Difference between revisions of "Chromosome VI History"
(→Sequence Changes) |
|||
Line 536: | Line 536: | ||
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2001-05-29 | ||
+ | | [https://www.yeastgenome.org/locus/YFL042C YFL042C], [https://www.yeastgenome.org/locus/YFL043C YFL043C] <br> | ||
+ | | 46151 | ||
+ | | 46151 | ||
+ | | Deletion | ||
+ | | C | ||
+ | | | ||
+ | |- | ||
+ | | || colspan="6" | Due to the deletion of G at chromosomal coordinate 46151, which was within the ORF YFL043C, YFL043C is now part of YFL042C. The new coordinates for YFL042C are 47744-45720. See Genbank file YSCCHRVIN. ''The old coordinates for YFL042C were 47745-46078, and for YFL043C were 46157-45720.'' | ||
+ | <pre>Old: 46141 CACGTTATTTCCGTCATTCCAACGGATTAGATACCTTGTCTTAGTTGAGAAACTACCACC 46200 | ||
+ | ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | ||
+ | New: 46141 CACGTTATTTC-GTCATTCCAACGGATTAGATACCTTGTCTTAGTTGAGAAACTACCACC 46199</pre> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2001-05-29 | ||
+ | | [https://www.yeastgenome.org/locus/YFL031W YFL031W] <br> | ||
+ | | 75751 | ||
+ | | 75751 | ||
+ | | Insertion | ||
+ | | | ||
+ | | C | ||
+ | |- | ||
+ | | || colspan="6" | A single C was inserted after the C at chromosomal coordinate 75751 (see GenBank file YSCCHRVIN). In addition, a new intron was annotated at relative coordinates 662-913. As a result, the chromosomal coordinates for ORF YFL031W are now 75177-75837..76090-76145, with relative coordinates 1-661..914-969. ''The old chromosomal coordinates for YFL031W were 75178-75780, with old relative coordinates 1-603.'' | ||
+ | <pre>Old: 75721 AACAACAATTTGTTTGATGCGGTGGCCTCGC-GTTGGCAGACCCACTCTGCGACGATATA 75779 | ||
+ | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | ||
+ | New: 75720 AACAACAATTTGTTTGATGCGGTGGCCTCGCCGTTGGCAGACCCACTCTGCGACGATATA 75779</pre> | ||
+ | |||
+ | |} | ||
+ | |||
+ | <br><br> | ||
+ | |||
+ | =Annotation Changes ''without sequence changes''= | ||
+ | {| border="1" style="border-collapse:collapse; width:90%" cellpadding="6" | ||
+ | ! Date !! Affected Features | ||
+ | |- | ||
+ | | 2014-11-18 | ||
+ | | [https://www.yeastgenome.org/locus/ARS600 ARS600], [https://www.yeastgenome.org/locus/ARS603 ARS603], [https://www.yeastgenome.org/locus/ARS606 ARS606] <br> | ||
+ | The chromosomal coordinates of the following ARS elements on Chromosome VI were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS600, ARS603, ARS606. <br> <br> | ||
+ | '''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text] | ||
+ | |- | ||
+ | | 2014-11-18 | ||
+ | | [https://www.yeastgenome.org/locus/ARS600.4 ARS600.4], [https://www.yeastgenome.org/locus/ARS603.1 ARS603.1] <br> | ||
+ | The following new ARS elements on Chromosome VI were added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS600.4, ARS603.1.<br> <br> | ||
+ | '''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text] | ||
+ | |- | ||
+ | | 2014-11-18 | ||
+ | | [https://www.yeastgenome.org/locus/YFL056C YFL056C], [https://www.yeastgenome.org/locus/YFL057C YFL057C] <br> | ||
+ | The ORF AAD16/YFL057C was merged into neighboring ORF AAD6/YFL056C and the combined feature is now annotated as a pseudogene. This update was made as part of SGD's genome annotation revision R64.2.<br> <br> | ||
+ | '''Delneri D, et al.''' (1999) Analysis of the seven-member AAD gene set demonstrates that genetic redundancy in yeast may be more apparent than real. Genetics 153(4):1591-600. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000043843 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10581269 PubMed] | [https://www.genetics.org/content/153/4/1591.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2009-05-04 | ||
+ | | [https://www.yeastgenome.org/locus/RUF20 RUF20], [https://www.yeastgenome.org/locus/RUF21 RUF21], [https://www.yeastgenome.org/locus/RUF22 RUF22], [https://www.yeastgenome.org/locus/RUF23 RUF23] <br> | ||
+ | The following RNA features were added to the S. cerevisiae genome annotation based on Kavanaugh & Dietrich 2009: RUF20, RUF21, RUF22, and RUF23. ''Note that Kavanaugh & Dietrich state that the 3' ends of RUF22 and RUF23 are uncertain, meaning that these two RNAs may possibly be longer than currently annotated.''<br> <br> | ||
+ | '''Kavanaugh LA and Dietrick FS''' (2009) Non-Coding RNA Prediction and Verification in Saccharomyces cerevisiae. PLoS Genet 5(1):e1000321. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000128754 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/19119416 PubMed] | [https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1000321 Full-Text] <br> | ||
+ | |- | ||
+ | | 2008-06-02 | ||
+ | | [https://www.yeastgenome.org/locus/YFR024C-A YFR024C-A] <br> | ||
+ | Based on the sequencing of the cloned cDNA, as the genomic DNA has an intron, Kathryn Ayscough and E.G. Allwood from the University of Sheffield conclude that the intron is not spliced at the predicted site, but rather 24 nt upstream. This annotation was updated in SGD, and as a result, the predicted protein product is 8 amino acids longer. The relative coding coordinates had been 1-47..166-1474, but are now 1-47..142-1474. Special thanks to Kathryn Ayscough and E.G. Allwood from the University of Sheffield for bringing this error to our attention. <br><br> | ||
+ | |||
+ | This annotation change is also supported by RNA sequencing data from Yassour et al. 2009.<br><br> | ||
+ | '''Ayscough K and Allowed E''' (2008) <br> | ||
+ | [https://www.yeastgenome.org/reference/S000126577 SGD paper] <br> | ||
+ | '''Yassour M, et al.''' (2009) Ab initio construction of a eukaryotic transcriptome by massively parallel mRNA sequencing. Proc Natl Acad Sci U S A 106(9):3264-9. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000129301 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/19208812 PubMed] | [https://www.pnas.org/content/106/9/3264 Full-Text] <br> | ||
+ | |- | ||
+ | | 2007-04-04 | ||
+ | | [https://www.yeastgenome.org/locus/YFR032C-A YFR032C-A] <br> | ||
+ | RPL29/YFR032C-A mRNA contains an intron in the 5' untranslated region (UTR). <br><br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | '''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br> | ||
+ | '''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7. | ||
+ | <br> | ||
+ | [https://www.yeastgenome.org/reference/S000120506 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17244705 PubMed] | [https://www.pnas.org/content/104/5/1522.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2007-04-04 | ||
+ | | [https://www.yeastgenome.org/locus/YFR045W YFR045W] <br> | ||
+ | Based on cDNA data from Miura et al. and sequence conservation among closely related fungal species, a new intron and 5' exon were added to YFR045W. This alters and extends the N-terminus, changing the size of the protein product from 285 to 309 amino acids. Special thanks to Michel Satre for bringing this update to our attention. <br><br> | ||
+ | '''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br> |
Revision as of 14:09, 4 October 2019
This page lists all sequence and annotation changes that have been made to the Chromosome VI systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome VI has been updated 36 times, affecting 43 features.
- The annotation of Chromosome VI has been updated 24 times, affecting 39 features.
- Current and past versions can be obtained from SGD's Download site.
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YFL034W | 66443 | 66443 | Substitution | C | A |
Nucleotide change(s) in the coding region of YFL034W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 323 is now Lysine rather than Asparagine.
New 66421 TATTGACATTAAATCCCACAAGAAACTAGCACATAGATTACAGTTTACCCAGAAGGATAT 66480 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Old 66419 TATTGACATTAAATCCCACAAGAACCTAGCACATAGATTACAGTTTACCCAGAAGGATAT 66478 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFR040W | 236216 | 236216 | Substitution | C | A |
Nucleotide change(s) in the coding region of SAP155/YFR040W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 663 is now Asparagine rather than Threonine.
New 236219 ATGAAGCAAAACATAAAACTTAGGACCGACCCCACGGTCGGGGACCTATTCAAAATCAAA 236278 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 236206 ATGAAGCAAACCATAAAACTTAGGACCGACCCCACGGTCGGGGACCTATTCAAAATCAAA 236265 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFR019W | 191312 | 191312 | Substitution | T | A |
Nucleotide change(s) in the coding region of FAB1/YFR019W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 2275 is now Arginine rather than Tryptophan.
New 191280 AAGCAATGGAGAGGTATATTTTGATGGTTCCTGATCCGTGGTATAGGGAAGGAAATTAAT 191339 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 191268 AAGCAATGGAGAGGTATATTTTGATGGTTCCTGATCCGTGGTATTGGGAAGGAAATTAAT 191327 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFL026W | 83382 | 83382 | Substitution | G | A |
Nucleotide change(s) in the coding region of STE2/YFL026W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 269 is now Lysine rather than Glutamic Acid.
New 83341 TTTGTTGGTTCCATCGATAATATTCATCCTCGCATACAGTTTGAAACCAAACCAGGGAAC 83400 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 83339 TTTGTTGGTTCCATCGATAATATTCATCCTCGCATACAGTTTGGAACCAAACCAGGGAAC 83398 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFR020W, YFRCdelta9 |
192393 | 192393 | Deletion | C | |
A single nucleotide deletion was made in the intergenic region between Ty1 LTR YFRCdelta9 and ORF YFR020W.
New 192360 TTTTAGGAATACTGTTGTTCAAGATAGAGCATTTGCATACCTTAT-CGAGGTTCACTATC 192418 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 192348 TTTTAGGAATACTGTTGTTCAAGATAGAGCATTTGCATACCTTATCCGAGGTTCACTATC 192407 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFR020W, YFR021W |
192393 | 192393 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs YFR020W and ATG18/YFR021W.
New 194759 GTTAGTAATAGTGTTCCAGTTAACTCTGTATCCTTTTCTTCTTCGGCCTGACAATGTCTG 194818 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Old 194748 GTTAGTAATAGTGTTCCAGTTAACTCTGTATCCTTTTC-TCTTCGGCCTGACAATGTCTG 194806 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFR019W, tS(GCU)F |
191388 | 191388 | Substitution | G | T |
A single nucleotide substitution was made within the intergenic region between ORF FAB1/YFR019W and tRNA tS(GCU)F.
New 191390 CGCACATTAGTGTTCTTTAACTTTCAGTACCTTAGTAGTTATCAACTATGAAAAGGTGGT 191449 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 191378 CGCACATTAGGGTTCTTTAACTTTCAGTACCTTAGTAGTTATCAACTATGAAAAGGTGGT 191437 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFR014C |
173057 | 173057 | Substitution | C | T |
A single nucleotide substitution was made within ORF CMK1/YFR014C. Note that the protein sequence was not affected.
New 173040 GAGCCTTCAAGATGAATTGTTTTGCTTTATTGGAAACGGAATCCCAATAAGGCCTATGAA 173099 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 173032 GAGCCTTCAAGATGAATTGTTTTGCCTTATTGGAAACGGAATCCCAATAAGGCCTATGAA 173091 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFR012W, YFR012W-A |
168869 | 168869 | Insertion | A | |
A single nucleotide insertion was made in the intergenic region between ORFs YFR012W and YFR012W-A.
New 168840 TTACCTGCAAAGCAAGAAAATGTGGAAATGCCTACTGAAAAAAAAAAGGCAAATATTTTA 168899 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 168833 TTACCTGCAAAGCAAGAAAATGTGGAAATGCCTACTG-AAAAAAAAAGGCAAATATTTTA 168891 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFR009W, YFR010W |
164814 | 164814 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs GCN20/YFR009W and UBP6/YFR010W.
New 164810 CCCCATGATACTTTTTTTTTTTGACTACTTGTATTGGAATCTAATTGACCTAACTGGGCA 164869 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 164804 CCCCATGATAC-TTTTTTTTTTGACTACTTGTATTGGAATCTAATTGACCTAACTGGGCA 164862 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFR005C, YFR006W |
155980 | 155980 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs SAD1/YFR005C and YFR006W.
New 155940 CCAATTTTTTTTCCTATTTCGTCATTTTTTTATCAAGATTTTCCAGTTTTTTTTTTTTTT 155999 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 155935 CCAATTTTTTTTCCTATTTCGTCATTTTTTTATCAAGATTTTCCAG-TTTTTTTTTTTTT 155993 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFR044C, YFR045W |
241576 | 241576 | Substitution | A | T |
A single nucleotide substitution was made within the intergenic region between ORFs DUG1/YFR044C and YFR045W.
New 241559 GAATGACGAATATAAGGGATATTGCTAAAATATGCTGTGGCATTGGTCAACTTAAAAGAA 241618 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Old 241546 GAATGACGAATATAAGGGATATTGCTAAAAAATGCTGTGGCATTGGTCAACTTAAAAGAA 241605 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | RUF21 | 58032 | 58032 | Substitution | G | A |
58035 | 58035 | Substitution | G | A | ||
Two separate single nucleotide substitutions were made within ncRNA RUF21.
New 58021 TATATATATATAAGGAGGCCGATAAAAAAGAACTTGCAATATTACGCAGATCAGGGATTT 58080 |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| Old 58020 TATATATATATAGGGGGGCCGATAAAAAAGAACTTGCAATATTACGCAGATCAGGGATTT 58079 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFR035C, tK(CUU)F |
226684 | 226684 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORF YFR035C and tRNA tK(CUU)F.
New 226679 AAAGAGATAAGCCCTGTAGGGGGCTCGAACCCCTAACCTTATGATTAAGAGTCATACGCG 226738 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 226667 AAAGAGATAAGCCCTGTA-GGGGCTCGAACCCCTAACCTTATGATTAAGAGTCATACGCG 226725 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFR031C |
219387 | 219387 | Substitution | A | G |
A single nucleotide substitution was made within ORF SMC2/YFR031C. Note that the protein sequence was not affected.
New 219359 TTATTGATGTATGTTTATGTTTAATGTTATAGTATTCATAGGATACAACAATTCGTTCAG 219418 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old 219347 TTATTGATGTATGTTTATGTTTAATGTTATAGTATTCATAAGATACAACAATTCGTTCAG 219406 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | ARS603.5, YFL009W | 118584 | 118584 | Substitution | G | A |
118606 | 118614 | Substitution | CTGGATGTG | TTGTATGT | ||
Several nucleotides were changed in the intergenic region between ORF CDC4/YFL009W and ARS603.5.
New 118571 ACTTCGTACATTTTATTGAATATAAACTGCAGCTAAACTGCTTGTATGT-TCAATTTTAA 118629 ||||||||||||||||||| ||||||||||||||||||||| || |||| |||||||||| Old 118565 ACTTCGTACATTTTATTGAGTATAAACTGCAGCTAAACTGCCTGGATGTGTCAATTTTAA 118624 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFL020C, YFL021W | 97503 | 97503 | Insertion | A | |
98796 | 98796 | Insertion | TGA | |||
A single nucleotide insertion and a trinucleotide insertion were made in the intergenic region between ORFs GAT1/YFL021W and PAU5/YFL020C.
New 97491 ATTTATAGATCCCCCAAAAAAAAAAAAGTACTCGCTTCTTTCCATGTCCGCTTCATATAT 97550 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 97489 ATTTATAGATCCCCC-AAAAAAAAAAAGTACTCGCTTCTTTCCATGTCCGCTTCATATAT 97547 New 98761 CTGCAATTTTTTTTTTTGTATTAACTCATCGAGTATGTCTGATGTGTAAACTGAACCAGG 98820 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 98758 CTGCAATTTTTTTTTTTGTATTAACTCATCGAGTATGTC---TGTGTAAACTGAACCAGG 98814 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFL021C-A, YFL022C | 95385 | 95385 | Substitution | C | G |
95410 | 95410 | Substitution | T | C | ||
Two separate single nucleotide substitutions were made within the intergenic region between ORFs FRS2/YFL022C and YFL021C-A.
New 95371 TTTCCGATTTTAGCCGGCGAAGACGTACTTGGCGCCATAATCAAAACCTAGCTTGCCCAA 95430 |||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| Old 95369 TTTCCGATTTTAGCCGCCGAAGACGTACTTGGCGCCATAATTAAAACCTAGCTTGCCCAA 95428 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | TEL06L-XR |
4827 | 4827 | Substitution | T | A |
A single nucleotide substitution was made within TEL06L-XR.
New 4801 CCCACACACCACACCCACACCCTAATACTACCTCAACCCTACCCTAATCCAACCCTTCCA 4860 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 4801 CCCACACACCACACCCACACCCTAATTCTACCTCAACCCTACCCTAATCCAACCCTTCCA 4860 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFL039C |
54494 | 54494 | Insertion | T | |
A single nucleotide insertion was made within the intron of ORF ACT1/YFL039C.
New 54481 CGAAAATATTTCAGTTTTTTTTTTTTTTCCAAATTTCAAGCCCCTATTTATTCCAATAAT 54540 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 54481 CGAAAATATTTCAG-TTTTTTTTTTTTTCCAAATTTCAAGCCCCTATTTATTCCAATAAT 54539 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFL034C-A, YFL034W |
65112 | 65112 | Insertion | A | |
A single nucleotide insertion was made in the intergenic region between ORFs RPL22B/YFL034C-A and YFL034W.
New 65101 GCTCGCGTTGTCTAAAAAAAAAAGTTTGGAAACTTTTTTGTATAATTTATGGGTGTTATC 65160 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 65100 GCTCGCGTTGTCT-AAAAAAAAAGTTTGGAAACTTTTTTGTATAATTTATGGGTGTTATC 65158 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | tG(GCC)F2 |
181039 | 181039 | Insertion | TTTC | |
A tetranucleotide insertion was made within tRNA tG(GCC)F2.
New 181020 GATTTTACCACTAAACCACTTGCGCTTATTTCTTGGAAGTGTTCGTGTTCTAATAAGGTC 181079 |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old 181012 GATTTTACCACTAAACCACTTGCGCTTA----TTGGAAGTGTTCGTGTTCTAATAAGGTC 181067 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFR048W, YFR049W |
248160 | 248160 | Substitution | A | T |
A single nucleotide substitution was made in the intergenic region between ORFs RMD8/YFR048W and YMR31/YFR049W.
New 248159 CATTAAAAATAAATTAATGATATATTTAGTTATCAAGGTTTTTAGTCATATATTTCACCG 248218 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 248146 CATTAAAAATAAATAAATGATATATTTAGTTATCAAGGTTTTTAGTCATATATTTCACCG 248205 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YFL022C |
95000 | 95000 | Substitution | A | G |
A single nucleotide substitution was made within ORF FRS2/YFL022C. Note that the protein sequence was not affected.
New 94981 TTTTAGAATTTCTAATTGGAAGTCAGACATCTTTACGTTAGGGGGTGAGAGAGGGAGGGG 95040 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 94979 TTTTAGAATTTCTAATTGGAAATCAGACATCTTTACGTTAGGGGGTGAGAGAGGGAGGGG 95038 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2004-02-05 | YFR038W |
231670 | 231670 | Deletion | G | |
Based on the automated comparison of related fungi, Kellis et al. and Brachat et al. suggested that the stop site for YFR038W be moved 226 nt downstream. Hui-fen Kuo and Eric Richards resequenced this portion of the genome and found that a G nt. should be deleted (personal communication to SGD). This sequence error was confirmed by SGD. As a consequence of this sequence change, YFR038W was extended 226 nt at the 3' end, altering the the C-terminus and increasing the size of the predicted protein from 778 to 853 amino acids.
New: 231648 AAAAATTGGCGTTAAATGAAGG-TTCTTTTTTGAAGGCAAA 231687 |||||||||||||||||||||| |||||||||||||||||| Old: 231648 AAAAATTGGCGTTAAATGAAGGGTTCTTTTTTGAAGGCAAA 231688 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-02-05 | YFR045W |
242181 | 242181 | Insertion | G | |
Based on the automated comparison of related Saccharomyces species, Kellis et al. and Brachat et al. suggested that the start site for YFR045W be moved 320 nt upstream. Belenkiy R et al. demonstrated a G nt insertion in that region and this sequence change was confirmed in S288c, by SGD. As a consequence of this sequence change, YFR045W was extended 320 nt at the 5' end, altering the the N-terminus and increasing the size of the predicted protein from 537 to 858 amino acids. Note that Belenkiy et al. also demonstrated a silent G to C substitution 701 nts downstream from the new start site; however, SGD could not confirm this sequence change in S288c, so it has not been incorporated.
New: 242152 TAAAGACTGGTTTACAATTGCAACCGAAGGGTACCGCTTTCGAAATCATTTTACCTCAGA 242211 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Old: 242152 TAAAGACTGGTTTACAATTGCAACCGAAGG-TACCGCTTTCGAAATCATTTTACCTCAGA 242210 Belenkiy R, et al. (2000) The yeast mitochondrial transport proteins: new sequences and consensus residues, lack of direct relation between consensus residues and transmembrane helices, expression patterns of the transport protein genes, and protein-protein interactions with other proteins. Biochim Biophys Acta 1467(1):207-18. | ||||||
2003-09-26 | YFR050C, YFR051C |
250082 | 250082 | Deletion | G | |
A single G nucleotide was deleted from the intergenic region between ORFs YFR050C and YFR051C.
Old: 250051 TAAACTATATATATAGAAGGACGAAAGAAAAGGATACCTCGATTTTTATTTATTTAGTTT 250110 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| New: 250051 TAAACTATATATATAGAAGGACGAAAGAAAAG-ATACCTCGATTTTTATTTATTTAGTTT 250109 Robben J, et al. (2002) Revisiting the yeast chromosome VI DNA sequence reveals a correction merging YFL007w and YFL006w to a single ORF. Yeast 19(8):699-702. | ||||||
2003-09-26 | YFL006W, YFL007W |
128870 | 128870 | Insertion | G | |
Due to the insertion of a G at 128870 on Chromosome VI, YFL006W has been merged with BLM10/YFL007W. YFL006W is now an alias of BLM10/YFL007W. Personal communication from Tim Formosa, University of Utah.
Old: 128841 TTTGATCACCCATACGATCAGGTTCGCCAG-CTGTCGCTAAACTATTGACGACCTTAGTT 128899 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| New: 128841 TTTGATCACCCATACGATCAGGTTCGCCAGGCTGTCGCTAAACTATTGACGACCTTAGTT 128900 Robben J, et al. (2002) Revisiting the yeast chromosome VI DNA sequence reveals a correction merging YFL007w and YFL006w to a single ORF. Yeast 19(8):699-702. | ||||||
2003-09-26 | TEL06R, TEL06R-XC |
270023 | 270023 | Insertion | G | |
After sequence verification in AB972 (S288c derivative) by SGD, a single G nucleotide was inserted after chromosomal coordinate 270023. This change lies within TEL06R-XC, the X element core sequence of TEL06R, the right telomere of chromosome VI.
Old: 270000 TACTATTGATGGAAATGAGGACTG-GTCATGGGGCGCAATGGAGTGAAGTAATATATACT 270058 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| New: 270000 TACTATTGATGGAAATGAGGACTGGGTCATGGGGCGCAATGGAGTGAAGTAATATATACT 270059 Robben J, et al. (2002) Revisiting the yeast chromosome VI DNA sequence reveals a correction merging YFL007w and YFL006w to a single ORF. Yeast 19(8):699-702. | ||||||
2003-09-26 | YFR040W |
234451 | 234451 | Deletion | G | |
Due to the deletion of a G at 234450 on Chr VI, the coordinates of ORF YFR040W changed from 234521-237238 to 234229-237237. References: 1. Sequence verification in AB972 (S288c derivative strain) background by SGD. Old: 234421 CATGGTGATGAAGTGAAAACGGCACGTGGGAGATCAGAAGAGTCGATTTGAGAAGGATGA 234480 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| New: 234421 CATGGTGATGAAGTGAAAACGGCACGTGG-AGATCAGAAGAGTCGATTTGAGAAGGATGA 234479 Luke MM, et al. (1996) The SAP, a new family of proteins, associate and function positively with the SIT4 phosphatase. Mol Cell Biol 16(6):2744-55. | ||||||
2001-05-29 | YFL042C, YFL043C |
46151 | 46151 | Deletion | C | |
Due to the deletion of G at chromosomal coordinate 46151, which was within the ORF YFL043C, YFL043C is now part of YFL042C. The new coordinates for YFL042C are 47744-45720. See Genbank file YSCCHRVIN. The old coordinates for YFL042C were 47745-46078, and for YFL043C were 46157-45720.
Old: 46141 CACGTTATTTCCGTCATTCCAACGGATTAGATACCTTGTCTTAGTTGAGAAACTACCACC 46200 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| New: 46141 CACGTTATTTC-GTCATTCCAACGGATTAGATACCTTGTCTTAGTTGAGAAACTACCACC 46199 | ||||||
2001-05-29 | YFL031W |
75751 | 75751 | Insertion | C | |
A single C was inserted after the C at chromosomal coordinate 75751 (see GenBank file YSCCHRVIN). In addition, a new intron was annotated at relative coordinates 662-913. As a result, the chromosomal coordinates for ORF YFL031W are now 75177-75837..76090-76145, with relative coordinates 1-661..914-969. The old chromosomal coordinates for YFL031W were 75178-75780, with old relative coordinates 1-603.
Old: 75721 AACAACAATTTGTTTGATGCGGTGGCCTCGC-GTTGGCAGACCCACTCTGCGACGATATA 75779 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| New: 75720 AACAACAATTTGTTTGATGCGGTGGCCTCGCCGTTGGCAGACCCACTCTGCGACGATATA 75779 |
Annotation Changes without sequence changes
Date | Affected Features |
---|---|
2014-11-18 | ARS600, ARS603, ARS606 The chromosomal coordinates of the following ARS elements on Chromosome VI were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS600, ARS603, ARS606. |
2014-11-18 | ARS600.4, ARS603.1 The following new ARS elements on Chromosome VI were added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS600.4, ARS603.1. |
2014-11-18 | YFL056C, YFL057C The ORF AAD16/YFL057C was merged into neighboring ORF AAD6/YFL056C and the combined feature is now annotated as a pseudogene. This update was made as part of SGD's genome annotation revision R64.2. |
2009-05-04 | RUF20, RUF21, RUF22, RUF23 The following RNA features were added to the S. cerevisiae genome annotation based on Kavanaugh & Dietrich 2009: RUF20, RUF21, RUF22, and RUF23. Note that Kavanaugh & Dietrich state that the 3' ends of RUF22 and RUF23 are uncertain, meaning that these two RNAs may possibly be longer than currently annotated. |
2008-06-02 | YFR024C-A Based on the sequencing of the cloned cDNA, as the genomic DNA has an intron, Kathryn Ayscough and E.G. Allwood from the University of Sheffield conclude that the intron is not spliced at the predicted site, but rather 24 nt upstream. This annotation was updated in SGD, and as a result, the predicted protein product is 8 amino acids longer. The relative coding coordinates had been 1-47..166-1474, but are now 1-47..142-1474. Special thanks to Kathryn Ayscough and E.G. Allwood from the University of Sheffield for bringing this error to our attention. This annotation change is also supported by RNA sequencing data from Yassour et al. 2009. |
2007-04-04 | YFR032C-A RPL29/YFR032C-A mRNA contains an intron in the 5' untranslated region (UTR). |
2007-04-04 | YFR045W Based on cDNA data from Miura et al. and sequence conservation among closely related fungal species, a new intron and 5' exon were added to YFR045W. This alters and extends the N-terminus, changing the size of the protein product from 285 to 309 amino acids. Special thanks to Michel Satre for bringing this update to our attention. |