Difference between revisions of "Chromosome VII History"
(→Sequence Changes) |
|||
(22 intermediate revisions by 2 users not shown) | |||
Line 1: | Line 1: | ||
− | This page lists all sequence and annotation changes that have been made to the Chromosome VII systematic reference sequence since its intial release on 1996-07-31. | + | This page lists all sequence and annotation changes that have been made to the Chromosome VII systematic reference sequence since its intial release on 1996-07-31. <br> |
− | The sequence of Chromosome VII has been updated 125 times, affecting 87 features. | + | *The sequence of Chromosome VII has been updated '''125''' times, affecting '''87''' features. <br> |
− | The annotation of Chromosome VII has been updated | + | *The annotation of Chromosome VII has been updated '''57''' times, affecting '''91''' features. <br> |
+ | *Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site]. | ||
+ | |||
+ | __FORCETOC__ | ||
=Sequence Changes= | =Sequence Changes= | ||
Line 1,564: | Line 1,567: | ||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||
New 719761 CACTCGGAAGTGGTGCTGCAAGAGTGGTCAATGGGCCCGTTACGAAGAACAGAAATTCAA 719820</pre> | New 719761 CACTCGGAAGTGGTGCTGCAAGAGTGGTCAATGGGCCCGTTACGAAGAACAGAAATTCAA 719820</pre> | ||
+ | |||
+ | |} | ||
+ | |||
+ | <br><br> | ||
+ | |||
+ | =Annotation Changes ''without sequence changes''= | ||
+ | {| border="1" style="border-collapse:collapse; width:90%" cellpadding="6" | ||
+ | ! Date !! Affected Features | ||
+ | |- | ||
+ | |2021-04-21 | ||
+ | |[https://www.yeastgenome.org/locus/S000003139 ROK1/YGL171W]<br> | ||
+ | Two new uORFs | ||
+ | *coordinates uORF1: 182286..182407 | ||
+ | *coordinates uORF2: 182291..182329 | ||
+ | :[https://www.yeastgenome.org/reference/S000139084 Jeon and Kim 2010] PMID:20969870 | ||
+ | |- | ||
+ | |2021-04-21 | ||
+ | |[https://www.yeastgenome.org/locus/S000303806 OTO1/YGR227C-A]<br> | ||
+ | New ORF | ||
+ | *coordinates 949052..949225 Crick | ||
+ | :[https://www.yeastgenome.org/reference/S000179595 Makanae et al 2015] PMID:25781884 | ||
+ | |- | ||
+ | | 2014-11-19 | ||
+ | | [https://www.yeastgenome.org/locus/ARS737 ARS737] <br> | ||
+ | The coordinates of the ARS consensus sequence annotated within ARS737 were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2. <br> <br> | ||
+ | '''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text] | ||
+ | |- | ||
+ | | 2014-11-19 | ||
+ | | [https://www.yeastgenome.org/locus/ARS716 ARS716], [https://www.yeastgenome.org/locus/ARS720 ARS720], [https://www.yeastgenome.org/locus/ARS722 ARS722], [https://www.yeastgenome.org/locus/ARS729 ARS729], [https://www.yeastgenome.org/locus/ARS734 ARS734] <br> | ||
+ | As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome VII based on Liachko et al. 2013: ARS716, ARS720, ARS722, ARS729, ARS734. <br> <br> | ||
+ | '''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text] | ||
+ | |- | ||
+ | | 2014-11-19 | ||
+ | | [https://www.yeastgenome.org/locus/ARS702 ARS702], [https://www.yeastgenome.org/locus/ARS707 ARS707], [https://www.yeastgenome.org/locus/ARS714 ARS714], [https://www.yeastgenome.org/locus/ARS716 ARS716], [https://www.yeastgenome.org/locus/ARS718 ARS718], [https://www.yeastgenome.org/locus/ARS727 ARS727], [https://www.yeastgenome.org/locus/ARS728 ARS728], [https://www.yeastgenome.org/locus/ARS737 ARS737], [https://www.yeastgenome.org/locus/ARS734 ARS734] <br> | ||
+ | The chromosomal coordinates of the following ARS elements on Chromosome VII were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS702, ARS707, ARS714, ARS716, ARS718, ARS727, ARS728, ARS737, ARS734.<br> <br> | ||
+ | '''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text] | ||
+ | |- | ||
+ | | 2014-11-19 | ||
+ | | [https://www.yeastgenome.org/locus/RME3 RME3] <br> | ||
+ | RME3 was added to the genome annotation and assigned genomic coordinates based on Xu et al. 2009 and Gelfand et al. 2011 as part of SGD's genome annotation revision R64.2.<br> <br> | ||
+ | '''Xu Z, et al.''' (2009) Bidirectional promoters generate pervasive transcription in yeast. Nature 457(7232):1033-7. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000135372 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/19169243 PubMed] | [https://www.nature.com/articles/nature07728 Full-Text] | [https://www.yeastgenome.org/reference/S000135372 Comments & Errata] <br> | ||
+ | '''Gelfand B, et al.''' (2011) Regulated antisense transcription controls expression of cell-type-specific genes in yeast. Mol Cell Biol 31(8):1701-9. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000144311 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/21300780 PubMed] | [https://mcb.asm.org/content/31/8/1701 Full-Text] | ||
+ | |- | ||
+ | | 2014-11-19 | ||
+ | | [https://www.yeastgenome.org/locus/RME2 RME2] <br> | ||
+ | RME2 was added to the genome annotation and assigned genomic coordinates based on Yassour et al. 2010 and Gelfand et al. 2011 as part of SGD's genome annotation revision R64.2.<br> <br> | ||
+ | '''Yassour M, et al.''' (2010) Strand-specific RNA sequencing reveals extensive regulated long antisense transcripts that are conserved across yeast species. Genome Biol 11(8):R87. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000136009 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/20796282 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2010-11-8-r87 Full-Text] <br> | ||
+ | '''Gelfand B, et al.''' (2011) Regulated antisense transcription controls expression of cell-type-specific genes in yeast. Mol Cell Biol 31(8):1701-9. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000144311 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/21300780 PubMed] | [https://mcb.asm.org/content/31/8/1701 Full-Text] | ||
+ | |- | ||
+ | | 2014-11-18 | ||
+ | | [https://www.yeastgenome.org/locus/YGL033W YGL033W] <br> | ||
+ | A second intron and third coding region were added to the annotation of HOP2/YGL033W as part of SGD's genome annotation revision R64.2. | ||
+ | <pre>Old coordinates: | ||
+ | CDS 1-55 435625..435679 | ||
+ | intron 56-125 435680..435749 | ||
+ | CDS 126-727 435750..436351 | ||
+ | New coordinates: | ||
+ | CDS 1-55 435625..435679 - stays the same | ||
+ | intron 56-125 435680..435749 - stays the same | ||
+ | CDS 126-688 435750..436312 - new coordinates | ||
+ | intron 689-750 436313..436374 - new intron | ||
+ | CDS 751-777 436375..436401 - new coding region</pre> | ||
+ | '''Chan YL, et al.''' (2014) The Third Exon of the Budding Yeast Meiotic Recombination Gene HOP2 Is Required for Calcium-dependent and Recombinase Dmc1-specific Stimulation of Homologous Strand Assimilation. J Biol Chem 289(26):18076-18086. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000175748 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/?term=24798326 PubMed] | [http://www.jbc.org/content/289/26/18076.long Full-Text] | ||
+ | |- | ||
+ | | 2014-11-18 | ||
+ | | [https://www.yeastgenome.org/locus/ETC1 ETC1], [https://www.yeastgenome.org/locus/ETC2 ETC2], [https://www.yeastgenome.org/locus/ETC3 ETC3], [https://www.yeastgenome.org/locus/ETC4 ETC4], [https://www.yeastgenome.org/locus/ETC6 ETC6], [https://www.yeastgenome.org/locus/ETC7 ETC7], [https://www.yeastgenome.org/locus/ETC8 ETC8] <br> | ||
+ | The following previously unmapped features were identified as nuclear matrix attachment sites and assigned chromosomal coordinates based on Hiraga et al. 2012 as part of SGD's genome annotation revision R64.2: ETC1, ETC2, ETC3, ETC4, ETC6, ETC7, ETC8.<br> <br> | ||
+ | '''Hiraga SI, et al.''' (2012) TFIIIC localizes budding yeast ETC sites to the nuclear periphery. Mol Biol Cell 23(14):2741-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000149071 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/22496415 PubMed] | [https://www.molbiolcell.org/doi/10.1091/mbc.e11-04-0365 Full-Text] | ||
+ | |- | ||
+ | | 2009-05-07 | ||
+ | | [https://www.yeastgenome.org/locus/ARS709 ARS709], [https://www.yeastgenome.org/locus/ARS712 ARS712], [https://www.yeastgenome.org/locus/ARS715 ARS715], [https://www.yeastgenome.org/locus/ARS723 ARS723], [https://www.yeastgenome.org/locus/ARS735 ARS735], [https://www.yeastgenome.org/locus/ARS736 ARS736] <br> | ||
+ | The following ARS elements on Chromosome 7 were added to the genome annotation based on Raveendranathan et al. 2006: ARS709, ARS712, ARS715, ARS723, ARS724, ARS735, and ARS736.<br> <br> | ||
+ | '''Raveendranathan M, et al.''' (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000117571 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16888628 PubMed] | [https://www.embopress.org/cgi/doi/10.1038/sj.emboj.7601251 Full-Text] | ||
+ | |- | ||
+ | | 2008-06-02 | ||
+ | | [https://www.yeastgenome.org/locus/YGL256W YGL256W] <br> | ||
+ | The start of ADH4/YGL256W was moved 249 nt downstream, based on Williams & Paquin 1987 and Lyons et al. 2000, who state that Met84 appears to be the true translational start. See also GenBank X05992.<br> <br> | ||
+ | '''Lyons TJ, et al.''' (2000) Genome-wide characterization of the Zap1p zinc-responsive regulon in yeast. Proc Natl Acad Sci U S A 97(14):7957-62. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000049083 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10884426 PubMed] | [https://www.pnas.org/content/97/14/7957.long Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=10884426&db=pmid YFGdb] <br> | ||
+ | '''Williamson VM and Paquin CE''' (1987) Homology of Saccharomyces cerevisiae ADH4 to an iron-activated alcohol dehydrogenase from Zymomonas mobilis. Mol Gen Genet 209(2):374-81. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000050560 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/2823079 PubMed] | [https://link.springer.com/article/10.1007%2FBF00329668 Full-Text] | ||
+ | |- | ||
+ | | 2007-05-08 | ||
+ | | [https://www.yeastgenome.org/locus/snR46 snR46]<br> | ||
+ | Updated coordinates of snR46 based on GenBank Z72814, U56647, Z72815. Shifted entire feature downstream 1 nucleotide.<br> <br> | ||
+ | '''Balakin AG, et al.''' (1996) The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell 86(5):823-34. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000042180 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/8797828 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400801567?via%3Dihub Full-Text] | ||
+ | |- | ||
+ | | 2007-04-04 | ||
+ | | [https://www.yeastgenome.org/locus/YGR148C YGR148C]<br> | ||
+ | RPL24B/YGR148C mRNA contains an intron in the 5' untranslated region (UTR).<br> <br> | ||
+ | '''Baronas-Lowell DM and Warner JR ''' (1990) Ribosomal protein L30 is dispensable in the yeast Saccharomyces cerevisiae. Mol Cell Biol 10(10):5235-43. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000051769 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/2204809 PubMed] | [https://mcb.asm.org/content/10/10/5235.long Full-Text] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | '''Mitra G and Warner JR''' (1984) A yeast ribosomal protein gene whose intron is in the 5' leader. J Biol Chem 259(14):9218-24. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000079790 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/6086628 PubMed] | [http://www.jbc.org/content/259/14/9218.long Full-Text] <br> | ||
+ | '''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br> | ||
+ | '''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7. | ||
+ | <br> | ||
+ | [https://www.yeastgenome.org/reference/S000120506 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17244705 PubMed] | [https://www.pnas.org/content/104/5/1522.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2007-04-04 | ||
+ | | [https://www.yeastgenome.org/locus/YGR027C YGR027C]<br> | ||
+ | RPS25A/YGR027C mRNA contains an intron in the 5' untranslated region (UTR).<br> <br> | ||
+ | '''Nieuwint RT, et al.''' (1985) The gene for yeast ribosomal protein S31 contains an intron in the leader sequence. Curr Genet 10(1):1-5. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000065021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/2856436 PubMed] | [https://link.springer.com/article/10.1007%2FBF00418486 Full-Text] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | '''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br> | ||
+ | '''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7. | ||
+ | <br> | ||
+ | [https://www.yeastgenome.org/reference/S000120506 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17244705 PubMed] | [https://www.pnas.org/content/104/5/1522.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2007-04-04 | ||
+ | | [https://www.yeastgenome.org/locus/YGL189C YGL189C]<br> | ||
+ | RPS26A/YGL189C mRNA contains an intron in the 5' untranslated region (UTR)..<br> <br> | ||
+ | '''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br> | ||
+ | '''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7. | ||
+ | <br> | ||
+ | [https://www.yeastgenome.org/reference/S000120506 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17244705 PubMed] | [https://www.pnas.org/content/104/5/1522.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2007-04-04 | ||
+ | | [https://www.yeastgenome.org/locus/YGL187C YGL187C]<br> | ||
+ | COX4/YGL187W mRNA contains an intron in the 5' untranslated region (UTR).<br> <br> | ||
+ | '''Schneider JC and Guarente L''' (1987) The untranslated leader of nuclear COX4 gene of Saccharomyces cerevisiae contains an intron. Nucleic Acids Res 15(8):3515-29. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000056034 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/3033605 PubMed] | [https://academic.oup.com/nar/article/15/8/3515/1025374 Full-Text] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | '''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br> | ||
+ | '''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7. | ||
+ | <br> | ||
+ | [https://www.yeastgenome.org/reference/S000120506 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17244705 PubMed] | [https://www.pnas.org/content/104/5/1522.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2007-04-04 | ||
+ | | [https://www.yeastgenome.org/locus/YGL031C YGL031C]<br> | ||
+ | RPL24A/YGL031C mRNA contains an intron in the 5' untranslated region (UTR).<br> <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | '''Mitra G and Warner JR''' (1984) A yeast ribosomal protein gene whose intron is in the 5' leader. J Biol Chem 259(14):9218-24. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000079790 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/6086628 PubMed] | [http://www.jbc.org/content/259/14/9218.long Full-Text] <br> | ||
+ | '''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br> | ||
+ | '''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7. | ||
+ | <br> | ||
+ | [https://www.yeastgenome.org/reference/S000120506 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17244705 PubMed] | [https://www.pnas.org/content/104/5/1522.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2006-10-05 | ||
+ | | [https://www.yeastgenome.org/locus/YGR034W YGR034W]<br> | ||
+ | Based on N-terminal sequencing (Otaka E. et al) and conservation with RPL26A, the first exon of RPL26B was moved upstream. The new first exon is 19 nts in length (the previous first exon was 25 nts), and the new start codon is 117 nt upstream of the previously annotated start. The 5' end of the intron has been extended upstream, but the 3' end of the intron remains the same, as does the second exon. The protein product is now two residues shorter and altered at the N-terminus. Special thanks to Ivo Pedruzzi and the team at Swiss-Prot for bringing this to our attention.<br> <br> | ||
+ | '''Otaka E, et al.''' (1984) Yeast ribosomal proteins. VIII. Isolation of two proteins and sequence characterization of twenty-four proteins from cytoplasmic ribosomes. Mol Gen Genet 195(3):544-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000127723 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/18782943 PubMed] | [https://link.springer.com/article/10.1007%2FBF00341461 Full-Text] <br> | ||
+ | |- | ||
+ | | 2006-10-03 | ||
+ | | [https://www.yeastgenome.org/locus/ARS737 ARS737]<br> | ||
+ | ARS737, also known as ARS731.5, was added to the genome annotation based on Nieduszynski et al. 2006.<br> <br> | ||
+ | '''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000117321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] | [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br> | ||
+ | |- | ||
+ | | 2006-10-03 | ||
+ | | [https://www.yeastgenome.org/locus/ARS702 ARS702], [https://www.yeastgenome.org/locus/ARS704 ARS704], [https://www.yeastgenome.org/locus/ARS707 ARS707], [https://www.yeastgenome.org/locus/ARS710 ARS710], [https://www.yeastgenome.org/locus/ARS714 ARS714], [https://www.yeastgenome.org/locus/ARS717 ARS717], [https://www.yeastgenome.org/locus/ARS718 ARS718], [https://www.yeastgenome.org/locus/ARS719 ARS719], [https://www.yeastgenome.org/locus/ARS721 ARS721], [https://www.yeastgenome.org/locus/ARS727 ARS727], [https://www.yeastgenome.org/locus/ARS728 ARS728], [https://www.yeastgenome.org/locus/ARS729 ARS729], [https://www.yeastgenome.org/locus/ARS731 ARS731], [https://www.yeastgenome.org/locus/ARS733 ARS733]<br> | ||
+ | ARS Consensus Sequences (ACS elements) were annotated in the following ARS elements on Chromosome VII based on Nieduszynski et al. 2006: ARS702, ARS704, ARS707, ARS710, ARS714, ARS717, ARS718, ARS719, ARS721, ARS727, ARS728, ARS729, ARS731, ARS733.<br> <br> | ||
+ | '''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000117321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] | [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br> | ||
+ | |- | ||
+ | | 2006-09-08 | ||
+ | | [https://www.yeastgenome.org/locus/ARS702 ARS702], [https://www.yeastgenome.org/locus/ARS704 ARS704], [https://www.yeastgenome.org/locus/ARS707 ARS707], [https://www.yeastgenome.org/locus/ARS710 ARS710], [https://www.yeastgenome.org/locus/ARS714 ARS714], [https://www.yeastgenome.org/locus/ARS716 ARS716],[https://www.yeastgenome.org/locus/ARS717 ARS717], [https://www.yeastgenome.org/locus/ARS718 ARS718], [https://www.yeastgenome.org/locus/ARS719 ARS719], [https://www.yeastgenome.org/locus/ARS720 ARS720], [https://www.yeastgenome.org/locus/ARS721 ARS721], [https://www.yeastgenome.org/locus/ARS722 ARS722], [https://www.yeastgenome.org/locus/ARS727 ARS727], [https://www.yeastgenome.org/locus/ARS728 ARS728], [https://www.yeastgenome.org/locus/ARS729 ARS729], [https://www.yeastgenome.org/locus/ARS731 ARS731], [https://www.yeastgenome.org/locus/ARS733 ARS733], [https://www.yeastgenome.org/locus/ARS734 ARS734]<br> | ||
+ | The following new ARS elements on Chromosome VII were added to SGD based on Nieduszynski et al. 2006: ARS702, ARS704, ARS707, ARS710, ARS714, ARS716, ARS717, ARS718, ARS719, ARS720, ARS721, ARS722, ARS727, ARS728, ARS729, ARS731, ARS733, ARS734.<br> <br> | ||
+ | '''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000117321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] | [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br> | ||
+ | |- | ||
+ | | 2006-05-09 | ||
+ | | [https://www.yeastgenome.org/locus/CEN7 CEN7]<br> | ||
+ | The previously annotated 3' boundary of CEN7 was moved 1 bp upstream to coincide with the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae.<br> <br> | ||
+ | '''Wieland G, et al.''' (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000059647 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11222754 PubMed] | [https://academic.oup.com/nar/article/29/5/1054/2381189 Full-Text]<br> | ||
+ | '''Espelin CW, et al.''' (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000074756 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/13679521 PubMed] | [https://www.molbiolcell.org/doi/full/10.1091/mbc.e02-08-0533?url_ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed Full-Text]<br> | ||
+ | |- | ||
+ | | 2006-04-12 | ||
+ | | [https://www.yeastgenome.org/locus/ARS706 ARS706]<br> | ||
+ | ARS706, also known as "ARO8 ARS", was added to the genome annotation for Chromosome VII at coordinates 117565-117858 based on Wyrick et al. 2001 and Iraqui et al. 1998.<br> <br> | ||
+ | '''Iraqui I, et al.''' (1998) Characterisation of Saccharomyces cerevisiae ARO8 and ARO9 genes encoding aromatic aminotransferases I and II reveals a new aminotransferase subfamily. Mol Gen Genet 257(2):238-48.<br> | ||
+ | [https://www.yeastgenome.org/reference/S000054049 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9491083 PubMed] | [https://link.springer.com/article/10.1007%2Fs004380050644 Full-Text]<br> | ||
+ | '''Wyrick JJ, et al.''' (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000069019 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11743203 PubMed] | [https://science.sciencemag.org/content/294/5550/2357.long Full-Text] | [https://www.ncbi.nlm.nih.gov/pubmed/11743187 Comments & Errata]<br> | ||
+ | |- | ||
+ | | 2006-01-23 | ||
+ | | [https://www.yeastgenome.org/locus/YGR088W YGR088W]<br> | ||
+ | Based on based on 5' SAGE TSS and multiple orthologous sequences alignment, Zhang and Dietrich suggest that the start site CTT1/YGR088W be moved 33 nt (11 codons) downstream. This is the same start codon published in the initial characterization by Hartig and Ruis. This change has been incorporated into SGD and the numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly.<br> <br> | ||
+ | '''Hartig A and Ruis H''' (1986) Nucleotide sequence of the Saccharomyces cerevisiae CTT1 gene and deduced amino-acid sequence of yeast catalase T. Eur J Biochem 160(3):487-90. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000053472 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/3536508 PubMed] | [https://febs.onlinelibrary.wiley.com/doi/full/10.1111/j.1432-1033.1986.tb10065.x?sid=nlm%3Apubmed Full-Text]<br> | ||
+ | '''Zhang Z and Dietrich FS''' (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000082006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/15905473 PubMed] | [https://academic.oup.com/nar/article/33/9/2838/2401448 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=15905473&db=pmid YFGdb]<br> | ||
+ | |- | ||
+ | | 2005-11-10 | ||
+ | | [https://www.yeastgenome.org/locus/YGL194C-A YGL194C-A]<br> | ||
+ | Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that this new ORF, YGL194C-A, be added to the S. cerevisiae genome annotation.<br> <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | |- | ||
+ | | 2005-11-01 | ||
+ | | [https://www.yeastgenome.org/locus/YGL194C-A YGL194C-A]<br> | ||
+ | Identified based on conservation in closely related fungi.<br> <br> | ||
+ | '''Blandin G, et al.''' (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000065690 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11152879 PubMed] | [https://febs.onlinelibrary.wiley.com/doi/full/10.1016/S0014-5793%2800%2902275-4 Full-Text] <br> | ||
+ | |- | ||
+ | | 2004-10-12 | ||
+ | | [https://www.yeastgenome.org/locus/CEN7 CEN7]<br> | ||
+ | The orientation of this centromere was reversed (from Watson to Crick) and its coordinates expanded to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. (2001) and Espelin et al. (2003).<br> <br> | ||
+ | '''Wieland G, et al.''' (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000059647 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11222754 PubMed] | [https://academic.oup.com/nar/article/29/5/1054/2381189 Full-Text]<br> | ||
+ | '''Espelin CW, et al.''' (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000074756 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/13679521 PubMed] | [https://www.molbiolcell.org/doi/full/10.1091/mbc.e02-08-0533?url_ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed Full-Text]<br> | ||
+ | |- | ||
+ | | 2004-08-27 | ||
+ | | [https://www.yeastgenome.org/locus/YGR161W-C YGR161W-C]<br> | ||
+ | The ORF YGR161W-C was added per Blandin et al. Note that this ORF was originally published using the systematic name "YGR161W-A;" however, the systematic name "YGR161W-A" had already been used to refer to a TyA Gag protein downstream of the new ORF predicted by Blandin et al.<br> <br> | ||
+ | '''Blandin G, et al.''' (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000065690 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11152879 PubMed] | [https://febs.onlinelibrary.wiley.com/doi/full/10.1016/S0014-5793%2800%2902275-4 Full-Text] <br> | ||
+ | |- | ||
+ | | 2004-04-01 | ||
+ | | [https://www.yeastgenome.org/locus/snR82 snR82]<br> | ||
+ | Start and stop coordinates updated per McCutcheon & Eddy 2004.<br> <br> | ||
+ | '''McCutcheon JP and Eddy SR''' (2004) Detailed correction to: Computational identification of noncoding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res. 31:4119-4128, 2003. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000074006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12853629 PubMed] | [https://academic.oup.com/nar/article/31/14/4119/2904330#55548715 Full-Text] <br> | ||
+ | |- | ||
+ | | 2004-04-01 | ||
+ | | [https://www.yeastgenome.org/locus/snR7-L snR7-L], [https://www.yeastgenome.org/locus/snR7-S snR7-S]<br> | ||
+ | 5' chromosomal coordinate of both snR7-L and snR7-S changed to that experimentally determined in Patterson, B and Guthrie, C. (1987).<br> <br> | ||
+ | '''Patterson B and Guthrie C''' (1987) An essential yeast snRNA with a U5-like domain is required for splicing in vivo. Cell 49(5):613-24. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000042788 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/3555841 PubMed] | [https://www.sciencedirect.com/science/article/pii/009286748790537X?via%3Dihub Full-Text] <br> | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YGR095C YGR095C]<br> | ||
+ | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for RRP46/YGR095C was moved 99 nt (33 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) this is the form of the protein detected in analyses by Synowsky et al.<br> <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | '''Synowsky SA, et al.''' (2006) Probing genuine strong interactions and post-translational modifications in the heterogeneous yeast exosome protein complex. Mol Cell Proteomics 5(9):1581-92. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000117042 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16829593 PubMed] | [https://www.mcponline.org/content/5/9/1581.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YGR275W YGR275W]<br> | ||
+ | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for RTT102/YGR275W was moved 87 nt (29 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br> <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YGL240W YGL240W]<br> | ||
+ | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for DOC1/YGL240W was moved 99 nt (33 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br> <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YGL250W YGL250W]<br> | ||
+ | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for YGL250W was moved 12 nt (4 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br> <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YGR201C YGR201C]<br> | ||
+ | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for YGR201C was moved 147 nt (49 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br> <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YGL025C YGL025C]<br> | ||
+ | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for PGD1/YGL025C was moved 102 nt (34 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br> <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YGR120C YGR120C]<br> | ||
+ | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for COG2/YGR120C was moved 39 nt (13 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br> <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YGL245W YGL245W]<br> | ||
+ | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for YGL245W was moved 48 nt (16 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br> <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YGL128C YGL128C]<br> | ||
+ | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for CWC23/YGL128C was moved 192 nt (64 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br> <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YGR057C YGR057C]<br> | ||
+ | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for LST7/YGR057C was moved 9 nt (3 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br> <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | |- | ||
+ | | 2003-09-09 | ||
+ | | [https://www.yeastgenome.org/locus/TEL07L TEL07L], [https://www.yeastgenome.org/locus/TEL07R TEL07R]<br> | ||
+ | The chromosomal locations for TEL07L, TEL07L-TR, TEL07L-XC, TEL07L-XR, TEL07R, TEL07R-XC, TEL07R-XR, and TEL07R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).<br> <br> | ||
+ | Note that TEL07R does have telomeric repeats (TEL07R-TR), but they are missing from the genome annotation due to sequencing difficulties encountered during the initial genome sequencing efforts in the 1990s. <br> | ||
+ | |- | ||
+ | | 2003-07-29 | ||
+ | | [https://www.yeastgenome.org/locus/YGL041C-B YGL041C-B], [https://www.yeastgenome.org/locus/YGL210W-A YGL210W-A], [https://www.yeastgenome.org/locus/YGR121W-A YGR121W-A], [https://www.yeastgenome.org/locus/YGR240C-A YGR240C-A]<br> | ||
+ | Thanks to Kessler et al. for providing the coordinates of the following Chromosome VII ORFs: YGR240C-A, YGL210W-A, YGR121W-A, and YGL041C-B.<br> <br> | ||
+ | '''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073671 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] | [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2003-07-29 | ||
+ | | [https://www.yeastgenome.org/locus/YGL007C-A YGL007C-A], [https://www.yeastgenome.org/locus/YGL063C-A YGL063C-A], [https://www.yeastgenome.org/locus/YGL123C-A YGL123C-A], [https://www.yeastgenome.org/locus/YGL188C-A YGL188C-A], [https://www.yeastgenome.org/locus/YGR031C-A YGR031C-A], [https://www.yeastgenome.org/locus/YGR068W-A YGR068W-A], [https://www.yeastgenome.org/locus/YGR146C-A YGR146C-A], [https://www.yeastgenome.org/locus/YGR174W-A YGR174W-A], [https://www.yeastgenome.org/locus/YGR204C-A YGR204C-A], [https://www.yeastgenome.org/locus/YGR270C-A YGR270C-A], [https://www.yeastgenome.org/locus/YGR296C-A YGR296C-A], [https://www.yeastgenome.org/locus/YGR296C-B YGR296C-B] <br> | ||
+ | Thanks to Kumar et al. for providing the coordinates of the following Chromosome VII ORFs: YGR270C-A, YGR296C-A, YGR296C-B, YGL007C-A, YGL063C-A, YGL123C-A, YGL188C-A, YGR031C-A, YGR068W-A, YGR146C-A, YGR174W-A, and YGR204C-A.<br> <br> | ||
+ | '''Kumar A, et al.''' (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073673 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11753363 PubMed] | [https://www.nature.com/articles/nbt0102-58 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11753363&db=pmid YFGdb] | [https://www.yeastgenome.org/reference/S000141796 Comments & Errata] <br> | ||
+ | |- | ||
+ | | 2003-07-29 | ||
+ | | [https://www.yeastgenome.org/locus/YGL006W-A YGL006W-A] <br> | ||
+ | Thanks to [https://bioinformatik.wzw.tum.de/index.php?id=63 MIPS] for providing the coordinates of YGL006W-A..<br> <br> | ||
+ | |- | ||
+ | | 2003-07-29 | ||
+ | | [https://www.yeastgenome.org/locus/YGL014C-A YGL014C-A], [https://www.yeastgenome.org/locus/YGL041W-A YGL041W-A], [https://www.yeastgenome.org/locus/YGR035W-A YGR035W-A] <br> | ||
+ | Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the following Chromosome VII ORFs: YGL014C-A, YGL041W-A and YGR035W-A.<br> <br> | ||
+ | '''Basrai MA, et al.''' (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000042214 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10490641 PubMed] | [https://mcb.asm.org/content/19/10/7041.long Full-Text] <br> | ||
+ | '''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br> | ||
+ | '''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073672 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] | [https://genome.cshlp.org/content/12/8/1210.long Full-Text] | [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br> | ||
+ | |- | ||
+ | | 2003-07-29 | ||
+ | | [https://www.yeastgenome.org/locus/YGR169C-A YGR169C-A] <br> | ||
+ | Thanks to Brachat et al. for providing the coordinates of YGR169C-A.<br> <br> | ||
+ | '''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br> | ||
+ | |- | ||
+ | | 2003-03-06 | ||
+ | | [https://www.yeastgenome.org/locus/snR82 snR82] <br> | ||
+ | Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8.<br> <br> | ||
+ | '''McCutcheon JP and Eddy SR''' (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000074006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12853629 PubMed] | [https://academic.oup.com/nar/article/31/14/4119/2904330 Full-Text] <br> | ||
+ | |- | ||
+ | | 2003-01-07 | ||
+ | | [https://www.yeastgenome.org/locus/YGL183C YGL183C] <br> | ||
+ | A new intron and in-frame 5' exon were added to MND1/YGL183C, changing the N-terminus and increasing the size of the protein from 174 aa to 219 aa. The relative coordinates of the coding region change from 1-525 to 1-3..87-743. Note that the stop remains unchanged. Thanks to Pinar Kondu (Yeast Proteome Database) for reporting this change to SGD.<br> <br> | ||
+ | '''Tsubouchi H and Roeder GS''' (2002) The Mnd1 protein forms a complex with hop2 to promote homologous chromosome pairing and meiotic double-strand break repair. Mol Cell Biol 22(9):3078-88. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000069966 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11940665 PubMed] | [https://mcb.asm.org/content/22/9/3078 Full-Text] <br> | ||
+ | |- | ||
+ | | 2003-03-06 | ||
+ | | [https://www.yeastgenome.org/locus/ARS701 ARS701] <br> | ||
+ | Courtesy of Prof. BiK Tye; based on Ph. D. thesis of Dr. Clarence Chan.<br> | ||
+ | |- | ||
+ | | 2000-12-01 | ||
+ | | [https://www.yeastgenome.org/locus/YGL033W YGL033W] <br> | ||
+ | The start of ORF YGL033W was moved 374 nucleotides downstream, and the existing intron was narrowed at both ends. The relative coordinates of the coding region change from 1-24..568-1101 to 1-55..126-727, and the chromosomal coordinates of the coding region change from 435247-435270..435814-436347 to 435621-435675..435746-436347.<br> | ||
+ | |- | ||
+ | | 2000-12-01 | ||
+ | | [https://www.yeastgenome.org/locus/YGR225W YGR225W] <br> | ||
+ | The stop of ORF YGR225W was moved 552 nucleotides downstream, and at the same time an intron was added at relative coordinates 1184-1276. The relative coordinates of the coding region change from 1-1230 to 1-1183..1277-1782, and the chromosomal coordinates of the coding region change from 945137-946366 to 945137-946319..946413-946918. Note that the start remains unchanged.<br> | ||
+ | |- | ||
+ | | 2000-07-14 | ||
+ | | [https://www.yeastgenome.org/locus/YGR029W YGR029W] <br> | ||
+ | The start of ORF YGR029W was moved 299 nucleotides upstream, and at the same time an intron was added at relative coordinates 87-169. The relative coordinates of the coding region change from 1-354 to 1-86..170-653, and the chromosomal coordinates of the coding region change from 543846-544199 to 543547-543632..543716-544199. Note that the stop remains unchanged.<br> | ||
+ | |- | ||
+ | | 2000-07-14 | ||
+ | | [https://www.yeastgenome.org/locus/YGL251C YGL251C] <br> | ||
+ | The start of ORF YGL251C was moved 575 nucleotides upstream, and at the same time an intron was added at relative coordinates 59-210. The relative coordinates of the coding region change from 1-3141 to 1-58..211-3716, and the chromosomal coordinates of the coding region change from 31061-27921 to 31636-31579..31426-27921. Note that the stop remains unchanged.<br> | ||
+ | |- | ||
+ | | 2000-05-19 | ||
+ | | [https://www.yeastgenome.org/locus/YGR001C YGR001C] <br> | ||
+ | Davis et al. 2000 demonstrated a second intron upstream of the annotated YGR001C ORF that extends the N-terminus by 55 amino acids (aa). The gene was previously annotated to chromosomal coordinates 497802-497128, with two exons at relative coordinates 1-349 and 443-675, for a predicted protein of 193 aa. The updated annotation is from chromosomal coordinates 498029-497128, with three exons at 1-35, 98-576, and 670-902, for a predicted protein of 248 aa.<br><br> | ||
+ | '''Davis CA, et al.''' (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000042737 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10734188 PubMed] | [https://academic.oup.com/nar/article/28/8/1700/1009222 Full-Text] <br> | ||
+ | |- | ||
+ | | 1999-07-17 | ||
+ | | [https://www.yeastgenome.org/locus/YGL244W YGL244W] <br> | ||
+ | The start of ORF YGL244W was moved 300 nucleotides upstream. The relative coordinates of the coding region change from 1-1377 to 1-1677, and the chromosomal coordinates of the coding region change from 41798-43174 to 41498-43174. Note that the stop remains unchanged.<br> | ||
+ | |- | ||
+ | | 1998-05-21 | ||
+ | | [https://www.yeastgenome.org/locus/YGR122C-A YGR122C-A] <br> | ||
+ | The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. <br><br> | ||
+ | The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.<br><br> | ||
+ | '''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br> | ||
+ | |||
+ | |} |
Latest revision as of 14:07, 21 April 2022
This page lists all sequence and annotation changes that have been made to the Chromosome VII systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome VII has been updated 125 times, affecting 87 features.
- The annotation of Chromosome VII has been updated 57 times, affecting 91 features.
- Current and past versions can be obtained from SGD's Download site.
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YGR067C | 622408 | 622408 | Substitution | A | T |
A single nucleotide substitution was made in the stop codon of ORF YGR067C, destroying it and increasing the length of the annotated protein by 10 amino acids.
New 622362 TCTTTGGCCATTATTTTATTTGGCTAAAAATTTCAATGTTTTTACTTTGTTTATTGTCAG 622421 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 622366 TCTTTGGCCATTATTTTATTTGGCTAAAAATTTCAATGTTTTAACTTTGTTTATTGTCAG 622425 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL197W | 125909 | 125910 | Substitution | CG | GC |
125487 | 125487 | Insertion | A | |||
125495 | 125495 | Deletion | A | |||
Nucleotide changes within the coding region of MDS3/YGL197W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 262-264 are now QSE rather than HPK, and residue 403 is now Alanine rather than Arginine.
New 125449 TAGACATCTATAACATCTCACAGAATTGCTGGCAATCCGAAA-CCATACCCAAACAACCG 125507 |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| Old 125454 TAGACATCTATAACATCTCACAGAATTGCTGGCA-TCCGAAAACCATACCCAAACAACCG 125512 New 125868 ATATACGATATTAACTCCGGAAAGTGGTCACGAGTCGCTACCGCCTGCCCTGACTGCGAT 125927 |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 125873 ATATACGATATTAACTCCGGAAAGTGGTCACGAGTCCGTACCGCCTGCCCTGACTGCGAT 125932 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL041C, YGL041W-A | 419056 | 419056 | Deletion | G | |
A single nucleotide was deleted within the coding regions of overlapping ORFs YGL041W-A and YGL041C, resulting in altered protein sequences for both ORFs. The YGL041W-A C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 72 amino acids longer. The YGL041C N-terminus remains the same, but the C-terminus has changed and the annotated protein is truncated by one-third of its length (reduced from 104 amino acids to 67 amino acids).
New 419013 ACTCATGGATCAAATAAATTCGAGGCCTAATGTTCTGG-AAAAGTTAGAAAAGGTTAGCA 419071 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Old 419018 ACTCATGGATCAAATAAATTCGAGGCCTAATGTTCTGGGAAAAGTTAGAAAAGGTTAGCA 419077 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL214W | 90019 | 90019 | Insertion | T | |
A single T nucleotide was inserted within ORF YGL214W very near its 5' end, altering its coding sequence. The reading frame and stop remain the same, but the start has been shifted downstream four nucleotides and the annotated protein is now one amino acid shorter.
New 89994 CCAAAAAGAATAATGGATGATTGTAAGGTTACATGCAATATATCAAGATATTACTAGAGA 90053 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 89999 CCAAAAAGAATAATGGATGAT-GTAAGGTTACATGCAATATATCAAGATATTACTAGAGA 90057 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL129C | 269097 | 269097 | Deletion | A | |
A single nucleotide was deleted within ORF RSM23/YGL129C, altering its coding sequence. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 38 amino acids shorter.
New 269076 TATTCTGATACGTATA-CCACGTGGCTTGTACTTGTTCTCTTGTTAATGTTTTCCCTCGA 269134 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 269081 TATTCTGATACGTATAACCACGTGGCTTGTACTTGTTCTCTTGTTAATGTTTTCCCTCGA 269140 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL056C | 397085 | 397086 | Substitution | CG | GC |
397241 | 397241 | Substitution | A | C | ||
Nucleotide changes within the coding region of SDS23/YGL056C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 180 is now Glycine rather than Alanine.
New 397060 GTGTCAACTTTACTATCTCGCCCACGGGCACGGACTTACCATTCTGGCAGTCTGAGGTTA 397119 ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 397066 GTGTCAACTTTACTATCTCCGCCACGGGCACGGACTTACCATTCTGGCAGTCTGAGGTTA 397125 New 397190 TGTTAAACAATTCATGTCTCCCGGAAAATTCTCCACAGGCAAAGACGTTAGCTGGTGCTT 397249 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 397196 TGTTAAACAATTCATGTCTCCCGGAAAATTCTCCACAGGCAAAGAAGTTAGCTGGTGCTT 397255 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR058W | 607109 | 607109 | Substitution | T | G |
A single nucleotide substitution within the coding region of PEF1/YGR058W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 324 is now Aspartic Acid rather than Tyrosine.
New 607062 TAATCAAGAAGGCATTGCAACCATACAGTACAAAGATTTTATCGATGCTACATTATATTT 607121 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 607066 TAATCAAGAAGGCATTGCAACCATACAGTACAAAGATTTTATCTATGCTACATTATATTT 607125 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR271W | 1033108 | 1033108 | Substitution | C | T |
1032373 | 1032373 | Substitution | G | A | ||
1031948 | 1031948 | Substitution | C | A | ||
Nucleotide substitutions within the coding region of SLH1/YGR271W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 51 is now Glutamine rather than Proline, residue 193 is now Lysine rather than Glutamic Acid, and residue 438 is now Serine rather than Proline.
New 1031905 TTTGATGACGAGCTAAAAAAAGTCCAAAAGGATGAACAAAATCAAAGAACTGAACTAACT 1031964 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 1031911 TTTGATGACGAGCTAAAAAAAGTCCAAAAGGATGAACCAAATCAAAGAACTGAACTAACT 1031970 New 1032325 CCAGAGTTCCTGACACAGCAAGATATCAGGAATCAAGTTTTGAAAAGTGCAGAGGATGCC 1032384 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 1032331 CCAGAGTTCCTGACACAGCAAGATATCAGGAATCAAGTTTTGGAAAGTGCAGAGGATGCC 1032390 New 1033055 AATTACTAATTATTGATGAAGTTCATTTACTGCACGAAGATAGAGGTTCGGTTATTGAAA 1033114 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 1033061 AATTACTAATTATTGATGAAGTTCATTTACTGCACGAAGATAGAGGTCCGGTTATTGAAA 1033120 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL109W | 303591 | 303591 | Substitution | A | C |
A single nucleotide substitution within the coding region of YGL109W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 26 is now Glutamine rather than Lysine.
New 303574 GAATGGAAGGCCAACAAAAAAATTCTTGTACAATTGCATATATTGATTCATTACAATATT 303633 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 303577 GAATGGAAGGCCAAAAAAAAAATTCTTGTACAATTGCATATATTGATTCATTACAATATT 303636 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR070W | 630688 | 630688 | Substitution | C | T |
A single nucleotide substitution within the coding region of ROM1/YGR070W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 960 is now Valine rather than Alanine.
New 630642 GTAAAAGAATCATTATGATTGCACATCATTTTTTGCACGCCGTACAATTATTGATTGTTA 630701 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 630646 GTAAAAGAATCATTATGATTGCACATCATTTTTTGCACGCCGCACAATTATTGATTGTTA 630705 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL059W | 392896 | 392896 | Insertion | A | |
392901 | 392901 | Deletion | A | |||
Nucleotide changes within the coding region of PKP2/YGL059W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 224-225 are now SI rather than VY.
New 392862 TCAAGAAGATTGATTGTAGAGGAACACGTCAGTAT-CACAGCCAACTACACTAGTGGTAA 392920 |||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| Old 392867 TCAAGAAGATTGATTGTAGAGGAACACGTC-GTATACACAGCCAACTACACTAGTGGTAA 392925 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL124C | 275965 | 275965 | Substitution | C | G |
276384 | 276384 | Substitution | A | T | ||
Nucleotide changes within the coding region of MON1/YGL124C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 113 is now Serine rather than Cysteine.
New 275925 GATTCAACAATTCGTTCGAGGACTCGCCTCTTTCGGATTGAGCCATTAGTAATATAGGTG 275984 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 275931 GATTCAACAATTCGTTCGAGGACTCGCCTCTTTCCGATTGAGCCATTAGTAATATAGGTG 275990 New 276345 TGTCCAAATAAGGACCGAAATCCTTTTTTGGACTGTTTAGTGCTCTCGTTGTATCATCAT 276404 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 276351 TGTCCAAATAAGGACCGAAATCCTTTTTTGGACAGTTTAGTGCTCTCGTTGTATCATCAT 276410 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR221C | 938725 | 938725 | Deletion | T | |
938792 | 938792 | Insertion | T | |||
Nucleotide changes within the coding region of TOS2/YGR221C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 69-91 are now EPSMQDFDPNFEGDLYYLPKMDS rather than NLLCRILTQILRAIYTIYRRWIT.
New 938681 TTCTGTGGCATTGCTGTCTGAGTTTGCAGAATTCATAGAAG-AATCCATCTTCGGTAAAT 938739 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 938684 TTCTGTGGCATTGCTGTCTGAGTTTGCAGAATTCATAGAAGTAATCCATCTTCGGTAAAT 938743 New 938740 AGTATAAATCGCCCTCAAAATTTGGGTCAAAATCCTGCATAGAAGGTTCTTTTTTGCATC 938799 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 938744 AGTATAAATCGCCCTCAAAATTTGGGTCAAAATCCTGCATAGAAGGTTC-TTTTTGCATC 938802 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR145W | 783805 | 783805 | Substitution | A | C |
A single nucleotide substitution within the coding region of ENP2/YGR145W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 678 is now Aspartic Acid rather than Glutamic Acid.
New 783751 ATTATAAATCCAGGCGTCATGATAATTCATCGGATGAAGAAGGTATTGACGAAAATGGTA 783810 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 783756 ATTATAAATCCAGGCGTCATGATAATTCATCGGATGAAGAAGGTATTGAAGAAAATGGTA 783815 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR153W | 796569 | 796570 | Substitution | AC | CA |
Nucleotide substitutions within the coding region of YGR153W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 158 is now Alanine rather than Aspartic Acid.
New 796531 TAAAACCGTGTGGTTGTCATAAATCGAGAAAAGCAAAATGCTTCAAAGAACTGGAGATGG 796590 ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 796536 TAAAACCGTGTGGTTGTCATAAATCGAGAAAAGACAAATGCTTCAAAGAACTGGAGATGG 796595 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR227W | 948219 | 948219 | Substitution | A | T |
A single nucleotide substitution within the coding region of DIE2/YGR227W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 266 is now Isoleucine rather than Lysine.
New 948200 GTTCTGCCCTATATGATAAATTTTGTTTTGTTCTTCATTTATCTGATTTGGAACAGATCC 948259 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 948203 GTTCTGCCCTATATGAAAAATTTTGTTTTGTTCTTCATTTATCTGATTTGGAACAGATCC 948262 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL063W | 384063 | 384064 | Substitution | CG | GC |
Nucleotide substitutions within the coding region of PUS2/YGL063W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 136 is now Cysteine rather than Serine.
New 384044 CGAAACGTGGGGGGATGCTACCGCGAAGACGGCTCGCAAGAGGTGTGGGATACGTTCCTG 384103 |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 384047 CGAAACGTGGGGGGATCGTACCGCGAAGACGGCTCGCAAGAGGTGTGGGATACGTTCCTG 384106 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | ARS714, tW(CCA)G1 | 286729 | 286729 | Deletion | T | |
286355 | 286355 | Insertion | C | |||
A single nucleotide insertion and a single nucleotide deletion were made in the intergenic region between ARS714 and tRNA-Trp tW(CCA)G1.
New 286305 CACCATTAACTTTACAACATTACATAATATGACATTCCACAGAACCTCTCTATTCCATTT 286364 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 286311 CACCATTAACTTTACAACATTACATAATATGACATTCCACAGAAC-TCTCTATTCCATTT 286369 New 286675 TGCATTTATCTCAGGATATAATGATCCCGTTATCCAATCGATATAGCTT-CCTCAGGTTT 286733 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 286680 TGCATTTATCTCAGGATATAATGATCCCGTTATCCAATCGATATAGCTTTCCTCAGGTTT 286739 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | ARS710 | 203957 | 203957 | Substitution | C | A |
A single nucleotide substitution was made within ARS710.
New 203926 AGATTTTTGATGTTTACATATGAGCAGTTTGATAGAAATTTTGCAATTTTTTATATTTAT 203985 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 203932 AGATTTTTGATGTTTACATATGAGCCGTTTGATAGAAATTTTGCAATTTTTTATATTTAT 203991 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL036W, YGL037C | 428252 | 428252 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs PNC1/YGL037C and YGL036W.
New 428202 ATTCACTTTTCCAGTACGTAACACCACGCGGCGCCCCTTTGTGGGGCCTGCCCCTTTTTT 428261 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 428208 ATTCACTTTTCCAGTACGTAACACCACGCGGCGCCCCTTTGTGGG-CCTGCCCCTTTTTT 428266 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | ARS734,YGR253C | 999367 | 999367 | Substitution | A | C |
999335 | 999335 | Insertion | C | |||
999271 | 999271 | Substitution | C | T | ||
Two separate single nucleotide substitutions and a single nucleotide insertion were made in the intergenic region between ORF PUP2/YGR253C and ARS734.
New 999218 AATTTCCTAGGTTACTCTTTTGCCACCGGTCTTGGTTTATGATAACCCTGTATAATGAAA 999277 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 999223 AATTTCCTAGGTTACTCTTTTGCCACCGGTCTTGGTTTATGATAACCCCGTATAATGAAA 999282 New 999318 AGCACTAAATTATCCTTACGGACTTGGGCTACATTCATGTTTGCACGCTTAATAAAAAAT 999377 ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| Old 999323 AGCACTAAATTAT-CTTACGGACTTGGGCTACATTCATGTTTGCAAGCTTAATAAAAAAT 999381 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | ARS734 | 999676 | 999676 | Deletion | T | |
A single nucleotide deletion was made within ARS734.
New 999628 CTGAGCTTTTATCTTCATTAATATATAGTAATTACAACATGTTA-TTGAAATGCACAGCA 999686 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 999632 CTGAGCTTTTATCTTCATTAATATATAGTAATTACAACATGTTATTTGAAATGCACAGCA 999691 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR216C, YGR217W | 924488 | 924488 | Insertion | C | |
924482 | 924482 | Insertion | A | |||
Two separate single nucleotide insertions were made in the intergenic region between ORFs GPI1/YGR216C and CCH1/YGR217W.
New 924451 GTAATTTGGCATGTCATTTAACTGTATAAAACCGCCCCTGAATTCGAAGGTTCCTGTTCA 924510 ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| Old 924456 GTAATTTGGCATGTCATTTAACTGTAT-AAACCG-CCCTGAATTCGAAGGTTCCTGTTCA 924513 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR054W | 598535 | 598535 | Substitution | C | T |
A single nucleotide substitution was made within ORF YGR054W. Note that the protein sequence was not affected.
New 598482 TAAAGAAATTAAGGGCTATTGAAACCTTGAAGGAAAGACAGGCCGTCGGTGACAAACTAG 598541 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 598486 TAAAGAAATTAAGGGCTATTGAAACCTTGAAGGAAAGACAGGCCGTCGGCGACAAACTAG 598545 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR236C, YGR237C | 962981 | 962981 | Deletion | T | |
A single nucleotide deletion was made in the intergenic region between ORFs SPG1/YGR236C and YGR237C.
New 962959 CCCTCACGTCGCGAAGCA-TTTTTAACAGTGTTATCCCAGTATCCCGTAATTCTTCTCTT 963017 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 962963 CCCTCACGTCGCGAAGCATTTTTTAACAGTGTTATCCCAGTATCCCGTAATTCTTCTCTT 963022 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL158W, tL(CAA)G1 | 206467 | 206467 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between tRNA-Leu tL(CAA)G1 and ORF RCK1/YGL158W.
New 206446 GAGACCCCGCCCTGCGGAGAGGGGCAAACAATTCTAGCAGAAAAAAATCAGTGGAAAAAA 206505 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 206452 GAGACCCCGCCCTGCG-AGAGGGGCAAACAATTCTAGCAGAAAAAAATCAGTGGAAAAAA 206510 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL145W | 230256 | 230256 | Substitution | C | T |
A single nucleotide substitution was made within ORF TIP20/YGL145W. Note that the protein sequence was not affected.
New 230206 TATTGTTTATAAGCATAGTCACAAGTGCATAAAAACTATGAACGGTATTGATGATCTCCT 230265 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 230211 TATTGTTTATAAGCATAGTCACAAGTGCATAAAAACTATGAACGGCATTGATGATCTCCT 230270 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL116W, YGL117W | 289567 | 289567 | Insertion | G | |
289527 | 289527 | Insertion | G | |||
289525 | 289525 | Insertion | G | |||
Three separate single nucleotide insertions were made in the intergenic region between ORFs YGL117W and CDC20/YGL116W.
New 289484 CAATTTGATTGCCGAAAGAGGCAAAACGTAAATAGGGTTGGTTTCAAATAATTAGAAGGA 289543 |||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| Old 289490 CAATTTGATTGCCGAAAGAGGCAAAACGTAAATAGG-TT-GTTTCAAATAATTAGAAGGA 289547 New 289544 GCATCGGAAAAATGCAACGAGCAAAACCTCTAGCAGGCAAAGAATTTATCACCTTTAAAA 289603 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 289548 GCATCGGAAAAATGCAACGA-CAAAACCTCTAGCAGGCAAAGAATTTATCACCTTTAAAA 289606 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL060W, YGL061C | 390008 | 390008 | Deletion | G | |
389965 | 389965 | Deletion | G | |||
Two separate single nucleotide deletions were made in the intergenic region between ORFs DUO1/YGL061C and YBP2/YGL060W.
New 389924 TCTAAAAGGCTAAAAGAACTCACCGTCAAGAGGAAGGG-CTCAGAAAGTATGGGTGAGTC 389982 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Old 389927 TCTAAAAGGCTAAAAGAACTCACCGTCAAGAGGAAGGGGCTCAGAAAGTATGGGTGAGTC 389986 New 389983 AATTGAAACAATTTGTAAAAG-CCTTGTCAGGGCTTTCCAAGAGGAGAAGGATGATTTTG 390041 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 389987 AATTGAAACAATTTGTAAAAGGCCTTGTCAGGGCTTTCCAAGAGGAGAAGGATGATTTTG 390046 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL058W, YGL059W | 393814 | 393814 | Deletion | G | |
A single nucleotide deletion was made in the intergenic region between ORFs PKP2/YGL059W and RAD6/YGL058W.
New 393761 CTACATTTCCCGGATTAGTGTATGTATATACAAAAAGGCACCTCCGGG-TAGCCGGAGTA 393819 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 393766 CTACATTTCCCGGATTAGTGTATGTATATACAAAAAGGCACCTCCGGGGTAGCCGGAGTA 393825 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL055W, YGL056C | 398069 | 398069 | Insertion | G | |
398035 | 398035 | Insertion | GC | |||
398033 | 398033 | Insertion | G | |||
398027 | 398027 | Deletion | G | |||
398014 | 398014 | Insertion | A | |||
397868 | 397868 | Deletion | A | |||
Several nucleotide sequence changes were made in the intergenic region between ORFs SCS23/YGL056C and OLE1/YGL055W.
New 397840 AAAAAAAAAAAAAAATAAATGA-CACATGGAAATAAGTCAAGGATTAGCGGATATGTAGT 397898 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 397846 AAAAAAAAAAAAAAATAAATGAACACATGGAAATAAGTCAAGGATTAGCGGATATGTAGT 397905 New 397959 CTAATCATTATGCACGTCAAGATTCTCCGTGACTATGGCTCTTTTCTGAAGCATTTTTCG 398018 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 397966 CTAATCATTATGCACGTCAAGATTCTCCGTGACTATGGCTCTTTTCTGA-GCATTTTTCG 398024 New 398019 GG-CGCCCGGTGGCCAAAAACTAACTCCGAGCCCGGGCATGTCCCGGGGTTAGCGGGCCC 398077 || |||||| || |||||||||||||||||||||||||||||||||| ||||||||||| Old 398025 GGGCGCCCG-TG--CAAAAACTAACTCCGAGCCCGGGCATGTCCCGGG-TTAGCGGGCCC 398080 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL054C, tE(UUC)G2 | 401427 | 401427 | Deletion | T | |
401422 | 401422 | Insertion | A | |||
A single nucleotide insertion and a single nucleotide deletion were made in the intergenic region between ORF ERV14/YGL054C and tRNA-Glu tE(UUC)G2.
New 401378 TGAGAAAAATCCAGGTCTCTCCTTCGTATTAAGGAATACATGATCTA-GCTATCACTCTT 401436 |||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| Old 401381 TGAGAAAAATCCAGGTCTCTCCTTCGTATTAAGGAATACATG-TCTATGCTATCACTCTT 401439 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL213C, YGL215W | 89751 | 89751 | Deletion | T | |
89749 | 89749 | Deletion | G | |||
89735 | 89735 | Substitution | G | C | ||
89610 | 89610 | Deletion | G | |||
89601 | 89601 | Insertion | A | |||
89587 | 89590 | Deletion | GTTA | |||
Several nucleotide sequence changes were made in the intergenic region between ORFs CLG1/YGL215W and SKI8/YGL213C.
New 89571 AAAGATTATTATTATTA----CTTTTTTTATTAGTACTCCA-TATGGACCTCTTAGGTGA 89625 ||||||||||||||||| ||||||||||| |||||||| |||||||||||||||||| Old 89570 AAAGATTATTATTATTAGTTACTTTTTTTATT-GTACTCCAGTATGGACCTCTTAGGTGA 89628 New 89706 GGAATAAAAACTATAAAAAATGAAAACCAAAAAAAAAAAG-C-ACTGGATTTTTAACATC 89763 |||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||| Old 89709 GGAATAAAAACTATAAAAAATGAAAAGCAAAAAAAAAAAGGCTACTGGATTTTTAACATC 89768 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL210W, YGL211W | 93660 | 93660 | Deletion | C | |
A single nucleotide deletion was made in the intergenic region between ORFs NCS6/YGL211W and YPT32/YGL210W.
New 93644 ATAGTACGGCGC-GCCCTCCATTAGAACGCGCAACACAATAAAGACAAATAAAAGAATCA 93702 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Old 93648 ATAGTACGGCGCCGCCCTCCATTAGAACGCGCAACACAATAAAGACAAATAAAAGAATCA 93707 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL209W, YGL210W | 95484 | 95484 | Insertion | AA | |
95471 | 95471 | Insertion | A | |||
95084 | 95084 | Deletion | A | |||
95082 | 95082 | Deletion | G | |||
94596 | 94596 | Insertion | T | |||
95447 | 95448 | Substitution | TA | AT | ||
95444 | 95444 | Deletion | A | |||
Several nucleotide sequence changes were made in the intergenic region between ORFs YPT32/YGL210W and MIG2/YFL209W.
New 94553 ACATATACCTTCCCAAGTTATTTATTACTAACCTTCGTTGCACGCAAGAAAAAATGTATT 94612 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Old 94558 ACATATACCTTCCCAAGTTATTTATTACTAACCTTCGT-GCACGCAAGAAAAAATGTATT 94616 New 95033 ATTAGAGCGTGTTTCGGAAAACAAACTCGCTCGATACAGTAATTG-C-GTTTTATTTACG 95090 ||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| Old 95037 ATTAGAGCGTGTTTCGGAAAACAAACTCGCTCGATACAGTAATTGGCAGTTTTATTTACG 95096 New 95391 CTTGCGTCAACTAGCTCTCCCCTTTCCCCATTGAAGTTAGCGTATTA-CCATCAGTTAAT 95449 ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| Old 95397 CTTGCGTCAACTAGCTCTCCCCTTTCCCCATTGAAGTTAGCGTATTAACCTACAGTTAAT 95456 New 95450 GATTGATAGGCTCATACGAAGAAGAAAAAAAGCCGGGATAAGAAACCCCGCCTCCACTTT 95509 ||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| Old 95457 GATTGATAGGCTCAT-CGAAGAAGAAAAA--GCCGGGATAAGAAACCCCGCCTCCACTTT 95513 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL045W, YGLWdelta10 | 413970 | 413970 | Deletion | G | |
413784 | 413784 | Deletion | A | |||
413409 | 413410 | Substitution | CG | GGC | ||
413366 | 413367 | Substitution | GC | CG | ||
413089 | 413089 | Deletion | G | |||
Several nucleotide sequence changes were made in the intergenic region between Ty1 LTR YGLWdelta10 and ORF RIM8/YGL045W.
New 413077 TCTACAGCCG-ACGGGCACTCTATGTATACTCATATCACAGCCACTGTTGCACTACATTA 413135 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 413079 TCTACAGCCGGACGGGCACTCTATGTATACTCATATCACAGCCACTGTTGCACTACATTA 413138 New 413316 TCGCACGGGTCTTCTGTGCGAATGAGCCACAACGGGGCCGAGTTCAGCGCGTGTCCGCCT 413375 ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 413319 TCGCACGGGTCTTCTGTGCGAATGAGCCACAACGGGGCCGAGTTCAGGCCGTGTCCGCCT 413378 New 413376 ACAACGTCCGCCAACTAGTGGCAATTGCTAGGCTACGCCGACCACGCTGACACGCACCGT 413435 |||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| Old 413379 ACAACGTCCGCCAACTAGTGGCAATTGCTACG-TACGCCGACCACGCTGACACGCACCGT 413437 New 413736 CTTAATCGCCTTTCTTTGTTTTCTTTCTTCGTTATTTGTTCTTGGA-CTTTTCCGCTCCA 413794 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 413738 CTTAATCGCCTTTCTTTGTTTTCTTTCTTCGTTATTTGTTCTTGGAACTTTTCCGCTCCA 413797 New 413925 TGTCTAAGCTCTATTGAGTCAAAAGTAACAATCTAGACGAAG-AAAAAAAAAAAATAGAA 413983 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 413928 TGTCTAAGCTCTATTGAGTCAAAAGTAACAATCTAGACGAAGGAAAAAAAAAAAATAGAA 413987 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL041C-B, YGL042C | 418633 | 418633 | Deletion | C | |
A single nucleotide deletion was made in the intergenic region between ORFs YGL042C and YGL041C-B.
New 418594 ATATACATATACTGCTGGTGTTAATTTTTTTTGTC-TGTCTCACGTAAAATCTTTTGTTC 418652 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old 418598 ATATACATATACTGCTGGTGTTAATTTTTTTTGTCCTGTCTCACGTAAAATCTTTTGTTC 418657 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR256W, tT(UGU)G2 | 1004546 | 1004546 | Insertion | T | |
1004338 | 1004338 | Deletion | T | |||
A single nucleotide deletion and a single nucleotide insertion were made in the intergenic region between tRNA-Thr tT(UGU)G2 and ORF GND2/YGR256W.
New 1004306 AGTATTAATAATTGAGGCGCCCCTAA-TTTTTTTGGCACCGCTCTCGATGAAAAAGTAGA 1004364 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 1004312 AGTATTAATAATTGAGGCGCCCCTAATTTTTTTTGGCACCGCTCTCGATGAAAAAGTAGA 1004371 New 1004495 GGAGTTAGCTCAAATATATATATATATATATATATGGAGACAACGTTTGAAGAATTCGTA 1004554 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 1004502 GGAGTTAGCTCAAATATATATATATATATATATATGGAGACAACG-TTGAAGAATTCGTA 1004560 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR255C, tT(UGU)G2 | 1004035 | 1004035 | Deletion | C | |
A single nucleotide deletion was made in the intergenic region between ORF COQ6/YGR255C and tRNA-Thr tT(UGU)G2.
New 1004007 AGTTACTGAATGAAGAAAATTAT-CGCCACAATTATATTTATTCCTTTTTAATGTCGTAT 1004065 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old 1004012 AGTTACTGAATGAAGAAAATTATCCGCCACAATTATATTTATTCCTTTTTAATGTCGTAT 1004071 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL208W | 98172 | 98172 | Substitution | G | A |
A single nucleotide substitution was made within ORF SIP2/YGL208W. Note that the protein sequence was not affected.
New 98150 TCGATCCTCAATTGCTCTACAAATTGGTAAGGATCCAGACGATTTTGGTGACGGATATAC 98209 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 98154 TCGATCCTCAATTGCTCTGCAAATTGGTAAGGATCCAGACGATTTTGGTGACGGATATAC 98213 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL200C, tK(CUU)G1 | 122568 | 122568 | Deletion | G | |
A single nucleotide deletion was made in the intergenic region bewteen tRNA-Lys tK(CUU)G1 and ORF EMP24/YGL200C.
New 122520 ACCATATATATGTATATATTTATTTACATGTAATTGGCACAGGG-AAAAACAGTGGAAGG 122578 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 122524 ACCATATATATGTATATATTTATTTACATGTAATTGGCACAGGGGAAAAACAGTGGAAGG 122583 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL195W, YGL196W | 131262 | 131262 | Deletion | G | |
A single nucleotide deletion was made in the intergenic region between ORFs DSD1/YGL196W and GCN1/YGL195W.
New 131208 TCTCTGTGTCTATGTAATTGTGTATCTATTTATAAATAGTAACTAAGAG-TAAGGTTGTA 131266 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 131213 TCTCTGTGTCTATGTAATTGTGTATCTATTTATAAATAGTAACTAAGAGGTAAGGTTGTA 131272 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL185C, YGL186C | 153012 | 153012 | Insertion | G | |
152961 | 152961 | Deletion | C | |||
A single nucleotide deletion and a single nucleotide insertion were made in the intergenic region between ORFs TPN1/YGL186C and YGL185C.
New 152927 GAAAATTTCAGGTGAGATAAGGTGCGGC-GAACAAATCCGAAATTTACTTACACGCAAGT 152985 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Old 152933 GAAAATTTCAGGTGAGATAAGGTGCGGCCGAACAAATCCGAAATTTACTTACACGCAAGT 152992 New 152986 ACGAGTCATACACCTACGGGGCACTGTACTACAATCCATTGTCGAAACAAAAACGGCACT 153045 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 152993 ACGAGTCATACACCTACGGG-CACTGTACTACAATCCATTGTCGAAACAAAAACGGCACT 153051 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR118W | 727144 | 727144 | Deletion | A | |
A single nucleotide deletion was made within the intron of ORF RPS23A/YGR118W.
New 727112 TTGTGAGCTCTGGAGTGATAAATTTATC-AGTAACATATCCTGGCGCAAATCAGTTTGGA 727170 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Old 727116 TTGTGAGCTCTGGAGTGATAAATTTATCAAGTAACATATCCTGGCGCAAATCAGTTTGGA 727175 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR233C, YGR234W | 958923 | 958923 | Deletion | C | |
A single nucleotide deletion was made in the intergenic region between ORFs PHO81/YGR233C and YHB1/YGR234W.
New 958890 GCAAGAATAATAGGGCACGGTACGTTCATT-CACGTAGCGTTAGCTAGTGCTGCCACAAG 958948 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Old 958893 GCAAGAATAATAGGGCACGGTACGTTCATTCCACGTAGCGTTAGCTAGTGCTGCCACAAG 958952 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR273C, YGR274C | 1039741 | 1039741 | Deletion | A | |
A single nucleotide deletion was made in the intergenic region between ORFs YGR273C and TAF1/YGR274C.
New 1039705 AATATGCACTTTTCATCTTACTGCAAAAGT-GCACATTCACACACCACGTCCATCGTTTA 1039763 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Old 1039711 AATATGCACTTTTCATCTTACTGCAAAAGTAGCACATTCACACACCACGTCCATCGTTTA 1039770 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR274C | 1042563 | 1042563 | Substitution | G | A |
1042313 | 1042313 | Substitution | A | G | ||
1042308 | 1042308 | Substitution | A | G | ||
1042185 | 1042185 | Substitution | A | G | ||
1042083 | 1042083 | Substitution | A | G | ||
1041870 | 1041870 | Substitution | C | T | ||
Six separate single nucleotide substitutions were made within ORF TAF1/YGR274C. Note that the protein sequence was not affected.
New 1041814 ATATCAAGTTACTACTATCCAGTTGTTGCTTTTGCTGCGCTAAATTATTTGTTTTCTCAA 1041873 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 1041821 ATATCAAGTTACTACTATCCAGTTGTTGCTTTTGCTGCGCTAAATTATTCGTTTTCTCAA 1041880 New 1042044 TCCGCCAAGGTTGCTGTTGATGAAGTACCTTGGTTGATGATTTTTTCTTGGTCCCAATCA 1042103 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Old 1042051 TCCGCCAAGGTTGCTGTTGATGAAGTACCTTGATTGATGATTTTTTCTTGGTCCCAATCA 1042110 New 1042164 TTTTGTTGCTCTTTGATAGGGAAAAGTTCATCAATGGAAACATGAATTAAACCTCTTCGG 1042223 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 1042171 TTTTGTTGCTCTTTAATAGGGAAAAGTTCATCAATGGAAACATGAATTAAACCTCTTCGG 1042230 New 1042284 GATATTGTCCTTGAGTTGAATAGCCTCTTATCATCCTGTTGAACCTTGAATTTCAAATTT 1042343 ||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| Old 1042291 GATATTGTCCTTGAGTTAAATAACCTCTTATCATCCTGTTGAACCTTGAATTTCAAATTT 1042350 New 1042524 CCATCTGACATATCTGGTTCCATGATAAATCCACCATTTATCGACATATCATTTCCATTA 1042583 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Old 1042531 CCATCTGACATATCTGGTTCCATGATAAATCCGCCATTTATCGACATATCATTTCCATTA 1042590 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL006W, YGL006W-A | 485901 | 485901 | Insertion | A | |
A single nucleotide insertion was made in the intergenic region between ORFs YGL006W-A and YGL006W.
New 485852 ACTTGAACAAATAAAGTTTAGAAAAGTGGTTCTAAAAAAAAAAAAACTGTGTGCGTAACA 485911 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 485857 ACTTGAACAAATAAAGTTTAGAAAAGTGGTTCTAAAAAAAAAAAA-CTGTGTGCGTAACA 485915 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR060W, snR48 | 610095 | 610095 | Substitution | A | G |
A single nucleotide substitution was made in the intergenic region between snoRNA SNR48 and ORF ERG25/YGR060W.
New 610052 ACGGCCACTGCCACTACCACTGCCTCCCTTCGTATACGGGACACAGAGATCGTATACGGT 610111 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old 610056 ACGGCCACTGCCACTACCACTGCCTCCCTTCGTATACGGAACACAGAGATCGTATACGGT 610115 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGLWdelta10, tV(AAC)G1 | 412393 | 412393 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between tRNA-Val tV(AAC)G1 and Ty1 LTR YGLWdelta10.
New 412357 ACCACGAAACCAGTTTTTTGATGTTTCGTTTAGGGACAAGAGTCCTATGAGAGTCCACTA 412416 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 412360 ACCACGAAACCAGTTTTTTGATGTTTCGTTTAGG-ACAAGAGTCCTATGAGAGTCCACTA 412418 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGR152C, YGR153W | 795986 | 795989 | Substitution | AAAA | GGGG |
A tetranucleotide substitution was made in the intergenic region between ORFs RSR1/YGR152C and YGR153W.
New 795941 TGAGTACTATTCGCCTTTTCCCATAAAGTTGTTTTTTTCTGGGGTTTATGTGTATCGTAA 796000 |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 795946 TGAGTACTATTCGCCTTTTCCCATAAAGTTGTTTTTTTCTAAAATTTATGTGTATCGTAA 796005 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL062W, YGL063W | 384846 | 384847 | Substitution | CG | GC |
A dinucleotide substitution was made in the intergenic region between ORFs PUS2/YGL063W and PYC1/YGL062W.
New 384824 GGCTATTCAACTTAGACAAGCGCCAGTTGCGCGCACAAATTTGGTCATGACCGCTCCACC 384883 ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 384827 GGCTATTCAACTTAGACAACGGCCAGTTGCGCGCACAAATTTGGTCATGACCGCTCCACC 384886 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YGL226C-A, YGL227W | 72712 | 72712 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs VID30/YGL227W and OST5/YGL226C-A.
New 72671 AATATTCTCATCCAAAATACTTCTTAAGTATAGTATATAATTTCATCGATAATTCCTTTA 72730 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 72671 AATATTCTCATCCAAAATACTTCTTAAGTATAGTATATAATT-CATCGATAATTCCTTTA 72729 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2007-12-11 | YGR271C-A, YGR272C | 1038054 | 1038054 | Insertion | C | |
Kastenmayer et al confirmed the insertion of one C nucleotide in YGR272C in an S288C strain background. As a consequence of this sequence change, YGR272C was merged into an adjacent ORF, YGR271C-A. This change extended YGR271C-A at the 5' end, increasing the size of the protein from 63 amino acids to 233 amino acids.
New TTCTACGCCCTTTGGGTCTGTAGATGGTGTATCATTCGGATATAGTGCAATATACTTTTC ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Old 1038046 TTCTACGCC-TTTGGGTCTGTAGATGGTGTATCATTCGGATATAGTGCAATATACTTTTC 1038104 Kastenmayer JP, et al.(2006) Functional genomics of genes with small open reading frames (sORFs) in S. cerevisiae. Genome Res 16(3):365-73. | ||||||
2005-11-29 | YGR225W, YGR226C | 946899 | 946899 | Insertion | T | |
Based on the automated comparison of related fungi, Brachat et al. (2003) suggest that the C-terminus of Ama1p/YGR225Wp be extended 31 amino acids. SGD has confirmed the insertion of a T after the T at 946899 and is supported by Cooper, et al (2000). As a consequence, YGR225W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 562 amino acids to 593 amino acids. In addition, YGR226C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 199 amino acids to 69 amino acids.
New ACTAACGATGAAACGATAAGATTTTATGAACTGTGGAACGATAAGGAGGAAATAATTAAT |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Old 946876 ACTAACGATGAAACGATAAGATTT-ATGAACTGTGGAACGATAAGGAGGAAATAATTAAT 946934 Cooper KF, et al. (2000) Ama1p is a meiosis-specific regulator of the anaphase promoting complex/cyclosome in yeast. Proc Natl Acad Sci U S A 97(26):14548-53. | ||||||
2005-11-22 | YGR236C | 962549 | 962549 | Deletion | G | |
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. (2003) suggest that the stop site for YGR236C be moved 101 nt upstream. SGD has confirmed the deletion of the G at 962549. As a consequence, YGR236C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 129 amino acids to 95 amino acids.
New CAAATTCCCTTACATGATTGAAGAG-AACATCAAATACGTTACTTCATCAT ||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 962523 CAAATTCCCTTACATGATTGAAGAGGAACATCAAATACGTTACTTCATCAT 962573 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-07-20 | YGL210W-A, YGL211W | 93254 | 93254 | Insertion | C | |
93425 | 93425 | Deletion | A | |||
93037 | 93037 | Insertion | C | |||
The work of Brachat et al. 2003 suggested potential sequence errors within and downstream of NCS6/YGL211W. SGD resequenced this region in S288C and found that the following sequence changes were necessary to correct the reference sequence: insertion of a single C nucleotide after the G at chromosomal coordinate 93037, insertion of a C after the C at 93254, and deletion of the A at 93425. As a consequence of these changes (1) NCS6/YGL211W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 193 to 359 amino acids and (2) YGL210W-A was merged into YGL211W.
Old 93001 TTTTAGAAGACAATCATTGGACCGTGGTGCTGCAAAG-TGGGCATATCTCACGTTGTCAC 93059 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| New 93001 TTTTAGAAGACAATCATTGGACCGTGGTGCTGCAAAGCTGGGCATATCTCACGTTGTCAC 93060 Old 93240 GCTGGATTATTTTTC-ACTGAGTGTACCTATGCCCCAGAAGCGTTTAGGGGCACTGCGAG 93298 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| New 93241 GCTGGATTATTTTTCCACTGAGTGTACCTATGCCCCAGAAGCGTTTAGGGGCACTGCGAG 93300 Old 93419 TGTTGAACGGCAATAGATGCGCTAGATGTGGATATCTGTCGTCAAATAACATTTGCAAGG 93478 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| New 93421 TGTTGA-CGGCAATAGATGCGCTAGATGTGGATATCTGTCGTCAAATAACATTTGCAAGG 93479 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. | ||||||
2004-07-19 | YGL196W | 130260 | 130260 | Substitution | A | C |
130106 | 130106 | Insertion | C | |||
130298 | 130298 | Deletion | C | |||
130416 | 130416 | Deletion | G | |||
131047 | 131047 | Insertion | A | |||
The work of Kellis et al. 2003 predicted insertion of a single nucleotide downstream of YGL196W; SGD resequenced this region, as well as the region upstream of YGL196W, and confirmed 5 separate sequence errors in the regions flanking YGL196W. SGD has made the following corrections to the reference sequence: insertion of a single C nucleotide after the C at 130106, transversion of A to C at 130260, deletion of a C at 130298, deletion of a G at 130416, and insertion of an A after the A at 131047. As a consequence of these sequence changes, YGL196W was extended at both the 5' and the 3' ends, altering both the N- and C-termini without changing the translation frame, and increasing the size of the predicted protein from 165 to 428 amino acids.
N-terminus: Old: 130079 ACTTTGAAACAATTGGGCCACGGACTTC-ATTGGCTAAACGCACTACAAGAGCCATATTA 130137 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| New: 130080 ACTTTGAAACAATTGGGCCACGGACTTCCATTGGCTAAACGCACTACAAGAGCCATATTA 130139 Old: 130258 AGAAATTTGTCAAGAAGGGTGAATAATTTTCAGGTTTTTGCTTGATAACATTGAACACTT 130317 || ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| New: 130260 AGCAATTTGTCAAGAAGGGTGAATAATTTTCAGGTTTTTG-TTGATAACATTGAACACTT 130318 Old: 130378 GGTTGATATGGGGACTAAGAGGGCAGGTCTTGCTTTCGGACTCTCCAGAATTTTTGAGTC 130437 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| New: 130379 GGTTGATATGGGGACTAAGAGGGCAGGTCTTGCTTTCG-ACTCTCCAGAATTTTTGAGTC 130437 C-Terminus: Old: 131038 CTCCATTAAA-TTAGGCAGCAAAATTGCCGTCCTTCCTCAACACGCTTGTATCACAATGG 131096 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| New: 131038 CTCCATTAAAATTAGGCAGCAAAATTGCCGTCCTTCCTCAACACGCTTGTATCACAATGG 131097 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-07-15 | YGR231C | 952555 | 952555 | Deletion | A | |
The work of Kellis et al. 2003 predicted the deletion of a single A nucleotide at chromosomal coordinate 952555; this sequence error was confirmed in S288C by SGD. As a consequence of this sequence change, PHB2/YGR231C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 315 to 310 amino acids.
Old 952500 CTTAACATTGTTACTCAATTCTTAAAGATAATATCTAGCCTTCGCTATTTATTTGACCCC 952559 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| New 952501 CTTAACATTGTTACTCAATTCTTAAAGATAATATCTAGCCTTCGCTATTTATTTG-CCCC 952559 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-07-15 | YGL236C | 53811 | 53811 | Insertion | C | |
The work of Kellis et al. 2003 predicted the insertion of a single C nucleotide after the C at chromosomal coordinate 53811; this sequence error was confirmed in S288C by SGD. As a consequence of this sequence change, MTO1/YGL236C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 679 to 669 amino acids.
Old 53761 TATACAAGCTAACGATTAAAGGATATTTACATGACTGGTTGGCTTGGCTTC-GTGCCACA 53819 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| New 53761 TATACAAGCTAACGATTAAAGGATATTTACATGACTGGTTGGCTTGGCTTCCGTGCCACA 53820 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-01-23 | YGL198W | 124271 | 124271 | Deletion | T | |
124331 | 124331 | Deletion | T | |||
124279 | 124279 | Insertion | C | |||
124251 | 124251 | Insertion | C | |||
Kellis et al. 2003 predicted and confirmed four sequence errors in YGL198W: the insertion of a single C nucleotide after the C at chromosomal coordinate 124251, and the deletion of a single T at 124271, the insertion of a single C after the C at 124279, and the deletion of a single T at 124331. As a consequence of these sequence changes, YGL198W was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 261 to 235 amino acids.
New 124234 CCATTATCGAGATATACCCTCTGGCACTCTGTCTTTTT-GGCATGGCCTGGTTGTCAACT 124290 |||||||||||||||||| ||||||||||||||||||| |||||||| |||||||||||| Old 124234 CCATTATCGAGATATACC-TCTGGCACTCTGTCTTTTTTGGCATGGC-TGGTTGTCAACT 124291 New 124291 ATTTTATAACACTAGTTACATATGTATAAAACCCAATAT-CATGGACATAGAATTGCCTA 124351 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old 124292 ATTTTATAACACTAGTTACATATGTATAAAACCCAATATTCATGGACATAGAATTGCCTA 124351 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-01-23 | YGL201C | 120375 | 120375 | Substitution | C | G |
A single C nucleotide at chromosomal coordinate 120375 was changed to a G, altering the coding sequence of MCM6/YGL201C. The start, stop, and reading frame remain the same, but protein residue 179 is now a proline rather than an alanine. See GenBank Accession AY258324. Thanks to Andrea Duina and F. Winston for resequencing this region in S288c.
New 120335 TACTTTCTTACTACTCTTCTTAAACCCTTTTGTAAAAAAGGCAAAAATCTGTAATATTGT 120394 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old 120335 TACTTTCTTACTACTCTTCTTAAACCCTTTTGTAAAAAAGCCAAAAATCTGTAATATTGT 120394 | ||||||
2004-01-22 | YGR006W | 506672 | 506672 | Insertion | G | |
Kellis et al. predicted and confirmed the insertion of a single G nt. As a consequence of this sequence change, YGR006W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 219 to 251 amino acids.
New 506640 ATGTGGCCTGGCCTATTGGTGTTACTAGCGTAGGCATTCATGCTCGTAGTGCACATTCGA 506699 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 506640 ATGTGGCCTGGCCTATTGGTGTTACTAGCGTAG-CATTCATGCTCGTAGTGCACATTCGA 506698 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2003-01-09 | YGL045W, YGL046W | 414910 | 414910 | Insertion | C | |
414883 | 414883 | Insertion | A | |||
414983 | 414983 | Insertion | CC | |||
415042 | 415042 | Deletion | G | |||
Due to the following changes to the systematic sequence of Chromosome VII, YGL045W and YGL046W have been merged into one single larger ORF: A insertion at 414883, C insertion at 414910, CC insertion at 414983, and G deletion at 415042. RIM8 is the standard name for the new merged ORF; YGL046W is now an alias of RIM8/YGL045W. We thank Claude Gaillardin and Aaron P. Mitchell for reporting this sequence error to SGD.
Old 414838 TTCTAGCAGTTCAGTAAACTCCAAGACGTCCCCCTTACCAAATAAA-CGGTGACTATATC 414896 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| New 414841 TTCTAGCAGTTCAGTAAACTCCAAGACGTCCCCCTTACCAAATAAAACGGTGACTATATC 414900 Old 414897 CGTAGACATAC-GCAGGCTGGATTCATGATTGGTGAAATTATCCCTATAGACGTTAAGAT 414955 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| New 414901 CGTAGACATACCGCAGGCTGGATTCATGATTGGTGAAATTATCCCTATAGACGTTAAGAT 414960 Old 414956 TGACCACTATAAGCCTTTCTATGCC--TGCGGGTCTCACCACCACTTTGGTGAGGATATG 415013 ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| New 414961 TGACCACTATAAGCCTTTCTATGCCCCTGCGGGTCTCACCACCACTTTGGTGAGGATATG 415020 Old 415014 TAGGGTGGGCGGTGCAGGCAAAGATGGATCCTATGGAGACTTTCAGAAAAGATATATGTC 415073 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| New 415021 TAGGGTGGGCGGTGCAGGCAAAGATG-ATCCTATGGAGACTTTCAGAAAAGATATATGTC 415079 Treton B, et al.(2003) Ambient pH signalling in ascomycetous yeasts involves homologues of the Aspergillus nidulans genes palF and paIH. Mol Gen Genet 263(3):505-13. | ||||||
2003-01-06 | YGL125W | 273208 | 273209 | Substitution | AT | GC |
273061 | 273061 | Insertion | CG | |||
273111 | 273112 | Substitution | AC | CA | ||
273049 | 273049 | Insertion | A | |||
Due to the insertion of an A after the A at coordinate 273049, a CG insertion after the A at 273061, a substitution of AC at 273111-273112 with CA, and a substitution of AT at 273208-273209 with GC, the coordinates for the ORF YGL125W have changed to 272524-274326. The old coordinates for YGL125W were 272524-274323. Thanks to Dean Appling and Sherwin Chan for reporting this sequence error on Chromosome VII to SGD.
Old 273001 CATCCGGAGTTGCCTAACAAAGACGTGAAGCTTGATCTCGAGTATTTGA-GCAGAAGATC 273059 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| New 273001 CATCCGGAGTTGCCTAACAAAGACGTGAAGCTTGATCTCGAGTATTTGAAGCAGAAGATC 273060 Old 273060 GA--CCGGCGGCGACTTCATCATCACTCAGATGTTTTACGATGTTGATAATTTACTCAAC 273117 || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| New 273061 GACGCCGGCGGCGACTTCATCATCACTCAGATGTTTTACGATGTTGATAATTTCATCAAC 273120 Old 273118 TGGTGTTCCCAAGTTAGAGCTGCGGGCATGGACGTGCCCATTATTCCCGGGATCATGCCG 273177 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| New 273121 TGGTGTTCCCAAGTTAGAGCTGCGGGCATGGACGTGCCCATTATTCCCGGGATCATGCCG 273180 Old 273178 ATCACTACCTACGCGGCCTTCTTGAGAAGGATCCAATGGGGCCAAATCTCCATCCCTCAA 273237 |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| New 273181 ATCACTACCTACGCGGCCTTCTTGAGAAGGGCCCAATGGGGCCAAATCTCCATCCCTCAA 273240 Brachmann CB, et al. (1998) Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14(2):115-32. | ||||||
2003-01-03 | YGL059W | 393525 | 393525 | Insertion | A | |
In 2001, Lubo Tomaska and Yde Steensma reported that they had resequenced the C-terminal part of YGL059W and found that a single A nucleotide was missing between relative coordinates 1303 and 1304 in the reference sequence. As a consequence, the predicted protein should be 46 amino acids longer than originally annotated. This corresponds to the prediction based on comparative genomics by Blandin et al. 2000. SGD verified this change through resequencing of the region in strain FY1679, a derivative of S288c, and inserted an A after the A at chromosomal coordinate 393525 in the systematic sequence of Chromosome VII. As a result of this change, the new coordinates are 39223-393698, extending the predicted length of the protein from 445 amino acids to 491 amino acids.
Old 393481 TAAATGGGCACATCAAATATGAAACTCCCCTAATTGAATTGTTAA-GCGGTCTTTTAGAT 393539 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| New 393481 TAAATGGGCACATCAAATATGAAACTCCCCTAATTGAATTGTTAAAGCGGTCTTTTAGAT 393540 Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6. | ||||||
2000-06-16 | YGR113W | 719761 | 719761 | Insertion | C | |
Iain Cheeseman reported that a single frameshift 874 bp into the open reading frame at chromosomal coordinate 719761 (TATAC to TATCAC) results in a different coding sequence for the last 44 amino acids and a different stop codon 24 bp downstream from the sequence originally stored in SGD. The Candida DAM1 homolog is more similar to the sequence that Iain Cheeseman reports. SGD incorporated this sequence change on 2001-05-31.
Old 719701 TACCCATCGAAAACGACAATGTTGTTAATTTGGGAGATCTGCATCCAAATAATCGAATAT 719760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| New 719701 TACCCATCGAAAACGACAATGTTGTTAATTTGGGAGATCTGCATCCAAATAATCGAATAT 719760 Old 719761 -ACTCGGAAGTGGTGCTGCAAGAGTGGTCAATGGGCCCGTTACGAAGAACAGAAATTCAA 719819 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| New 719761 CACTCGGAAGTGGTGCTGCAAGAGTGGTCAATGGGCCCGTTACGAAGAACAGAAATTCAA 719820 |
Annotation Changes without sequence changes
Date | Affected Features |
---|---|
2021-04-21 | ROK1/YGL171W Two new uORFs
|
2021-04-21 | OTO1/YGR227C-A New ORF
|
2014-11-19 | ARS737 The coordinates of the ARS consensus sequence annotated within ARS737 were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2. |
2014-11-19 | ARS716, ARS720, ARS722, ARS729, ARS734 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome VII based on Liachko et al. 2013: ARS716, ARS720, ARS722, ARS729, ARS734. |
2014-11-19 | ARS702, ARS707, ARS714, ARS716, ARS718, ARS727, ARS728, ARS737, ARS734 The chromosomal coordinates of the following ARS elements on Chromosome VII were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS702, ARS707, ARS714, ARS716, ARS718, ARS727, ARS728, ARS737, ARS734. |
2014-11-19 | RME3 RME3 was added to the genome annotation and assigned genomic coordinates based on Xu et al. 2009 and Gelfand et al. 2011 as part of SGD's genome annotation revision R64.2. |
2014-11-19 | RME2 RME2 was added to the genome annotation and assigned genomic coordinates based on Yassour et al. 2010 and Gelfand et al. 2011 as part of SGD's genome annotation revision R64.2. |
2014-11-18 | YGL033W A second intron and third coding region were added to the annotation of HOP2/YGL033W as part of SGD's genome annotation revision R64.2. Old coordinates: CDS 1-55 435625..435679 intron 56-125 435680..435749 CDS 126-727 435750..436351 New coordinates: CDS 1-55 435625..435679 - stays the same intron 56-125 435680..435749 - stays the same CDS 126-688 435750..436312 - new coordinates intron 689-750 436313..436374 - new intron CDS 751-777 436375..436401 - new coding region Chan YL, et al. (2014) The Third Exon of the Budding Yeast Meiotic Recombination Gene HOP2 Is Required for Calcium-dependent and Recombinase Dmc1-specific Stimulation of Homologous Strand Assimilation. J Biol Chem 289(26):18076-18086. |
2014-11-18 | ETC1, ETC2, ETC3, ETC4, ETC6, ETC7, ETC8 The following previously unmapped features were identified as nuclear matrix attachment sites and assigned chromosomal coordinates based on Hiraga et al. 2012 as part of SGD's genome annotation revision R64.2: ETC1, ETC2, ETC3, ETC4, ETC6, ETC7, ETC8. |
2009-05-07 | ARS709, ARS712, ARS715, ARS723, ARS735, ARS736 The following ARS elements on Chromosome 7 were added to the genome annotation based on Raveendranathan et al. 2006: ARS709, ARS712, ARS715, ARS723, ARS724, ARS735, and ARS736. |
2008-06-02 | YGL256W The start of ADH4/YGL256W was moved 249 nt downstream, based on Williams & Paquin 1987 and Lyons et al. 2000, who state that Met84 appears to be the true translational start. See also GenBank X05992. |
2007-05-08 | snR46 Updated coordinates of snR46 based on GenBank Z72814, U56647, Z72815. Shifted entire feature downstream 1 nucleotide. |
2007-04-04 | YGR148C RPL24B/YGR148C mRNA contains an intron in the 5' untranslated region (UTR). |
2007-04-04 | YGR027C RPS25A/YGR027C mRNA contains an intron in the 5' untranslated region (UTR). |
2007-04-04 | YGL189C RPS26A/YGL189C mRNA contains an intron in the 5' untranslated region (UTR).. |
2007-04-04 | YGL187C COX4/YGL187W mRNA contains an intron in the 5' untranslated region (UTR). |
2007-04-04 | YGL031C RPL24A/YGL031C mRNA contains an intron in the 5' untranslated region (UTR). |
2006-10-05 | YGR034W Based on N-terminal sequencing (Otaka E. et al) and conservation with RPL26A, the first exon of RPL26B was moved upstream. The new first exon is 19 nts in length (the previous first exon was 25 nts), and the new start codon is 117 nt upstream of the previously annotated start. The 5' end of the intron has been extended upstream, but the 3' end of the intron remains the same, as does the second exon. The protein product is now two residues shorter and altered at the N-terminus. Special thanks to Ivo Pedruzzi and the team at Swiss-Prot for bringing this to our attention. |
2006-10-03 | ARS737 ARS737, also known as ARS731.5, was added to the genome annotation based on Nieduszynski et al. 2006. |
2006-10-03 | ARS702, ARS704, ARS707, ARS710, ARS714, ARS717, ARS718, ARS719, ARS721, ARS727, ARS728, ARS729, ARS731, ARS733 ARS Consensus Sequences (ACS elements) were annotated in the following ARS elements on Chromosome VII based on Nieduszynski et al. 2006: ARS702, ARS704, ARS707, ARS710, ARS714, ARS717, ARS718, ARS719, ARS721, ARS727, ARS728, ARS729, ARS731, ARS733. |
2006-09-08 | ARS702, ARS704, ARS707, ARS710, ARS714, ARS716,ARS717, ARS718, ARS719, ARS720, ARS721, ARS722, ARS727, ARS728, ARS729, ARS731, ARS733, ARS734 The following new ARS elements on Chromosome VII were added to SGD based on Nieduszynski et al. 2006: ARS702, ARS704, ARS707, ARS710, ARS714, ARS716, ARS717, ARS718, ARS719, ARS720, ARS721, ARS722, ARS727, ARS728, ARS729, ARS731, ARS733, ARS734. |
2006-05-09 | CEN7 The previously annotated 3' boundary of CEN7 was moved 1 bp upstream to coincide with the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae. |
2006-04-12 | ARS706 ARS706, also known as "ARO8 ARS", was added to the genome annotation for Chromosome VII at coordinates 117565-117858 based on Wyrick et al. 2001 and Iraqui et al. 1998. |
2006-01-23 | YGR088W Based on based on 5' SAGE TSS and multiple orthologous sequences alignment, Zhang and Dietrich suggest that the start site CTT1/YGR088W be moved 33 nt (11 codons) downstream. This is the same start codon published in the initial characterization by Hartig and Ruis. This change has been incorporated into SGD and the numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. |
2005-11-10 | YGL194C-A Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that this new ORF, YGL194C-A, be added to the S. cerevisiae genome annotation. |
2005-11-01 | YGL194C-A Identified based on conservation in closely related fungi. |
2004-10-12 | CEN7 The orientation of this centromere was reversed (from Watson to Crick) and its coordinates expanded to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. (2001) and Espelin et al. (2003). |
2004-08-27 | YGR161W-C The ORF YGR161W-C was added per Blandin et al. Note that this ORF was originally published using the systematic name "YGR161W-A;" however, the systematic name "YGR161W-A" had already been used to refer to a TyA Gag protein downstream of the new ORF predicted by Blandin et al. |
2004-04-01 | snR82 Start and stop coordinates updated per McCutcheon & Eddy 2004. |
2004-04-01 | snR7-L, snR7-S 5' chromosomal coordinate of both snR7-L and snR7-S changed to that experimentally determined in Patterson, B and Guthrie, C. (1987). |
2003-09-22 | YGR095C Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for RRP46/YGR095C was moved 99 nt (33 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) this is the form of the protein detected in analyses by Synowsky et al. |
2003-09-22 | YGR275W Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for RTT102/YGR275W was moved 87 nt (29 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-22 | YGL240W Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for DOC1/YGL240W was moved 99 nt (33 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-22 | YGL250W Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for YGL250W was moved 12 nt (4 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-22 | YGR201C Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for YGR201C was moved 147 nt (49 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-22 | YGL025C Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for PGD1/YGL025C was moved 102 nt (34 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-22 | YGR120C Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for COG2/YGR120C was moved 39 nt (13 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-22 | YGL245W Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for YGL245W was moved 48 nt (16 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-22 | YGL128C Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for CWC23/YGL128C was moved 192 nt (64 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-22 | YGR057C Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for LST7/YGR057C was moved 9 nt (3 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-09 | TEL07L, TEL07R The chromosomal locations for TEL07L, TEL07L-TR, TEL07L-XC, TEL07L-XR, TEL07R, TEL07R-XC, TEL07R-XR, and TEL07R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK). |
2003-07-29 | YGL041C-B, YGL210W-A, YGR121W-A, YGR240C-A Thanks to Kessler et al. for providing the coordinates of the following Chromosome VII ORFs: YGR240C-A, YGL210W-A, YGR121W-A, and YGL041C-B. |
2003-07-29 | YGL007C-A, YGL063C-A, YGL123C-A, YGL188C-A, YGR031C-A, YGR068W-A, YGR146C-A, YGR174W-A, YGR204C-A, YGR270C-A, YGR296C-A, YGR296C-B Thanks to Kumar et al. for providing the coordinates of the following Chromosome VII ORFs: YGR270C-A, YGR296C-A, YGR296C-B, YGL007C-A, YGL063C-A, YGL123C-A, YGL188C-A, YGR031C-A, YGR068W-A, YGR146C-A, YGR174W-A, and YGR204C-A. |
2003-07-29 | YGL006W-A Thanks to MIPS for providing the coordinates of YGL006W-A.. |
2003-07-29 | YGL014C-A, YGL041W-A, YGR035W-A Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the following Chromosome VII ORFs: YGL014C-A, YGL041W-A and YGR035W-A. |
2003-07-29 | YGR169C-A Thanks to Brachat et al. for providing the coordinates of YGR169C-A. |
2003-03-06 | snR82 Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8. |
2003-01-07 | YGL183C A new intron and in-frame 5' exon were added to MND1/YGL183C, changing the N-terminus and increasing the size of the protein from 174 aa to 219 aa. The relative coordinates of the coding region change from 1-525 to 1-3..87-743. Note that the stop remains unchanged. Thanks to Pinar Kondu (Yeast Proteome Database) for reporting this change to SGD. |
2003-03-06 | ARS701 Courtesy of Prof. BiK Tye; based on Ph. D. thesis of Dr. Clarence Chan. |
2000-12-01 | YGL033W The start of ORF YGL033W was moved 374 nucleotides downstream, and the existing intron was narrowed at both ends. The relative coordinates of the coding region change from 1-24..568-1101 to 1-55..126-727, and the chromosomal coordinates of the coding region change from 435247-435270..435814-436347 to 435621-435675..435746-436347. |
2000-12-01 | YGR225W The stop of ORF YGR225W was moved 552 nucleotides downstream, and at the same time an intron was added at relative coordinates 1184-1276. The relative coordinates of the coding region change from 1-1230 to 1-1183..1277-1782, and the chromosomal coordinates of the coding region change from 945137-946366 to 945137-946319..946413-946918. Note that the start remains unchanged. |
2000-07-14 | YGR029W The start of ORF YGR029W was moved 299 nucleotides upstream, and at the same time an intron was added at relative coordinates 87-169. The relative coordinates of the coding region change from 1-354 to 1-86..170-653, and the chromosomal coordinates of the coding region change from 543846-544199 to 543547-543632..543716-544199. Note that the stop remains unchanged. |
2000-07-14 | YGL251C The start of ORF YGL251C was moved 575 nucleotides upstream, and at the same time an intron was added at relative coordinates 59-210. The relative coordinates of the coding region change from 1-3141 to 1-58..211-3716, and the chromosomal coordinates of the coding region change from 31061-27921 to 31636-31579..31426-27921. Note that the stop remains unchanged. |
2000-05-19 | YGR001C Davis et al. 2000 demonstrated a second intron upstream of the annotated YGR001C ORF that extends the N-terminus by 55 amino acids (aa). The gene was previously annotated to chromosomal coordinates 497802-497128, with two exons at relative coordinates 1-349 and 443-675, for a predicted protein of 193 aa. The updated annotation is from chromosomal coordinates 498029-497128, with three exons at 1-35, 98-576, and 670-902, for a predicted protein of 248 aa. |
1999-07-17 | YGL244W The start of ORF YGL244W was moved 300 nucleotides upstream. The relative coordinates of the coding region change from 1-1377 to 1-1677, and the chromosomal coordinates of the coding region change from 41798-43174 to 41498-43174. Note that the stop remains unchanged. |
1998-05-21 | YGR122C-A The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. |