Chromosome VI History

This page lists all sequence and annotation changes that have been made to the Chromosome VI systematic reference sequence since its intial release on 1996-07-31.

• The sequence of Chromosome VI has been updated 36 times, affecting 43 features.
  
• The annotation of Chromosome VI has been updated 24 times, affecting 39 features.
  
• Current and past versions can be obtained from SGD's Download site.

Sequence Changes

Date	Affected Features	Start Coordinate of Change	End Coordinate of Change	Type of Change	Old Sequence	New Sequence
2011-02-03	YFL034W	66443	66443	Substitution	C	A
	Nucleotide change(s) in the coding region of YFL034W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 323 is now Lysine rather than Asparagine. New 66421 TATTGACATTAAATCCCACAAGAAACTAGCACATAGATTACAGTTTACCCAGAAGGATAT 66480 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Old 66419 TATTGACATTAAATCCCACAAGAACCTAGCACATAGATTACAGTTTACCCAGAAGGATAT 66478 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFR040W	236216	236216	Substitution	C	A
	Nucleotide change(s) in the coding region of SAP155/YFR040W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 663 is now Asparagine rather than Threonine. New 236219 ATGAAGCAAAACATAAAACTTAGGACCGACCCCACGGTCGGGGACCTATTCAAAATCAAA 236278 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 236206 ATGAAGCAAACCATAAAACTTAGGACCGACCCCACGGTCGGGGACCTATTCAAAATCAAA 236265 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFR019W	191312	191312	Substitution	T	A
	Nucleotide change(s) in the coding region of FAB1/YFR019W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 2275 is now Arginine rather than Tryptophan. New 191280 AAGCAATGGAGAGGTATATTTTGATGGTTCCTGATCCGTGGTATAGGGAAGGAAATTAAT 191339 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 191268 AAGCAATGGAGAGGTATATTTTGATGGTTCCTGATCCGTGGTATTGGGAAGGAAATTAAT 191327 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFL026W	83382	83382	Substitution	G	A
	Nucleotide change(s) in the coding region of STE2/YFL026W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 269 is now Lysine rather than Glutamic Acid. New 83341 TTTGTTGGTTCCATCGATAATATTCATCCTCGCATACAGTTTGAAACCAAACCAGGGAAC 83400 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 83339 TTTGTTGGTTCCATCGATAATATTCATCCTCGCATACAGTTTGGAACCAAACCAGGGAAC 83398 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFR020W, YFRCdelta9	192393	192393	Deletion	C
	A single nucleotide deletion was made in the intergenic region between Ty1 LTR YFRCdelta9 and ORF YFR020W. New 192360 TTTTAGGAATACTGTTGTTCAAGATAGAGCATTTGCATACCTTAT-CGAGGTTCACTATC 192418 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 192348 TTTTAGGAATACTGTTGTTCAAGATAGAGCATTTGCATACCTTATCCGAGGTTCACTATC 192407 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFR020W, YFR021W	192393	192393	Insertion		T
	A single nucleotide insertion was made in the intergenic region between ORFs YFR020W and ATG18/YFR021W. New 194759 GTTAGTAATAGTGTTCCAGTTAACTCTGTATCCTTTTCTTCTTCGGCCTGACAATGTCTG 194818 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Old 194748 GTTAGTAATAGTGTTCCAGTTAACTCTGTATCCTTTTC-TCTTCGGCCTGACAATGTCTG 194806 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFR019W, tS(GCU)F	191388	191388	Substitution	G	T
	A single nucleotide substitution was made within the intergenic region between ORF FAB1/YFR019W and tRNA tS(GCU)F. New 191390 CGCACATTAGTGTTCTTTAACTTTCAGTACCTTAGTAGTTATCAACTATGAAAAGGTGGT 191449 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 191378 CGCACATTAGGGTTCTTTAACTTTCAGTACCTTAGTAGTTATCAACTATGAAAAGGTGGT 191437 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFR014C	173057	173057	Substitution	C	T
	A single nucleotide substitution was made within ORF CMK1/YFR014C. Note that the protein sequence was not affected. New 173040 GAGCCTTCAAGATGAATTGTTTTGCTTTATTGGAAACGGAATCCCAATAAGGCCTATGAA 173099 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 173032 GAGCCTTCAAGATGAATTGTTTTGCCTTATTGGAAACGGAATCCCAATAAGGCCTATGAA 173091 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFR012W, YFR012W-A	168869	168869	Insertion		A
	A single nucleotide insertion was made in the intergenic region between ORFs YFR012W and YFR012W-A. New 168840 TTACCTGCAAAGCAAGAAAATGTGGAAATGCCTACTGAAAAAAAAAAGGCAAATATTTTA 168899 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 168833 TTACCTGCAAAGCAAGAAAATGTGGAAATGCCTACTG-AAAAAAAAAGGCAAATATTTTA 168891 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFR009W, YFR010W	164814	164814	Insertion		T
	A single nucleotide insertion was made in the intergenic region between ORFs GCN20/YFR009W and UBP6/YFR010W. New 164810 CCCCATGATACTTTTTTTTTTTGACTACTTGTATTGGAATCTAATTGACCTAACTGGGCA 164869 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 164804 CCCCATGATAC-TTTTTTTTTTGACTACTTGTATTGGAATCTAATTGACCTAACTGGGCA 164862 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFR005C, YFR006W	155980	155980	Insertion		T
	A single nucleotide insertion was made in the intergenic region between ORFs SAD1/YFR005C and YFR006W. New 155940 CCAATTTTTTTTCCTATTTCGTCATTTTTTTATCAAGATTTTCCAGTTTTTTTTTTTTTT 155999 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 155935 CCAATTTTTTTTCCTATTTCGTCATTTTTTTATCAAGATTTTCCAG-TTTTTTTTTTTTT 155993 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFR044C, YFR045W	241576	241576	Substitution	A	T
	A single nucleotide substitution was made within the intergenic region between ORFs DUG1/YFR044C and YFR045W. New 241559 GAATGACGAATATAAGGGATATTGCTAAAATATGCTGTGGCATTGGTCAACTTAAAAGAA 241618 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Old 241546 GAATGACGAATATAAGGGATATTGCTAAAAAATGCTGTGGCATTGGTCAACTTAAAAGAA 241605 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	RUF21	58032	58032	Substitution	G	A
		58035	58035	Substitution	G	A
	Two separate single nucleotide substitutions were made within ncRNA RUF21. New 58021 TATATATATATAAGGAGGCCGATAAAAAAGAACTTGCAATATTACGCAGATCAGGGATTT 58080 |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| Old 58020 TATATATATATAGGGGGGCCGATAAAAAAGAACTTGCAATATTACGCAGATCAGGGATTT 58079 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFR035C, tK(CUU)F	226684	226684	Insertion		G
	A single nucleotide insertion was made in the intergenic region between ORF YFR035C and tRNA tK(CUU)F. New 226679 AAAGAGATAAGCCCTGTAGGGGGCTCGAACCCCTAACCTTATGATTAAGAGTCATACGCG 226738 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 226667 AAAGAGATAAGCCCTGTA-GGGGCTCGAACCCCTAACCTTATGATTAAGAGTCATACGCG 226725 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFR031C	219387	219387	Substitution	A	G
	A single nucleotide substitution was made within ORF SMC2/YFR031C. Note that the protein sequence was not affected. New 219359 TTATTGATGTATGTTTATGTTTAATGTTATAGTATTCATAGGATACAACAATTCGTTCAG 219418 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old 219347 TTATTGATGTATGTTTATGTTTAATGTTATAGTATTCATAAGATACAACAATTCGTTCAG 219406 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	ARS603.5, YFL009W	118584	118584	Substitution	G	A
		118606	118614	Substitution	CTGGATGTG	TTGTATGT
	Several nucleotides were changed in the intergenic region between ORF CDC4/YFL009W and ARS603.5. New 118571 ACTTCGTACATTTTATTGAATATAAACTGCAGCTAAACTGCTTGTATGT-TCAATTTTAA 118629 ||||||||||||||||||| ||||||||||||||||||||| || |||| |||||||||| Old 118565 ACTTCGTACATTTTATTGAGTATAAACTGCAGCTAAACTGCCTGGATGTGTCAATTTTAA 118624 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFL020C, YFL021W	97503	97503	Insertion		A
		98796	98796	Insertion		TGA
	A single nucleotide insertion and a trinucleotide insertion were made in the intergenic region between ORFs GAT1/YFL021W and PAU5/YFL020C. New 97491 ATTTATAGATCCCCCAAAAAAAAAAAAGTACTCGCTTCTTTCCATGTCCGCTTCATATAT 97550 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 97489 ATTTATAGATCCCCC-AAAAAAAAAAAGTACTCGCTTCTTTCCATGTCCGCTTCATATAT 97547 New 98761 CTGCAATTTTTTTTTTTGTATTAACTCATCGAGTATGTCTGATGTGTAAACTGAACCAGG 98820 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 98758 CTGCAATTTTTTTTTTTGTATTAACTCATCGAGTATGTC---TGTGTAAACTGAACCAGG 98814 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFL021C-A, YFL022C	95385	95385	Substitution	C	G
		95410	95410	Substitution	T	C
	Two separate single nucleotide substitutions were made within the intergenic region between ORFs FRS2/YFL022C and YFL021C-A. New 95371 TTTCCGATTTTAGCCGGCGAAGACGTACTTGGCGCCATAATCAAAACCTAGCTTGCCCAA 95430 |||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| Old 95369 TTTCCGATTTTAGCCGCCGAAGACGTACTTGGCGCCATAATTAAAACCTAGCTTGCCCAA 95428 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	TEL06L-XR	4827	4827	Substitution	T	A
	A single nucleotide substitution was made within TEL06L-XR. New 4801 CCCACACACCACACCCACACCCTAATACTACCTCAACCCTACCCTAATCCAACCCTTCCA 4860 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 4801 CCCACACACCACACCCACACCCTAATTCTACCTCAACCCTACCCTAATCCAACCCTTCCA 4860 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFL039C	54494	54494	Insertion		T
	A single nucleotide insertion was made within the intron of ORF ACT1/YFL039C. New 54481 CGAAAATATTTCAGTTTTTTTTTTTTTTCCAAATTTCAAGCCCCTATTTATTCCAATAAT 54540 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 54481 CGAAAATATTTCAG-TTTTTTTTTTTTTCCAAATTTCAAGCCCCTATTTATTCCAATAAT 54539 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFL034C-A, YFL034W	65112	65112	Insertion		A
	A single nucleotide insertion was made in the intergenic region between ORFs RPL22B/YFL034C-A and YFL034W. New 65101 GCTCGCGTTGTCTAAAAAAAAAAGTTTGGAAACTTTTTTGTATAATTTATGGGTGTTATC 65160 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 65100 GCTCGCGTTGTCT-AAAAAAAAAGTTTGGAAACTTTTTTGTATAATTTATGGGTGTTATC 65158 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	tG(GCC)F2	181039	181039	Insertion		TTTC
	A tetranucleotide insertion was made within tRNA tG(GCC)F2. New 181020 GATTTTACCACTAAACCACTTGCGCTTATTTCTTGGAAGTGTTCGTGTTCTAATAAGGTC 181079 |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old 181012 GATTTTACCACTAAACCACTTGCGCTTA----TTGGAAGTGTTCGTGTTCTAATAAGGTC 181067 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFR048W, YFR049W	248160	248160	Substitution	A	T
	A single nucleotide substitution was made in the intergenic region between ORFs RMD8/YFR048W and YMR31/YFR049W. New 248159 CATTAAAAATAAATTAATGATATATTTAGTTATCAAGGTTTTTAGTCATATATTTCACCG 248218 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 248146 CATTAAAAATAAATAAATGATATATTTAGTTATCAAGGTTTTTAGTCATATATTTCACCG 248205 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YFL022C	95000	95000	Substitution	A	G
	A single nucleotide substitution was made within ORF FRS2/YFL022C. Note that the protein sequence was not affected. New 94981 TTTTAGAATTTCTAATTGGAAGTCAGACATCTTTACGTTAGGGGGTGAGAGAGGGAGGGG 95040 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 94979 TTTTAGAATTTCTAATTGGAAATCAGACATCTTTACGTTAGGGGGTGAGAGAGGGAGGGG 95038 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2004-02-05	YFR038W	231670	231670	Deletion	G
	Based on the automated comparison of related fungi, Kellis et al. and Brachat et al. suggested that the stop site for YFR038W be moved 226 nt downstream. Hui-fen Kuo and Eric Richards resequenced this portion of the genome and found that a G nt. should be deleted (personal communication to SGD). This sequence error was confirmed by SGD. As a consequence of this sequence change, YFR038W was extended 226 nt at the 3' end, altering the the C-terminus and increasing the size of the predicted protein from 778 to 853 amino acids. New: 231648 AAAAATTGGCGTTAAATGAAGG-TTCTTTTTTGAAGGCAAA 231687 |||||||||||||||||||||| |||||||||||||||||| Old: 231648 AAAAATTGGCGTTAAATGAAGGGTTCTTTTTTGAAGGCAAA 231688 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. SGD paper | PubMed | Full-Text
2004-02-05	YFR045W	242181	242181	Insertion		G
	Based on the automated comparison of related Saccharomyces species, Kellis et al. and Brachat et al. suggested that the start site for YFR045W be moved 320 nt upstream. Belenkiy R et al. demonstrated a G nt insertion in that region and this sequence change was confirmed in S288c, by SGD. As a consequence of this sequence change, YFR045W was extended 320 nt at the 5' end, altering the the N-terminus and increasing the size of the predicted protein from 537 to 858 amino acids. Note that Belenkiy et al. also demonstrated a silent G to C substitution 701 nts downstream from the new start site; however, SGD could not confirm this sequence change in S288c, so it has not been incorporated. New: 242152 TAAAGACTGGTTTACAATTGCAACCGAAGGGTACCGCTTTCGAAATCATTTTACCTCAGA 242211 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Old: 242152 TAAAGACTGGTTTACAATTGCAACCGAAGG-TACCGCTTTCGAAATCATTTTACCTCAGA 242210 Belenkiy R, et al. (2000) The yeast mitochondrial transport proteins: new sequences and consensus residues, lack of direct relation between consensus residues and transmembrane helices, expression patterns of the transport protein genes, and protein-protein interactions with other proteins. Biochim Biophys Acta 1467(1):207-18. SGD paper | PubMed | Full-Text Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. SGD paper | PubMed | Full-Text
2003-09-26	YFR050C, YFR051C	250082	250082	Deletion	G
	A single G nucleotide was deleted from the intergenic region between ORFs YFR050C and YFR051C. Old: 250051 TAAACTATATATATAGAAGGACGAAAGAAAAGGATACCTCGATTTTTATTTATTTAGTTT 250110 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| New: 250051 TAAACTATATATATAGAAGGACGAAAGAAAAG-ATACCTCGATTTTTATTTATTTAGTTT 250109 Robben J, et al. (2002) Revisiting the yeast chromosome VI DNA sequence reveals a correction merging YFL007w and YFL006w to a single ORF. Yeast 19(8):699-702. SGD paper | PubMed | Full-Text
2003-09-26	YFL006W, YFL007W	128870	128870	Insertion		G
	Due to the insertion of a G at 128870 on Chromosome VI, YFL006W has been merged with BLM10/YFL007W. YFL006W is now an alias of BLM10/YFL007W. Personal communication from Tim Formosa, University of Utah. Old: 128841 TTTGATCACCCATACGATCAGGTTCGCCAG-CTGTCGCTAAACTATTGACGACCTTAGTT 128899 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| New: 128841 TTTGATCACCCATACGATCAGGTTCGCCAGGCTGTCGCTAAACTATTGACGACCTTAGTT 128900 Robben J, et al. (2002) Revisiting the yeast chromosome VI DNA sequence reveals a correction merging YFL007w and YFL006w to a single ORF. Yeast 19(8):699-702. SGD paper | PubMed | Full-Text Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata
2003-09-26	TEL06R, TEL06R-XC	270023	270023	Insertion		G
	After sequence verification in AB972 (S288c derivative) by SGD, a single G nucleotide was inserted after chromosomal coordinate 270023. This change lies within TEL06R-XC, the X element core sequence of TEL06R, the right telomere of chromosome VI. Old: 270000 TACTATTGATGGAAATGAGGACTG-GTCATGGGGCGCAATGGAGTGAAGTAATATATACT 270058 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| New: 270000 TACTATTGATGGAAATGAGGACTGGGTCATGGGGCGCAATGGAGTGAAGTAATATATACT 270059 Robben J, et al. (2002) Revisiting the yeast chromosome VI DNA sequence reveals a correction merging YFL007w and YFL006w to a single ORF. Yeast 19(8):699-702. SGD paper | PubMed | Full-Text
2003-09-26	YFR040W	234451	234451	Deletion	G
	Due to the deletion of a G at 234450 on Chr VI, the coordinates of ORF YFR040W changed from 234521-237238 to 234229-237237. References: 1. Sequence verification in AB972 (S288c derivative strain) background by SGD. 2. Personal communication from Margaret Shirra, University of Pittsburgh. Old: 234421 CATGGTGATGAAGTGAAAACGGCACGTGGGAGATCAGAAGAGTCGATTTGAGAAGGATGA 234480 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| New: 234421 CATGGTGATGAAGTGAAAACGGCACGTGG-AGATCAGAAGAGTCGATTTGAGAAGGATGA 234479 Luke MM, et al. (1996) The SAP, a new family of proteins, associate and function positively with the SIT4 phosphatase. Mol Cell Biol 16(6):2744-55. SGD paper | PubMed | Full-Text Jablonowski D, et al. (2001) Sit4p protein phosphatase is required for sensitivity of Saccharomyces cerevisiae to Kluyveromyces lactis zymocin. Genetics 159(4):1479-89. SGD paper | PubMed | Full-Text Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. SGD paper | PubMed | Full-Text Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2001-05-29	YFL042C, YFL043C	46151	46151	Deletion	C
	Due to the deletion of G at chromosomal coordinate 46151, which was within the ORF YFL043C, YFL043C is now part of YFL042C. The new coordinates for YFL042C are 47744-45720. See Genbank file YSCCHRVIN. The old coordinates for YFL042C were 47745-46078, and for YFL043C were 46157-45720. Old: 46141 CACGTTATTTCCGTCATTCCAACGGATTAGATACCTTGTCTTAGTTGAGAAACTACCACC 46200 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| New: 46141 CACGTTATTTC-GTCATTCCAACGGATTAGATACCTTGTCTTAGTTGAGAAACTACCACC 46199
2001-05-29	YFL031W	75751	75751	Insertion		C
	A single C was inserted after the C at chromosomal coordinate 75751 (see GenBank file YSCCHRVIN). In addition, a new intron was annotated at relative coordinates 662-913. As a result, the chromosomal coordinates for ORF YFL031W are now 75177-75837..76090-76145, with relative coordinates 1-661..914-969. The old chromosomal coordinates for YFL031W were 75178-75780, with old relative coordinates 1-603. Old: 75721 AACAACAATTTGTTTGATGCGGTGGCCTCGC-GTTGGCAGACCCACTCTGCGACGATATA 75779 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| New: 75720 AACAACAATTTGTTTGATGCGGTGGCCTCGCCGTTGGCAGACCCACTCTGCGACGATATA 75779

Annotation Changes without sequence changes

Date	Affected Features
2014-11-18	ARS600, ARS603, ARS606 The chromosomal coordinates of the following ARS elements on Chromosome VI were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS600, ARS603, ARS606. Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. SGD paper | PubMed | Full-Text
2014-11-18	ARS600.4, ARS603.1 The following new ARS elements on Chromosome VI were added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS600.4, ARS603.1. Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. SGD paper | PubMed | Full-Text
2014-11-18	YFL056C, YFL057C The ORF AAD16/YFL057C was merged into neighboring ORF AAD6/YFL056C and the combined feature is now annotated as a pseudogene. This update was made as part of SGD's genome annotation revision R64.2. Delneri D, et al. (1999) Analysis of the seven-member AAD gene set demonstrates that genetic redundancy in yeast may be more apparent than real. Genetics 153(4):1591-600. SGD paper | PubMed | Full-Text
2009-05-04	RUF20, RUF21, RUF22, RUF23 The following RNA features were added to the S. cerevisiae genome annotation based on Kavanaugh & Dietrich 2009: RUF20, RUF21, RUF22, and RUF23. Note that Kavanaugh & Dietrich state that the 3' ends of RUF22 and RUF23 are uncertain, meaning that these two RNAs may possibly be longer than currently annotated. Kavanaugh LA and Dietrick FS (2009) Non-Coding RNA Prediction and Verification in Saccharomyces cerevisiae. PLoS Genet 5(1):e1000321. SGD paper | PubMed | Full-Text
2008-06-02	YFR024C-A Based on the sequencing of the cloned cDNA, as the genomic DNA has an intron, Kathryn Ayscough and E.G. Allwood from the University of Sheffield conclude that the intron is not spliced at the predicted site, but rather 24 nt upstream. This annotation was updated in SGD, and as a result, the predicted protein product is 8 amino acids longer. The relative coding coordinates had been 1-47..166-1474, but are now 1-47..142-1474. Special thanks to Kathryn Ayscough and E.G. Allwood from the University of Sheffield for bringing this error to our attention. This annotation change is also supported by RNA sequencing data from Yassour et al. 2009. Ayscough K and Allowed E (2008) SGD paper Yassour M, et al. (2009) Ab initio construction of a eukaryotic transcriptome by massively parallel mRNA sequencing. Proc Natl Acad Sci U S A 106(9):3264-9. SGD paper | PubMed | Full-Text
2007-04-04	YFR032C-A RPL29/YFR032C-A mRNA contains an intron in the 5' untranslated region (UTR). Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. SGD paper | PubMed | Full-Text Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7. SGD paper | PubMed | Full-Text
2007-04-04	YFR045W Based on cDNA data from Miura et al. and sequence conservation among closely related fungal species, a new intron and 5' exon were added to YFR045W. This alters and extends the N-terminus, changing the size of the protein product from 285 to 309 amino acids. Special thanks to Michel Satre for bringing this update to our attention. Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. SGD paper | PubMed | Full-Text
2007-03-08	ARS601, ARS602, ARS604, ARS605, ARS606, ARS607, ARS608, ARS609 ACS annotated based on Xu et al. 2006 and Shirahige et al. 1993. Shirahige K, et al. (1993) Location and characterization of autonomously replicating sequences from chromosome VI of Saccharomyces cerevisiae. Mol Cell Biol 13(8):5043-56. SGD paper | PubMed | Full-Text Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276. SGD paper | PubMed | Full-Text
2007-03-08	ARS603.5 ACS was annotated based on Xu et al. 2006 and Yamashita et al. 1997. Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276. SGD paper | PubMed | Full-Text Yamashita M, et al. (1997) The efficiency and timing of initiation of replication of multiple replicons of Saccharomyces cerevisiae chromosome VI. Genes Cells 2(11):655-65. SGD paper | PubMed | Full-Text
2007-03-08	ARS603 Both ACS's within ARS603 were annotated based on Xu et al. 2006 and Shirahige et al. 1993. Shirahige K, et al. (1993) Location and characterization of autonomously replicating sequences from chromosome VI of Saccharomyces cerevisiae. Mol Cell Biol 13(8):5043-56. SGD paper | PubMed | Full-Text Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276. SGD paper | PubMed | Full-Text
2007-03-08	ARS610 ARS610 was added to the genome annotation based on Xu et al. 2006. Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276. SGD paper | PubMed | Full-Text
2006-05-08	CEN6 The previously annotated 5' boundary of CEN6 was slightly adjusted to coincide with the 5' end of CDEI, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae. Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60. SGD paper | PubMed | Full-Text Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68. SGD paper | PubMed | Full-Text
2006-03-02	ARS600 This ARS element ARS600 (originally published as ARS120) was added to the genome annotation based on Eisenberg et al. 1988 and Wyrick et al. 2001. ARS120 was originally added to SGD as "not in systematic sequence of S288C". Eisenberg S, et al. (1988) Specific interaction between a Saccharomyces cerevisiae protein and a DNA element associated with certain autonomously replicating sequences. Proc Natl Acad Sci U S A 85(3):743-6. SGD paper | PubMed | Full-Text Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60. SGD paper | PubMed | Full-Text | Comments & Errata
2004-10-12	CEN6 Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003. Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60. SGD paper | PubMed | Full-Text Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68. SGD paper | PubMed | Full-Text
2004-04-01	RUF7 Feature annotation removed per John McCutcheon and Sean Eddy. McCutcheon JP and Eddy SR (2004) Detailed correction to: Computational identification of noncoding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res. 31:4119-4128, 2003. SGD paper | PubMed | Full-Text
2003-09-09	TEL06L, TEL06R The chromosomal locations for the following telomeric features on Chromosome VI were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL06L, TEL06L-XC, TEL06L-XR, TEL06L-TR, TEL06L-YP, TEL06R, TEL06R-XC, TEL06R-TR.
2003-07-29	YFR009W-A, YFR010W-A Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following ORFs on Chromosome VI: YFR009W-A, YFR010W-A. Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9. SGD paper | PubMed | Full-Text Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. SGD paper | PubMed | Full-Text | YFGdb Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. SGD paper | PubMed | Full-Text | Web Supplement | YFGdb
2003-07-29	YFL041W-A Thanks to Kessler et al. for providing the coordinates of ORF YFL041W-A. Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. SGD paper | PubMed | Full-Text
2003-07-29	YFL013W-A, YFL031C-A, YFR032C-B, YFR034W-A Thanks to Kumar et al. for providing the coordinates of the following ORFs on Chromosome VI: YFL013W-A, YFL031C-A, YFR032C-B, YFR034W-A. Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63. SGD paper | PubMed | Full-Text | YFGdb | Comments & Errata
2003-07-29	YFL015W-A, YFL021C-A, YFR036W-A, YFR052C-A Thanks to MIPS for providing the coordinates of the following ORFs on Chromosome VI: YFL015W-A, YFL021C-A, YFR036W-A, YFR052C-A.
2003-03-13	YFR024C, YFR024C-A YFR024C is not a genuine ORF, but is the C-terminus of LSB3/YFR024C-A. The LSB3 gene contains an intron that has been demonstrated to be spliced. The ORF YFR024C has been deleted and the name YFR024C has been made an alias for LSB3/YFR024C-A. Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6. SGD paper | PubMed | Full-Text
2003-03-06	RUF7 Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8. McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28. SGD paper | PubMed | Full-Text
2001-03-15	ARS603.5 Coordinates courtesy of Katsuhiro Shirahige - Personal communication
2001-03-02	ARS601, ARS602, ARS603, ARS604, ARS605, ARS606, ARS607, ARS608, ARS609 The coordinates for the following ARS elements on Chromosome VI are courtesy of Katsuhiro Shirahige, based on Shirahige et al. 1993: ARS601, ARS602, ARS603, ARS604, ARS605, ARS606, ARS607, ARS608, ARS609. Shirahige K, et al. (1993) Location and characterization of autonomously replicating sequences from chromosome VI of Saccharomyces cerevisiae. Mol Cell Biol 13(8):5043-56. SGD paper | PubMed | Full-Text