sequence in the intergenic region between ORFs YCR024C-A and YCR025C. The G at chromosomal coordinate 163259 was changed to A. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
1998-02-26 YCR024C-A 163030 163030 Substitution A G
A single nucleotide substitution was made in the systematic sequence in the region encompassing ORF YCR024C-A. The A at chromosomal coordinate 163030 was changed to G. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
              |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
1998-02-26 YCL022C, YCL024W 81746 81746 Deletion C
81527 81527 Deletion C
Two separate single nucleotide deletions were made in the systematic sequence in the region encompassing overlapping ORFs YCL024W and YCL022C. A single C was deleted at chromosomal coordinate 81527, and another C was deleted at 81746. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
1998-02-26 YCL014W 100535 100535 Insertion G
100475 100475 Deletion G
100471 100471 Insertion G
98839 98839 Deletion A
Four separate single nucleotide sequence changes were made in the systematic sequence in the region encompassing ORF YCL014W. A single A was deleted at chromosomal coordinate 98839, as was the G at 100475, and a single G was inserted after the A at 100471, and also after the G at 100535. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
1998-02-26 YCL010C, YCL011C 103537 103537 Insertion G
103526 103526 Insertion C
103515 103515 Insertion T
103071 103071 Deletion T
Four single nucleotide changes were made in the systematic sequence in the intergenic region between ORFs YCL011C and YCL010C. A single T was deleted at chromosomal coordinate 103071, a single T was inserted after the T at chromosomal coordinate 103515, a C was inserted after the C at 103526, and a G was inserted after the G at 103537. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of some made on 1997-07-27, returning the systematic sequence to its original state in this region.
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||
1998-02-26 YCL010C 104254 104254 Substitution C G
One single nucleotide substitution was made in the systematic sequence in the region encompassing ORF YCL010C. The C at chromosomal coordinate 104254 was changed to G. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
1998-02-26 YCL008C, YCL009C 105580 105580 Deletion T
One single nucleotide was deleted in Chromosome III in the intergenic region between ORFs YCL009C and YCL008C to correct the systematic sequence. The T at chromosomal coordinate 105580 was removed.
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
1998-02-26 YCL008C 106429 106429 Insertion C
106402 106402 Deletion A
106343 106343 Insertion C
105981 105981 Substitution G C
105937 105938 Substitution CC G
Several sequence changes were made to the systematic sequence in the region encompassing ORF YCL008C. The CC at chromosomal coordinate 105937 was changed to a G, the G at 105981 was changed to C, a C was inserted after the C at 106343, the A at 106402 was deleted, and a C was inserted after the T at 106429. Note that while the coordinates may appear to be different, the first four of these five changes are exact reciprocals of changes made on 1997-07-27, returning the systematic sequence to its original state in these areas. The insertion of the C after the T at 106429 is a novel change.
              ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
1998-02-26 YCL005W 108615 108615 Substitution T C
One single nucleotide substitution was made to the systematic sequence in the region encompassing ORF YCL005W. The T at chromosomal coordinate 108615 was changed to C. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
1998-02-26 YCL002C 111511 111511 Deletion T
A single nucleotide deletion was made in the systematic sequence in the region encompassing ORF YCL002C. The T at chromosomal coordinate 111511 was removed. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
1998-02-26 YCL001W 112074 112074 Deletion C
112025 112025 Deletion G
111987 111987 Deletion T
111983 111983 Deletion T
111978 111978 Deletion T
111975 111975 Deletion T
111971 111971 Deletion T
111967 111967 Deletion T
111963 111963 Deletion T
111956 111956 Substitution T G
111950 111950 Deletion T
111939 111940 Substitution AG GA
111924 111924 Substitution G C
Thirteen separate sequence changes were made in the systematic sequence in the region encompassing ORF YCL001W. The G at chromosomal coordinate 111924 was changed to C, the AG at 111939 was changed to GA, the T at 111956 was changed to G, and the following single nucleotides were deleted: the Ts at 111950, 111963, 111967, 111971, 111975, 111978, 111983, and 111987, the G at 112025, and the C at 112074. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
              |||||||||||||||||||||||||||||| ||||||||||||||  |
              |||||||| ||||| |||||| ||| ||| ||| || |||| ||| ||||||||||||||
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
1998-02-26 YCL073C 6718 6718 Substitution A G
6608 6608 Substitution A G
7100 7100 Substitution C T
7016 7016 Substitution G A
6921 6921 Substitution A G
6884 6884 Substitution T C
6872 6872 Substitution C T
6738 6738 Substitution T C
Eight separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL073C. Note that these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
           ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
1998-02-26 YCL063W 17831 17831 Insertion C
17606 17606 Insertion C
Two separate single nucleotide insertions were made in the systematic sequence in the region encompassing ORF YCL063W. Note that these sequence changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
1998-02-26 YCL061C 21562 21562 Insertion C
20421 20421 Deletion T
20326 20326 Deletion T
19507 19507 Deletion G
19500 19500 Deletion G
19494 19494 Deletion G
19443 19443 Insertion T
Seven separate single nucleotide sequence changes were made in the systematic sequence in the region encompassing ORF YCL061C. A single T was inserted after the G at chromosomal coordinate 19443, single G nucleotides were deleted at 19494, 19500, and 19507, single T nucleotides were deleted at 20326 and 20421, and a C was inserted after the C at 21562. Note that while some coordinates appear to be slightly different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
             ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||
             || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
1998-02-26 YCL054W 33687 33687 Insertion A
33665 33665 Insertion G
33604 33604 Insertion A
Three separate single nucleotide insertions were made in the systematic sequence in the region encompassing ORF YCL054W. A single A was inserted after the A at chromosomal coordinate 33604, a single G was inserted after the T at 33665, and an A was inserted after the A at 33687. Note that while some coordinates may appear to be slightly different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
             |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||
1998-02-26 YCL039W, YCL040W 52593 52593 Insertion G
52583 52584 Substitution GC CT
52580 52580 Substitution G A
52566 52566 Substitution C G
52562 52563 Substitution CC TGG
52435 52435 Substitution T C
Five separate substitutions and one single nucleotide insertion were made in the systematic sequence in the intergenic region between ORFs YCL040W and YCL039W. The T at chromosomal coordinate 52435 was changed to C, the CC at 52562 was changed to TGG, the C at 52566 was changed to G, the G at 52580 was changed to A, the GC at 52583 was changed to CT, and a G was inserted after the G at 52593. Note that these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
             ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
             ||||||||   || ||||||||||||| ||  ||||||||| ||||||||||||||||||
1998-02-26 YCL034W 62135 62135 Insertion G
62133 62133 Insertion G
Two separate single nucleotide insertions were made in the systematic sequence in the region encompassing ORF YCL034W. A single G nucleotide was inserted after the G at chromosomal coordinate 62133, and another G was inserted after the G at 62135. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
             |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
1997-07-27 ARS307
108844 108844 Substitution G C
108796 108796 Insertion G
109259 109259 Deletion A
Three sequence changes were made to Chromosome III within ARS307 to correct the systematic reference sequence: A single G was inserted after chromosomal coordinate 108796, the G at 108844 was changed to a C, and the A at 109259 was deleted.
              |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
1997-07-27 YCR028C-A 173207 173207 Deletion G
A single nucleotide deletion was made in Chromosome III within the ORF YCR028C-A to correct the systematic reference sequence: The G at chromosomal coordinate 173207 was removed.
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
1997-07-27 YCR024C-A, YCR025C 163256 163256 Substitution A G
A single nucleotide substitution was made in Chromosome III within the intergenic region between ORFs YCR024C-A and YCR025C to correct the systematic reference sequence: The A at chromosomal coordinate 163256 was changed to G.
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
1997-07-27 YCR024C-A 163027 163027 Substitution G A
A single nucleotide substitution was made in Chromosome III within the ORF YCR024C-A to correct the systematic reference sequence: The G at chromosomal coordinate 163027 was changed to A.
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
1997-07-27 YCL022C, YCL024W 81750 81750 Insertion C
81532 81532 Insertion C
Two single nucleotide insertions were made within the ORF YCL024W to correct the systematic reference sequence: A C was inserted after chromosomal coordinate 81532, and also after 81750. Note that the change at 81750 is also within overlapping ORF YCL022C.
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
1997-07-27 YCL014W 100539 100539 Deletion G
100478 100478 Insertion G
100475 100475 Deletion G
98842 98842 Insertion A
Two single nucleotide deletions and two single nucleotide insertions were made within the ORF YCL014W to correct the systematic reference sequence: The G at chromosomal coordinate 100475 was removed, as was the G at 100539, a single A was inserted after chromosomal coordinate 98842, and a single G was inserted after chromosomal coordinate 100478.
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
1997-07-27 YCL010C, YCL011C 103543 103543 Deletion G
103531 103531 Deletion C
103519 103519 Deletion T
103074 103074 Insertion T
Four single nucleotide changes were made within the intergenic region between ORFs YCL011C and YCL010C to correct the systematic reference sequence: A T was inserted after chromosomal coordinate 103074, the T at chromosomal coordinate 103519 was removed, as was the C at 103531, and the G at 103543.
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||
1997-07-27 YCL009C 104260 104260 Substitution G C
A single nucleotide substitution was made in Chromosome III within the ORF YCL009C to correct the systematic reference sequence: The G at 104260 was changed to a C.
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
1997-07-27 YCL008C 106435 106435 Substitution C G
106407 106407 Insertion A
106349 106349 Deletion C
105986 105986 Substitution C G
105943 105943 Substitution G CC
Three nucleotide substitutions, one single nucleotide deletion, and one single nucleotide insertion were made in Chromosome III within the ORF YCL008C to correct the systematic reference sequence: The G at 105943 was changed to CC, the Cs at 105986 and 106435 were changed to Gs, the C at 106349 was deleted, and an A was inserted after chromosomal coordinate 106407.
              ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
1997-07-27 YCL005W 108620 108620 Substitution C T
A single nucleotide substitution was made in Chromosome III within the ORF YCL005W to correct the systematic reference sequence: The C at 108620 was changed to a T.
              ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
1997-07-27 YCL002C 111515 111515 Insertion T
A single sequence change was made in Chromosome III within the ORF YCL002C to correct the systematic reference sequence: A single T was inserted after chromosomal coordinate 111515.
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
1997-07-27 YCL073C 7100 7100 Substitution T C
7016 7016 Substitution A G
6921 6921 Substitution G A
6884 6884 Substitution C T
6872 6872 Substitution T C
6738 6738 Substitution C T
6718 6718 Substitution G A
6608 6608 Substitution G A
The following nucleotide substitutions were made within the ORF YCL073C to correct the systematic reference sequence: G to A at chromosomal coordinate 6608, G to A at 6718, C to T at 6738, T to C at 6872, C to T at 6884, G to A at 6921, A to G at 7016, T to C at 7100.
             ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
             ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
1997-07-27 YCL063W 17833 17833 Deletion C
17607 17607 Deletion C
Two single nucleotide deletions were made within the ORF YCL063W to correct the systematic reference sequence: The C at chromosomal coordinate 17607 was removed, as was the C at 17833.
             |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
             |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
1997-07-27 YCL061C 21561 21561 Deletion C
20419 20419 Insertion T
20325 20325 Insertion T
19507 19507 Insertion G
19501 19501 Insertion G
19496 19496 Insertion G
19446 19446 Deletion T
Two single nucleotide deletions and five single nucleotide insertions were made within the ORF YCL061C to correct the systematic reference sequence: The T at chromosomal coordinate 19446 was removed, as was the C at 21561, single Gs were inserted after chromosomal coordinates 19496, 19501, and 19507, and single Ts were inserted after chromosomal coordinates 20325 and 20419.
             ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||
             || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
1997-07-27 YCL054W 33689 33689 Deletion A
33666 33666 Deletion G
33604 33604 Deletion A
Three single nucleotide deletions were made within the ORF YCL054W to correct the systematic reference sequence: The A at chromosomal coordinate 33604 was removed, as was the G at 33666, and the A at 33689.
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
             |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||
1997-07-27 YCL039W, YCL040W 52597 52597 Deletion G
52586 52587 Substitution CT GC
52583 52583 Substitution A G
52569 52569 Substitution G C
52564 52566 Substitution TGG CC
52537 52537 Substitution C T
Several changes were made within the intergenic region between ORFs YCL040W and YCL039W to correct the systematic reference sequence:
             ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
             ||||||||   || ||||||||||||| ||  ||||||||| ||||||||||||||||||
1997-07-27 YCL034W 62141 62141 Deletion G
62138 62138 Deletion G
Two single nucleotide deletions were made within the ORF YCL034W to correct the systematic reference sequence: the G at chromosomal coordinate 62138 and the G at 62141 were removed.
             |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
1997-07-27 YCL001W 112065 112065 Insertion C
112017 112017 Insertion G
111980 111980 Insertion T
111977 111977 Insertion T
111973 111973 Insertion T
111971 111971 Insertion T
111968 111968 Insertion T
111962 111962 Insertion T
111956 111956 Substitution G T
111950 111950 Insertion T
111940 111941 Substitution GA AG
111925 111925 Substitution C G
111965 111965 Insertion T
Thirteen sequence changes were made in Chromosome III within the ORF YCL001W to correct the systematic reference sequence: The C at chromosomal coordinate 111925 was changed to G, the GA at 111940-1 was changed to AG, the G at 111956 was changed to T, a single G was inserted after the A at 112017, a single C was inserted after the A at 112065, and single Ts were inserted after chromosomal coordinates 111950, 111962, 111965, 111968, 111971, 111973, 111977, and 111980.
              ||||||||||||||||||||| ||||||||||||||  ||
              ||||||| ||||| |||||| ||| ||| ||| || |||| ||| |||||||||||||||
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
1997-07-27 YCL001W 112872 112872 Deletion C
112531 112532 Deletion CA
112529 112529 Deletion T
112497 112497 Deletion C
112490 112490 Deletion C
Five deletions were made in Chromosome III in the region downstream of ORF YCL001W to correct the systematic reference sequence: The Cs at chromosomal coordinates 112490, 112497, and 112872 were deleted, as was the T at 112529, and the CA at 112531-2.
              |||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |  |
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
1997-07-27 YCR057C 221663 221663 Deletion C
The systematic reference sequence of Chromosome III was updated upstream of ORF YCR057C: The C at chromosomal coordinate 221663 was removed.
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
1997-07-27 YCR057C 221416 221416 Deletion G
220245 220245 Deletion T
The systematic reference sequence of Chromosome III was updated within ORF YCR057C: The T at chromosomal coordinate 220245 was removed, and the G at chromosomal coordinate 221416 was removed.
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
1997-07-27 YCR054C, YCR055C 219173 219173 Substitution G A
A single nucleotide substitution was made in Chromosome III between ORFs YCR054C and YCR055C to correct the systematic reference sequence: The G at chromosomal coordinate 219173 was changed to A.
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
1997-07-27 YCR080W, YCR081W 253651 253651 Substitution C G
253510 253510 Insertion A
253494 253494 Insertion A
Two single nucleotide insertions were made in Chromosome III within the ORF YCR080W to correct the systematic reference sequence: An A was inserted after the G at chromosomal coordinate 253494, and another A was inserted after the G at 253510.
              |||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||
One single nucleotide substitution was made in the region between ORFs YCR080W and YCR081W: the C at 253651 was changed to G.
1997-07-27 YCR068W 237282 237282 Insertion C
One single nucleotide insertion was made in Chromosome III downstream of ORF YCR068W to correct the systematic reference sequence: A single C was inserted after the G at chromosomal coordinate 237282.
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||

Annotation Changes without sequence changes

Date Affected Features
2014-11-18 ARS314, ARS315, ARS316

As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome III based on Liachko et al. 2013: ARS314, ARS315, ARS316.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704.
SGD paper | PubMed | Full-Text

2014-11-18 ARS300, ARS305, ARS307, ARS309, ARS313, ARS314, ARS317, ARS318, ARS319

The chromosomal coordinates of the following ARS elements on Chromosome III were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS300, ARS305, ARS307, ARS309, ARS313, ARS314, ARS317, ARS318, ARS319.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704.
SGD paper | PubMed | Full-Text

2014-11-18 YCL054W-A

RDT1/YCL054W-A was added to the genome annotation based on Wilson and Masel 2011 as part of SGD's genome annotation revision R64.2.

Wilson BA and Masel J (2011) Putatively noncoding transcripts show extensive association with ribosomes. Genome Biol Evol 3():1245-52
SGD paper | PubMed | Full-Text

2009-02-19 ARS318

The position of the annotated ACS within ARS318 was updated based on Chang et al. 2008.

Chang F, et al. (2008) Analysis of chromosome III replicators reveals an unusual structure for the ARS318 silencer origin and a conserved WTW sequence within the origin recognition complex binding site. Mol Cell Biol 28(16):5071-81
SGD paper | PubMed | Full-Text

2008-06-04 YCLWdelta15

Carol Newlon identified an additional delta element on Chromosome III. This delta element is present in the current Chromosome III sequence, but was not in Newlon's clone A5C, which was used to generate the original Chromosome III sequence. The new delta element is being named YCLWdelta15, and is between tE(UUC)C and YCLCdelta1.
Newlon C (2008)
SGD paper

2008-03-05 YCRCtau1

YCRCtau1 was erroneously annotated on the Watson strand instead of the Crick strand. This error has been corrected. Thank you to Douda Bensasson from bringing this mistake to our attention.
Bensasson D (2008)
SGD papers

2007-12-14 HML, HMR, MATALPHA

The W, X, Y, Z1 and Z2 regions of the mating-type loci (HML, MAT, and HMR cassettes) were annotated based on Abraham et al. 1984, Astell et al. 1981, Tatchell et al. 1981, and Wang et al. 2001.

Astell CR, et al. (1981) The sequence of the DNAs coding for the mating-type loci of Saccharomyces cerevisiae. Cell 27(1 Pt 2):15-23 SGD paper | PubMed | Full-Text
Abraham J, et al. (1984) Regulation of mating-type information in yeast. Negative control requiring sequences both 5' and 3' to the regulated region. J Mol Biol 176(3):307-31 SGD paper | PubMed | Full-Text
Tatchell K, et al. (1981) In vitro mutation analysis of the mating-type locus in yeast. Cell 27(1 Pt 2):25-35 SGD paper | PubMed | Full-Text
Wang Y, et al. (2001) DNA replication forks pause at silent origins near the HML locus in budding yeast. Mol Cell Biol 21(15):4938-48 SGD paper | PubMed | Full-Text

2007-09-06 YCR092C

Based on experimental evidence published by Harrington and Kolodner, the start site for MSH3/YCR092C was moved 84 nt (28 codons) downstream. This change is consistent with that predicted by Kellis et al. 2003.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Harrington JM and Kolodner RD (2007) Saccharomyces cerevisiae Msh2-Msh3 acts in repair of base-base mispairs. Mol Cell Biol 27(18):6546-54
SGD paper | PubMed | Full-Text

2007-04-02 YCLCdelta1, YCRCdelta14, YCRCdelta6, YCRCdelta7

The following LTRs on Chromosome III were mistakenly annotated in the wrong direction (i.e., on the Watson strand instead of Crick), and the error has now been corrected: YCLCdelta1, YCRCdelta6, YCRCdelta7, YCRCdelta14. Thanks go to Marc Gartenberg for bringing this annotation error to our attention.

2007-03-06 ARS317

The ACS annotation was added based on Xu et al. 2006 and Brand et al. 1987.

Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276
SGD paper | PubMed | Full-Text
Brand AH, et al. (1987) A yeast silencer contains sequences that can promote autonomous plasmid replication and transcriptional activation. Cell 51(5):709-19
SGD Paper | PubMed | Full-Text

2006-09-06 ARS313, ARS314, ARS315, ARS316

The coordinates of the following ARS elements on Chromosome III were updated based on Nieduszynski et al. 2006: ARS313, ARS314, ARS315, ARS316.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD papers | PubMed Entry | Full-Text | Web Supplement

2006-01-11 YCL058W-A

YCL058W-A was originally added per Brachat et al., based on conservation with Ashbya gossypii. Kellis et al. also predicted a protein in the same frame, but with a 19 amino acid N-terminal deletion relative to the ORF predicted by Brachat et al. SGD has changed the annotation to that predicted by Kellis et al., based on conservation of that start site in sensu stricto strains of Saccharomyces.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text

2005-11-14 YCL048W-A

Based on genome sequence comparisons among six Saccharomyces species, Cliften et al. 2003 suggested that a new ORF, YCL048W-A, be added to the S. cerevisiae genome annotation. This suggestion was later confirmed by Zhang and Dietrich 2005 using high-throughput identification of transcription start sites.

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement
Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51.
SGD paper | PubMed | Full-Text | YFGdb

2004-10-12 CEN3

Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60
SGD paper | PubMed Full-Text
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
SGD paper | PubMed Full-Text

2004-08-27 YCR095W-A

The ORF YCR095W-A was added per Oshiro et al. 2002.

Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20.
SGD paper | PubMed | Full-Text | Web Supplement | YFGdb

2003-09-27 YCL002C

Based on the alignment of orthologs in related Saccharomyces species, Cliften et al. proposed an intron and new 5' exon for YCL002C. The resulting ORF is in the same frame, but has a 99-residue extension at the N-terminus.
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YCL037C

Based on the automated comparison of closely-related Saccharomyces species in Kellis et al. 2003, the start site for SRO9/YCL037C was moved 96 nt (32 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-09 TEL03L, TEL03R

The chromosomal locations for the following telomeric features were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL03L, TEL03L-XC, TEL03L-XR, TEL03L-TR, TEL03R, TEL03R-XC, TEL03R-XR, TEL03R-TR.

2003-07-29 YCR108C

Thanks to Kessler et al. for providing the coordinates of ORF YCR108C.

Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71.
SGD paper | PubMed | Full-Text

2003-07-29 YCR045W-A, YCR047W-A, YCR081C-A

Thanks to Kumar et al. for providing the coordinates of the following ORFs on Chromosome III: YCR045W-A, YCR047W-A, YCR081C-A.

Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63.
SGD paper | PubMed | Full-Text | YFGdb | Comments & Errata

2003-07-29 YCL005W-A, YCL058W-A, YCR075W-A

Thanks to Brachat et al. 2003 for providing the coordinates of the following ORFs on Chromosome III: YCL005W-A, YCL058W-A, YCR075W-A.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text

2000-12-01 YCL024W

The stop site of ORF YCL024W was moved 366 nt downstream, changing the relative coding coordinates from 1-2748 to 1-3114. Chromosomal coordinates change from 79125-81872 to 79161-82274.

2000-12-01 YCL010C

The stop site of YCL010C was moved 339 nt upstream, increasing the size of the coding region from 441 nt to 780 nt. The chromosomal coordinates have changed from 103995-103515 to 104345-103566.

2000-12-01 YCL008C

The start site of YCL008C was moved 252 nt upstream, and the stop site was moved 179 nt downstream, increasing the size of the coding region from 360 nt to 891 nt. The chromosomal coordinates have changed from 106208-105849 to 106849-105959.

2000-10-13 YCR103C

YCR103C was originally annotated as an ORF, but upon further review was removed from the genome annotation.

2000-09-14 YCR061W, YCR062W

After resequencing and annotation of Chromosome III, ORF YCR062W has been merged into neighboring ORF YCR061W. The coding region of YCR061W had been 1752 nt long, but is now 1896 nt in length.

2000-09-14 YCL021W-A, YCL026C-B, YCL057C-A

The following ORFs were added after the MIPS ChrIII sequence update: YCL021W-A, YCL026C-B, YCL057C-A.

2000-09-13 YCRCdelta7

YCRCdelta7 was shortened from 380 bp to 323 bp, a net decrease of 57 bp.

2000-09-13 YCL025C

The stop site of ORF YCL025C was moved 114 nt upstream, changing the relative coding coordinates from 1-1902 to 1-1788. Chromosomal coordinates change from 77886-75985 to 77918-76131.

2000-08-16 YCL006C

YCL006C was deleted as a result of a sequence change that created a stop codon after residue 23.

2000-08-11 YCR069W

Old name: YCR070W; new name: YCR069W; date: 2/15/2000; old coord: ChrIII; SGDID: Unknown; YCR070W incorporated into YCR069W

2000-02-10 YCL003W, YCL004W

YCL003W was originally annotated as an independent ORF, but as a result of a sequence change, it was merged with an adjacent ORF into a single reading frame, designated YCL004W. YCL004W + YCL003W = YCL004W from MIPS.

1999-07-17 YCL054W

The stop site of ORF YCL054W was moved 351 nucleotides downstream, increasing the length of the coding sequence from 2175 nt to 2526 nt.

1999-07-17 YCL012W

The stop site of ORF YCL012W was moved 137 nt downstream, lengthening the coding region from 459 nt to 696 nt. Chromosomal coordinates change from 100110-100568 to 100113-100808.

1999-07-17 YCL053C

ORF YCL053C has been deleted due to a sequence correction.

1999-07-17 YCL021W

ORF YCL021W was deleted as a result of corrections to the systematic sequence.

1999-07-17 YCL013W

The ORF YCL013W has been deleted as a result of updates to the systematic sequence.

1999-07-17 YCL039W

The start site of ORF YCL039W was moved 42 nucleotides downstream, reducing the length of the coding sequence from 2280 nt to 2238 nt.

1999-07-17 YCL024W

The stop site of ORF YCL024W was moved 297 nt downstream, changing the relative coding coordinates from 1-2451 to 1-2748. Chromosomal coordinates change from 79119-81569 to 79125-81872.

1998-12-21 YCL026C

ORF YCL026C was deleted due to a sequence correction.

1998-07-24 YCR055C, YCR057C, YCR058C

ORFs YCR055C and YCR058C were merged with existing ORF YCR057C. The coding region of YCR057C had been 1320 nt long, but is now 2772 nt in length.

1998-07-24 YCR029C

ORF YCR029C has been deleted from the genome annotation due to sequence correction.

1998-07-24 YCL062W, YCL063W

Due to several sequence changes in the region encompassing ORFs YCL062W and YCL063W, YCL062W has been merged into adjacent ORF YCL063W. The coding region of YCL063W had been 387 nt long, and is now 1272 nt in length.

1998-07-24 YCR029C-A, YCR030C

ORF YCR029C-A has been merged into neighboring ORF YCR030C. The coding region YCR030C had been annotated as 1974 nt long, but is now 2613 nt in length.

1998-07-24 YCR080W, YCR081W

YCR080W was originally annotated as an independent ORF, but upon further review was merged with neighboring ORF YCR081W. As a result, the annotated start site of YCR081W was moved 603 nt upstream, increasing the coding region of YCR081W in length from 3681 nt to 4284 nt.

1998-07-24 YCR074C

YCR074C was originally annotated as an ORF, but upon further review was removed from the genome annotation.

1998-07-24 YCR056W

ORF YCR056W was deleted from the genome annotation due to sequence correction.

1998-07-24 YCL060C, YCL061C

Due to several sequence changes in the region encompassing ORFs YCL060C and YCL061C, YCL060C has been merged into adjacent ORF YCL061C.

1998-07-24 YCR070W

ORF YCR070W has been deleted from the genome annotation.


The following putative ORFs were originally included in the annotation of Chromosome III, but were later withdrawn: YCLX01W, YCLX02C, YCLX03C, YCLX04W, YCLX05C, YCLX06C, YCLX07W, YCLX09W, YCLX10C, YCLX11W, YCLX12W, YCRX01W, YCRX02C, YCRX03C, YCRX04W, YCRX05W, YCRX06W, YCRX07W, YCRX08W, YCRX09C, YCRX10W, YCRX11W, YCRX12W, YCRX14W, YCRX15W, YCRX16C, YCRX17W, YCRX18C, YCRX19W, YCRX20C, and YCRX21C. SGD (1998) Putative ORF Annotations on Chromosome III SGD paper

1998-05-21 YCL001W

The start site of ORF YCL001W was moved 159 nt downstream.

1998-05-21 YCR018C-A, YCR102W-A

The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A.

The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.
Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51.
SGD paper | PubMed | Full-Text | YFGdb

1997-07-26 YCR097W-A, YCR097WA

The original YCR097W-A ORF (SGDID: S0000693) was deleted because: HMRA1/YCR097W contains two introns and the 3 intron is spliced less efficiently but probably does NOT create an alternative form of the protein. Because there is no evidence for a functional protein at the original YCR097W-A coordinates, this ORF was deleted. Note that a new ORF with the same name (YCR097W-A, SGDID: S0007632) has been added because of homology to a hemiascomycetous yeast protein, but that these two ORFs (the original vs the new YCR097W-A) are completely different, except that they have the same name.