Chromosome VII History

This page lists all sequence and annotation changes that have been made to the Chromosome VII systematic reference sequence since its intial release on 1996-07-31. The sequence of Chromosome VII has been updated 125 times, affecting 87 features. The annotation of Chromosome VII has been updated 54 times, affecting 88 features.

Sequence Changes

Date	Affected Features	Start Coordinate of Change	End Coordinate of Change	Type of Change	Old Sequence	New Sequence
2011-02-03	YGR067C	622408	622408	Substitution	A	T
	A single nucleotide substitution was made in the stop codon of ORF YGR067C, destroying it and increasing the length of the annotated protein by 10 amino acids. New 622362 TCTTTGGCCATTATTTTATTTGGCTAAAAATTTCAATGTTTTTACTTTGTTTATTGTCAG 622421 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 622366 TCTTTGGCCATTATTTTATTTGGCTAAAAATTTCAATGTTTTAACTTTGTTTATTGTCAG 622425 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
2011-02-03	YGL197W	125909	125910	Substitution	CG	GC
		125487	125487	Insertion		A
		125495	125495	Deletion	A
	Nucleotide changes within the coding region of MDS3/YGL197W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 262-264 are now QSE rather than HPK, and residue 403 is now Alanine rather than Arginine. New 125449 TAGACATCTATAACATCTCACAGAATTGCTGGCAATCCGAAA-CCATACCCAAACAACCG 125507 |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| Old 125454 TAGACATCTATAACATCTCACAGAATTGCTGGCA-TCCGAAAACCATACCCAAACAACCG 125512 New 125868 ATATACGATATTAACTCCGGAAAGTGGTCACGAGTCGCTACCGCCTGCCCTGACTGCGAT 125927 |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 125873 ATATACGATATTAACTCCGGAAAGTGGTCACGAGTCCGTACCGCCTGCCCTGACTGCGAT 125932 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
2011-02-03	YGL041C, YGL041W-A	419056	419056	Deletion	G
	A single nucleotide was deleted within the coding regions of overlapping ORFs YGL041W-A and YGL041C, resulting in altered protein sequences for both ORFs. The YGL041W-A C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 72 amino acids longer. The YGL041C N-terminus remains the same, but the C-terminus has changed and the annotated protein is truncated by one-third of its length (reduced from 104 amino acids to 67 amino acids). New 419013 ACTCATGGATCAAATAAATTCGAGGCCTAATGTTCTGG-AAAAGTTAGAAAAGGTTAGCA 419071 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Old 419018 ACTCATGGATCAAATAAATTCGAGGCCTAATGTTCTGGGAAAAGTTAGAAAAGGTTAGCA 419077 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
2011-02-03	YGL214W	90019	90019	Insertion		T
	A single T nucleotide was inserted within ORF YGL214W very near its 5' end, altering its coding sequence. The reading frame and stop remain the same, but the start has been shifted downstream four nucleotides and the annotated protein is now one amino acid shorter. New 89994 CCAAAAAGAATAATGGATGATTGTAAGGTTACATGCAATATATCAAGATATTACTAGAGA 90053 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 89999 CCAAAAAGAATAATGGATGAT-GTAAGGTTACATGCAATATATCAAGATATTACTAGAGA 90057 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
2011-02-03	YGL129C	269097	269097	Deletion	A
	A single nucleotide was deleted within ORF RSM23/YGL129C, altering its coding sequence. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 38 amino acids shorter. New 269076 TATTCTGATACGTATA-CCACGTGGCTTGTACTTGTTCTCTTGTTAATGTTTTCCCTCGA 269134 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 269081 TATTCTGATACGTATAACCACGTGGCTTGTACTTGTTCTCTTGTTAATGTTTTCCCTCGA 269140 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
2011-02-03	YGL056C	397085	397086	Substitution	CG	GC
		397241	397241	Substitution	A	C
	Nucleotide changes within the coding region of SDS23/YGL056C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 180 is now Glycine rather than Alanine. New 397060 GTGTCAACTTTACTATCTCGCCCACGGGCACGGACTTACCATTCTGGCAGTCTGAGGTTA 397119 ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 397066 GTGTCAACTTTACTATCTCCGCCACGGGCACGGACTTACCATTCTGGCAGTCTGAGGTTA 397125 New 397190 TGTTAAACAATTCATGTCTCCCGGAAAATTCTCCACAGGCAAAGACGTTAGCTGGTGCTT 397249 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 397196 TGTTAAACAATTCATGTCTCCCGGAAAATTCTCCACAGGCAAAGAAGTTAGCTGGTGCTT 397255 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
2011-02-03	YGR058W	607109	607109	Substitution	T	G
	A single nucleotide substitution within the coding region of PEF1/YGR058W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 324 is now Aspartic Acid rather than Tyrosine. New 607062 TAATCAAGAAGGCATTGCAACCATACAGTACAAAGATTTTATCGATGCTACATTATATTT 607121 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 607066 TAATCAAGAAGGCATTGCAACCATACAGTACAAAGATTTTATCTATGCTACATTATATTT 607125 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
2011-02-03	YGR271W	1033108	1033108	Substitution	C	T
		1032373	1032373	Substitution	G	A
		1031948	1031948	Substitution	C	A
	Nucleotide substitutions within the coding region of SLH1/YGR271W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 51 is now Glutamine rather than Proline, residue 193 is now Lysine rather than Glutamic Acid, and residue 438 is now Serine rather than Proline. New 1031905 TTTGATGACGAGCTAAAAAAAGTCCAAAAGGATGAACAAAATCAAAGAACTGAACTAACT 1031964 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 1031911 TTTGATGACGAGCTAAAAAAAGTCCAAAAGGATGAACCAAATCAAAGAACTGAACTAACT 1031970 New 1032325 CCAGAGTTCCTGACACAGCAAGATATCAGGAATCAAGTTTTGAAAAGTGCAGAGGATGCC 1032384 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 1032331 CCAGAGTTCCTGACACAGCAAGATATCAGGAATCAAGTTTTGGAAAGTGCAGAGGATGCC 1032390 New 1033055 AATTACTAATTATTGATGAAGTTCATTTACTGCACGAAGATAGAGGTTCGGTTATTGAAA 1033114 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 1033061 AATTACTAATTATTGATGAAGTTCATTTACTGCACGAAGATAGAGGTCCGGTTATTGAAA 1033120 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98