Chromosome VI History
This page lists all sequence and annotation changes that have been made to the Chromosome VI systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome VI has been updated 36 times, affecting 43 features.
- The annotation of Chromosome VI has been updated 24 times, affecting 39 features.
- Current and past versions can be obtained from SGD's Download site.
Contents
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YFL034W | 66443 | 66443 | Substitution | C | A |
Nucleotide change(s) in the coding region of YFL034W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 323 is now Lysine rather than Asparagine.
New 66421 TATTGACATTAAATCCCACAAGAAACTAGCACATAGATTACAGTTTACCCAGAAGGATAT 66480 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Old 66419 TATTGACATTAAATCCCACAAGAACCTAGCACATAGATTACAGTTTACCCAGAAGGATAT 66478 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFR040W | 236216 | 236216 | Substitution | C | A |
Nucleotide change(s) in the coding region of SAP155/YFR040W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 663 is now Asparagine rather than Threonine.
New 236219 ATGAAGCAAAACATAAAACTTAGGACCGACCCCACGGTCGGGGACCTATTCAAAATCAAA 236278 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 236206 ATGAAGCAAACCATAAAACTTAGGACCGACCCCACGGTCGGGGACCTATTCAAAATCAAA 236265 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFR019W | 191312 | 191312 | Substitution | T | A |
Nucleotide change(s) in the coding region of FAB1/YFR019W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 2275 is now Arginine rather than Tryptophan.
New 191280 AAGCAATGGAGAGGTATATTTTGATGGTTCCTGATCCGTGGTATAGGGAAGGAAATTAAT 191339 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 191268 AAGCAATGGAGAGGTATATTTTGATGGTTCCTGATCCGTGGTATTGGGAAGGAAATTAAT 191327 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFL026W | 83382 | 83382 | Substitution | G | A |
Nucleotide change(s) in the coding region of STE2/YFL026W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 269 is now Lysine rather than Glutamic Acid.
New 83341 TTTGTTGGTTCCATCGATAATATTCATCCTCGCATACAGTTTGAAACCAAACCAGGGAAC 83400 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 83339 TTTGTTGGTTCCATCGATAATATTCATCCTCGCATACAGTTTGGAACCAAACCAGGGAAC 83398 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFR020W, YFRCdelta9 |
192393 | 192393 | Deletion | C | |
A single nucleotide deletion was made in the intergenic region between Ty1 LTR YFRCdelta9 and ORF YFR020W.
New 192360 TTTTAGGAATACTGTTGTTCAAGATAGAGCATTTGCATACCTTAT-CGAGGTTCACTATC 192418 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 192348 TTTTAGGAATACTGTTGTTCAAGATAGAGCATTTGCATACCTTATCCGAGGTTCACTATC 192407 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFR020W, YFRCdelta9 |
192393 | 192393 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs YFR020W and ATG18/YFR021W.
New 194759 GTTAGTAATAGTGTTCCAGTTAACTCTGTATCCTTTTCTTCTTCGGCCTGACAATGTCTG 194818 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Old 194748 GTTAGTAATAGTGTTCCAGTTAACTCTGTATCCTTTTC-TCTTCGGCCTGACAATGTCTG 194806 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. |