Difference between revisions of "Chromosome VI History"

From SGD-Wiki
Jump to: navigation, search
(→‎Sequence Changes)
(→‎Annotation Changes without sequence changes)
 
(4 intermediate revisions by the same user not shown)
Line 420: Line 420:
 
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2004-02-05
 +
| [https://www.yeastgenome.org/locus/YFR038W YFR038W] <br>
 +
| 231670
 +
| 231670
 +
| Deletion
 +
| G
 +
|
 +
|-
 +
| || colspan="6" | Based on the automated comparison of related fungi, Kellis et al. and Brachat et al. suggested that the stop site for YFR038W be moved 226 nt downstream. Hui-fen Kuo and Eric Richards resequenced this portion of the genome and found that a G nt. should be deleted (personal communication to SGD). This sequence error was confirmed by SGD. As a consequence of this sequence change, YFR038W was extended 226 nt at the 3' end, altering the the C-terminus and increasing the size of the predicted protein from 778 to 853 amino acids.
 +
<pre>New: 231648 AAAAATTGGCGTTAAATGAAGG-TTCTTTTTTGAAGGCAAA 231687
 +
            |||||||||||||||||||||| ||||||||||||||||||
 +
Old: 231648 AAAAATTGGCGTTAAATGAAGGGTTCTTTTTTGAAGGCAAA 231688</pre>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
 +
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2004-02-05
 +
| [https://www.yeastgenome.org/locus/YFR045W YFR045W] <br>
 +
| 242181
 +
| 242181
 +
| Insertion
 +
|
 +
| G
 +
|-
 +
| || colspan="6" | Based on the automated comparison of related ''Saccharomyces'' species, Kellis et al. and Brachat et al. suggested that the start site for YFR045W be moved 320 nt upstream. Belenkiy R et al. demonstrated a G nt insertion in that region and this sequence change was confirmed in S288c, by SGD. As a consequence of this sequence change, YFR045W was extended 320 nt at the 5' end, altering the the N-terminus and increasing the size of the predicted protein from 537 to 858 amino acids. Note that Belenkiy et al. also demonstrated a silent G to C substitution 701 nts downstream from the new start site; however, SGD could not confirm this sequence change in S288c, so it has not been incorporated.
 +
<pre>New: 242152 TAAAGACTGGTTTACAATTGCAACCGAAGGGTACCGCTTTCGAAATCATTTTACCTCAGA 242211
 +
            |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
 +
Old: 242152 TAAAGACTGGTTTACAATTGCAACCGAAGG-TACCGCTTTCGAAATCATTTTACCTCAGA 242210</pre>
 +
'''Belenkiy R, et al.''' (2000) The yeast mitochondrial transport proteins: new sequences and consensus residues, lack of direct relation between consensus residues and transmembrane helices, expression patterns of the transport protein genes, and protein-protein interactions with other proteins. Biochim Biophys Acta 1467(1):207-18. <br>
 +
[https://www.yeastgenome.org/reference/S000049213 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10930523 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0005273600002224?via%3Dihub Full-Text] <br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
 +
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2003-09-26
 +
| [https://www.yeastgenome.org/locus/YFR050C YFR050C], [https://www.yeastgenome.org/locus/YFR051C YFR051C] <br>
 +
| 250082
 +
| 250082
 +
| Deletion
 +
| G
 +
|
 +
|-
 +
| || colspan="6" | A single G nucleotide was deleted from the intergenic region between ORFs YFR050C and YFR051C.
 +
<pre>Old: 250051 TAAACTATATATATAGAAGGACGAAAGAAAAGGATACCTCGATTTTTATTTATTTAGTTT 250110
 +
            |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
 +
New: 250051 TAAACTATATATATAGAAGGACGAAAGAAAAG-ATACCTCGATTTTTATTTATTTAGTTT 250109</pre>
 +
'''Robben J, et al.''' (2002) Revisiting the yeast chromosome VI DNA sequence reveals a correction merging YFL007w and YFL006w to a single ORF. Yeast 19(8):699-702. <br>
 +
[https://www.yeastgenome.org/reference/S000070321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12185839 PubMed] | [https://onlinelibrary.wiley.com/doi/full/10.1002/yea.870 Full-Text] <br>
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2003-09-26
 +
| [https://www.yeastgenome.org/locus/YFL006W YFL006W], [https://www.yeastgenome.org/locus/YFL007W YFL007W] <br>
 +
| 128870
 +
| 128870
 +
| Insertion
 +
|
 +
| G
 +
|-
 +
| || colspan="6" | Due to the insertion of a G at 128870 on Chromosome VI, YFL006W has been merged with BLM10/YFL007W. YFL006W is now an alias of BLM10/YFL007W. ''Personal communication from Tim Formosa, University of Utah''.
 +
<pre>Old: 128841 TTTGATCACCCATACGATCAGGTTCGCCAG-CTGTCGCTAAACTATTGACGACCTTAGTT 128899
 +
            |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
 +
New: 128841 TTTGATCACCCATACGATCAGGTTCGCCAGGCTGTCGCTAAACTATTGACGACCTTAGTT 128900</pre>
 +
'''Robben J, et al.''' (2002) Revisiting the yeast chromosome VI DNA sequence reveals a correction merging YFL007w and YFL006w to a single ORF. Yeast 19(8):699-702. <br>
 +
[https://www.yeastgenome.org/reference/S000070321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12185839 PubMed] | [https://onlinelibrary.wiley.com/doi/full/10.1002/yea.870 Full-Text] <br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2003-09-26
 +
| [https://www.yeastgenome.org/locus/TEL06R TEL06R], [https://www.yeastgenome.org/locus/TEL06R-XC TEL06R-XC] <br>
 +
| 270023
 +
| 270023
 +
| Insertion
 +
|
 +
| G
 +
|-
 +
| || colspan="6" | After sequence verification in AB972 (S288c derivative) by SGD, a single G nucleotide was inserted after chromosomal coordinate 270023. This change lies within TEL06R-XC, the X element core sequence of TEL06R, the right telomere of chromosome VI.
 +
<pre>Old: 270000 TACTATTGATGGAAATGAGGACTG-GTCATGGGGCGCAATGGAGTGAAGTAATATATACT 270058
 +
            |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
 +
New: 270000 TACTATTGATGGAAATGAGGACTGGGTCATGGGGCGCAATGGAGTGAAGTAATATATACT 270059</pre>
 +
'''Robben J, et al.''' (2002) Revisiting the yeast chromosome VI DNA sequence reveals a correction merging YFL007w and YFL006w to a single ORF. Yeast 19(8):699-702. <br>
 +
[https://www.yeastgenome.org/reference/S000070321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12185839 PubMed] | [https://onlinelibrary.wiley.com/doi/full/10.1002/yea.870 Full-Text] <br>
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2003-09-26
 +
| [https://www.yeastgenome.org/locus/YFR040W YFR040W] <br>
 +
| 234451
 +
| 234451
 +
| Deletion
 +
| G
 +
|
 +
|-
 +
| || colspan="6" | Due to the deletion of a G at 234450 on Chr VI, the coordinates of ORF YFR040W changed from 234521-237238 to 234229-237237. <br>
 +
References:<br>
 +
 +
1. ''Sequence verification in AB972 (S288c derivative strain) background by SGD''.<br>
 +
2. ''Personal communication from Margaret Shirra, University of Pittsburgh''.<br>
 +
<pre>Old: 234421 CATGGTGATGAAGTGAAAACGGCACGTGGGAGATCAGAAGAGTCGATTTGAGAAGGATGA 234480
 +
            ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
 +
New: 234421 CATGGTGATGAAGTGAAAACGGCACGTGG-AGATCAGAAGAGTCGATTTGAGAAGGATGA 234479</pre>
 +
'''Luke MM, et al.''' (1996) The SAP, a new family of proteins, associate and function positively with the SIT4 phosphatase. Mol Cell Biol 16(6):2744-55. <br>
 +
[https://www.yeastgenome.org/reference/S000055325 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/8649382 PubMed] | [https://mcb.asm.org/content/16/6/2744.long Full-Text] <br>
 +
'''Jablonowski D, et al.''' (2001) Sit4p protein phosphatase is required for sensitivity of Saccharomyces cerevisiae to Kluyveromyces lactis zymocin. Genetics 159(4):1479-89. <br>
 +
[https://www.yeastgenome.org/reference/S000068918 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11779790 PubMed] | [https://www.genetics.org/content/159/4/1479.long Full-Text] <br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
 +
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2001-05-29
 +
| [https://www.yeastgenome.org/locus/YFL042C YFL042C], [https://www.yeastgenome.org/locus/YFL043C YFL043C] <br>
 +
| 46151
 +
| 46151
 +
| Deletion
 +
| C
 +
|
 +
|-
 +
| || colspan="6" | Due to the deletion of G at chromosomal coordinate 46151, which was within the ORF YFL043C, YFL043C is now part of YFL042C. The new coordinates for YFL042C are 47744-45720. See Genbank file YSCCHRVIN. ''The old coordinates for YFL042C were 47745-46078, and for YFL043C were 46157-45720.''
 +
<pre>Old: 46141 CACGTTATTTCCGTCATTCCAACGGATTAGATACCTTGTCTTAGTTGAGAAACTACCACC 46200
 +
          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
 +
New: 46141 CACGTTATTTC-GTCATTCCAACGGATTAGATACCTTGTCTTAGTTGAGAAACTACCACC 46199</pre>
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2001-05-29
 +
| [https://www.yeastgenome.org/locus/YFL031W YFL031W] <br>
 +
| 75751
 +
| 75751
 +
| Insertion
 +
|
 +
| C
 +
|-
 +
| || colspan="6" | A single C was inserted after the C at chromosomal coordinate 75751 (see GenBank file YSCCHRVIN). In addition, a new intron was annotated at relative coordinates 662-913. As a result, the chromosomal coordinates for ORF YFL031W are now 75177-75837..76090-76145, with relative coordinates 1-661..914-969. ''The old chromosomal coordinates for YFL031W were 75178-75780, with old relative coordinates 1-603.''
 +
<pre>Old: 75721 AACAACAATTTGTTTGATGCGGTGGCCTCGC-GTTGGCAGACCCACTCTGCGACGATATA 75779
 +
          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
 +
New: 75720 AACAACAATTTGTTTGATGCGGTGGCCTCGCCGTTGGCAGACCCACTCTGCGACGATATA 75779</pre>
 +
 +
|}
 +
 +
<br><br>
 +
 +
=Annotation Changes ''without sequence changes''=
 +
{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
 +
! Date  !! Affected Features
 +
|-
 +
| 2014-11-18
 +
| [https://www.yeastgenome.org/locus/ARS600 ARS600], [https://www.yeastgenome.org/locus/ARS603 ARS603], [https://www.yeastgenome.org/locus/ARS606 ARS606] <br>
 +
The chromosomal coordinates of the following ARS elements on Chromosome VI were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS600, ARS603, ARS606. <br> <br>
 +
'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
 +
[https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text]
 +
|-
 +
| 2014-11-18
 +
| [https://www.yeastgenome.org/locus/ARS600.4 ARS600.4], [https://www.yeastgenome.org/locus/ARS603.1 ARS603.1] <br>
 +
The following new ARS elements on Chromosome VI were added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS600.4, ARS603.1.<br> <br>
 +
'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
 +
[https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text]
 +
|-
 +
| 2014-11-18
 +
| [https://www.yeastgenome.org/locus/YFL056C YFL056C], [https://www.yeastgenome.org/locus/YFL057C YFL057C] <br>
 +
The ORF AAD16/YFL057C was merged into neighboring ORF AAD6/YFL056C and the combined feature is now annotated as a pseudogene. This update was made as part of SGD's genome annotation revision R64.2.<br> <br>
 +
'''Delneri D, et al.''' (1999) Analysis of the seven-member AAD gene set demonstrates that genetic redundancy in yeast may be more apparent than real. Genetics 153(4):1591-600. <br>
 +
[https://www.yeastgenome.org/reference/S000043843 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10581269 PubMed] | [https://www.genetics.org/content/153/4/1591.long Full-Text] <br>
 +
|-
 +
| 2009-05-04
 +
| [https://www.yeastgenome.org/locus/RUF20 RUF20], [https://www.yeastgenome.org/locus/RUF21 RUF21], [https://www.yeastgenome.org/locus/RUF22 RUF22], [https://www.yeastgenome.org/locus/RUF23 RUF23] <br>
 +
The following RNA features were added to the S. cerevisiae genome annotation based on Kavanaugh & Dietrich 2009: RUF20, RUF21, RUF22, and RUF23. ''Note that Kavanaugh & Dietrich state that the 3' ends of RUF22 and RUF23 are uncertain, meaning that these two RNAs may possibly be longer than currently annotated.''<br> <br>
 +
'''Kavanaugh LA and Dietrick FS''' (2009) Non-Coding RNA Prediction and Verification in Saccharomyces cerevisiae. PLoS Genet 5(1):e1000321. <br>
 +
[https://www.yeastgenome.org/reference/S000128754 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/19119416 PubMed] | [https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1000321 Full-Text] <br>
 +
|-
 +
| 2008-06-02
 +
| [https://www.yeastgenome.org/locus/YFR024C-A YFR024C-A] <br>
 +
Based on the sequencing of the cloned cDNA, as the genomic DNA has an intron, Kathryn Ayscough and E.G. Allwood from the University of Sheffield conclude that the intron is not spliced at the predicted site, but rather 24 nt upstream. This annotation was updated in SGD, and as a result, the predicted protein product is 8 amino acids longer. The relative coding coordinates had been 1-47..166-1474, but are now 1-47..142-1474. Special thanks to Kathryn Ayscough and E.G. Allwood from the University of Sheffield for bringing this error to our attention. <br><br>
 +
 +
This annotation change is also supported by RNA sequencing data from Yassour et al. 2009.<br><br>
 +
'''Ayscough K and Allowed E''' (2008) <br>
 +
[https://www.yeastgenome.org/reference/S000126577 SGD paper] <br>
 +
'''Yassour M, et al.''' (2009) Ab initio construction of a eukaryotic transcriptome by massively parallel mRNA sequencing. Proc Natl Acad Sci U S A 106(9):3264-9. <br>
 +
[https://www.yeastgenome.org/reference/S000129301 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/19208812 PubMed] | [https://www.pnas.org/content/106/9/3264 Full-Text] <br>
 +
|-
 +
| 2007-04-04
 +
| [https://www.yeastgenome.org/locus/YFR032C-A YFR032C-A] <br>
 +
RPL29/YFR032C-A mRNA contains an intron in the 5' untranslated region (UTR). <br><br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
'''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br>
 +
[https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br>
 +
'''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7.
 +
<br>
 +
[https://www.yeastgenome.org/reference/S000120506 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17244705 PubMed] | [https://www.pnas.org/content/104/5/1522.long Full-Text] <br>
 +
|-
 +
| 2007-04-04
 +
| [https://www.yeastgenome.org/locus/YFR045W YFR045W] <br>
 +
Based on cDNA data from Miura et al. and sequence conservation among closely related fungal species, a new intron and 5' exon were added to YFR045W. This alters and extends the N-terminus, changing the size of the protein product from 285 to 309 amino acids. Special thanks to Michel Satre for bringing this update to our attention. <br><br>
 +
'''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br>
 +
[https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br>
 +
|-
 +
| 2007-03-08
 +
| [https://www.yeastgenome.org/locus/ARS601 ARS601], [https://www.yeastgenome.org/locus/ARS602 ARS602], [https://www.yeastgenome.org/locus/ARS604 ARS604], [https://www.yeastgenome.org/locus/ARS605 ARS605], [https://www.yeastgenome.org/locus/ARS606 ARS606], [https://www.yeastgenome.org/locus/ARS607 ARS607], [https://www.yeastgenome.org/locus/ARS608 ARS608], [https://www.yeastgenome.org/locus/ARS609 ARS609] <br>
 +
ACS annotated based on Xu et al. 2006 and Shirahige et al. 1993. <br> <br>
 +
'''Shirahige K, et al.''' (1993) Location and characterization of autonomously replicating sequences from chromosome VI of Saccharomyces cerevisiae. Mol Cell Biol 13(8):5043-56. <br>
 +
[https://www.yeastgenome.org/reference/S000050050 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/8336734 PubMed] | [https://mcb.asm.org/content/13/8/5043.long Full-Text] <br>
 +
'''Xu W, et al.''' (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276. <br>
 +
[https://www.yeastgenome.org/reference/S000119399 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17067396 PubMed] | [https://bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-7-276 Full-Text] <br>
 +
|-
 +
| 2007-03-08
 +
| [https://www.yeastgenome.org/locus/ARS603.5 ARS603.5] <br>
 +
ACS was annotated based on Xu et al. 2006 and Yamashita et al. 1997. <br><br>
 +
'''Xu W, et al.''' (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276. <br>
 +
[https://www.yeastgenome.org/reference/S000119399 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17067396 PubMed] | [https://bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-7-276 Full-Text] <br>
 +
'''Yamashita M, et al.''' (1997) The efficiency and timing of initiation of replication of multiple replicons of Saccharomyces cerevisiae chromosome VI. Genes Cells 2(11):655-65. <br>
 +
[https://www.yeastgenome.org/reference/S000121132 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9491800 PubMed] | [https://onlinelibrary.wiley.com/doi/abs/10.1046/j.1365-2443.1997.1530351.x?sid=nlm%3Apubmed Full-Text] <br>
 +
|-
 +
| 2007-03-08
 +
| [https://www.yeastgenome.org/locus/ARS603 ARS603] <br>
 +
Both ACS's within ARS603 were annotated based on Xu et al. 2006 and Shirahige et al. 1993.<br><br>
 +
'''Shirahige K, et al.''' (1993) Location and characterization of autonomously replicating sequences from chromosome VI of Saccharomyces cerevisiae. Mol Cell Biol 13(8):5043-56. <br>
 +
[https://www.yeastgenome.org/reference/S000050050 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/8336734 PubMed] | [https://mcb.asm.org/content/13/8/5043.long Full-Text] <br>
 +
'''Xu W, et al.''' (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276. <br>
 +
[https://www.yeastgenome.org/reference/S000119399 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17067396 PubMed] | [https://bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-7-276 Full-Text] <br>
 +
|-
 +
| 2007-03-08
 +
| [https://www.yeastgenome.org/locus/ARS610 ARS610] <br>
 +
ARS610 was added to the genome annotation based on Xu et al. 2006. <br><br>
 +
'''Xu W, et al.''' (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276. <br>
 +
[https://www.yeastgenome.org/reference/S000119399 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17067396 PubMed] | [https://bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-7-276 Full-Text] <br>
 +
|-
 +
| 2006-05-08
 +
| [https://www.yeastgenome.org/locus/CEN6 CEN6] <br>
 +
The previously annotated 5' boundary of CEN6 was slightly adjusted to coincide with the 5' end of CDEI, to more accurately reflect current knowledge regarding centromere structure in ''Saccharomyces cerevisiae''. <br><br>
 +
'''Wieland G, et al.''' (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60. <br>
 +
[https://www.yeastgenome.org/reference/S000059647 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11222754 PubMed] | [https://academic.oup.com/nar/article/29/5/1054/2381189 Full-Text]<br>
 +
'''Espelin CW, et al.''' (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68. <br>
 +
[https://www.yeastgenome.org/reference/S000074756 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/13679521 PubMed] | [https://www.molbiolcell.org/doi/full/10.1091/mbc.e02-08-0533?url_ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed Full-Text]<br>
 +
|-
 +
| 2006-03-02
 +
| [https://www.yeastgenome.org/locus/ARS600 ARS600] <br>
 +
This ARS element ARS600 (originally published as ARS120) was added to the genome annotation based on Eisenberg et al. 1988 and Wyrick et al. 2001. ARS120 was originally added to SGD as "not in systematic sequence of S288C". <br><br>
 +
'''Eisenberg S, et al.''' (1988) Specific interaction between a Saccharomyces cerevisiae protein and a DNA element associated with certain autonomously replicating sequences. Proc Natl Acad Sci U S A 85(3):743-6. <br>
 +
[https://www.yeastgenome.org/reference/S000049674 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/3277180 PubMed] | [https://www.pnas.org/content/85/3/743 Full-Text] <br>
 +
'''Wyrick JJ, et al.''' (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60. <br>
 +
[https://www.yeastgenome.org/reference/S000069019 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11743203 PubMed] | [https://science.sciencemag.org/content/294/5550/2357.long Full-Text] | [https://www.ncbi.nlm.nih.gov/pubmed/11743187 Comments & Errata]<br>
 +
|-
 +
| 2004-10-12
 +
| [https://www.yeastgenome.org/locus/CEN6 CEN6] <br>
 +
Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.<br><br>
 +
'''Wieland G, et al.''' (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60. <br>
 +
[https://www.yeastgenome.org/reference/S000059647 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11222754 PubMed] | [https://academic.oup.com/nar/article/29/5/1054/2381189 Full-Text]<br>
 +
'''Espelin CW, et al.''' (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68. <br>
 +
[https://www.yeastgenome.org/reference/S000074756 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/13679521 PubMed] | [https://www.molbiolcell.org/doi/full/10.1091/mbc.e02-08-0533?url_ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed Full-Text]<br>
 +
|-
 +
| 2004-04-01
 +
| [https://www.yeastgenome.org/locus/RUF7 RUF7] <br>
 +
Feature annotation removed per John McCutcheon and Sean Eddy.<br><br>
 +
'''McCutcheon JP and Eddy SR''' (2004) Detailed correction to: Computational identification of noncoding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res. 31:4119-4128, 2003. <br>
 +
[https://www.yeastgenome.org/reference/S000074006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12853629 PubMed] | [https://academic.oup.com/nar/article/31/14/4119/2904330#55548715 Full-Text] <br>
 +
|-
 +
| 2003-09-09
 +
| [https://www.yeastgenome.org/locus/TEL06L TEL06L], [https://www.yeastgenome.org/locus/TEL06R TEL06R] <br>
 +
The chromosomal locations for the following telomeric features on Chromosome VI were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL06L, TEL06L-XC, TEL06L-XR, TEL06L-TR, TEL06L-YP, TEL06R, TEL06R-XC, TEL06R-TR.<br><br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YFR009W-A YFR009W-A], [https://www.yeastgenome.org/locus/YFR010W-A YFR010W-A] <br>
 +
Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following ORFs on Chromosome VI: YFR009W-A, YFR010W-A.<br><br>
 +
'''Basrai MA, et al.''' (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9. <br>
 +
[https://www.yeastgenome.org/reference/S000042214 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10490641 PubMed] | [https://mcb.asm.org/content/19/10/7041.long Full-Text] <br>
 +
'''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br>
 +
[https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br>
 +
'''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br>
 +
[https://www.yeastgenome.org/reference/S000073672 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] | [https://genome.cshlp.org/content/12/8/1210.long Full-Text] | [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YFL041W-A YFL041W-A] <br>
 +
Thanks to Kessler et al. for providing the coordinates of ORF YFL041W-A.<br><br>
 +
'''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br>
 +
[https://www.yeastgenome.org/reference/S000073671 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] | [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YFL013W-A YFL013W-A], [https://www.yeastgenome.org/locus/YFL031C-A YFL031C-A], [https://www.yeastgenome.org/locus/YFR032C-B YFR032C-B], [https://www.yeastgenome.org/locus/YFR034W-A YFR034W-A] <br>
 +
Thanks to Kumar et al. for providing the coordinates of the following ORFs on Chromosome VI: YFL013W-A, YFL031C-A, YFR032C-B, YFR034W-A.<br><br>
 +
'''Kumar A, et al.''' (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63. <br>
 +
[https://www.yeastgenome.org/reference/S000073673 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11753363 PubMed] | [https://www.nature.com/articles/nbt0102-58 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11753363&db=pmid YFGdb] | [https://www.yeastgenome.org/reference/S000141796 Comments & Errata] <br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YFL015W-A YFL015W-A], [https://www.yeastgenome.org/locus/YFL021C-A YFL021C-A], [https://www.yeastgenome.org/locus/YFR036W-A YFR036W-A], [https://www.yeastgenome.org/locus/YFR052C-A YFR052C-A] <br>
 +
Thanks to [https://bioinformatik.wzw.tum.de/index.php?id=63 MIPS] for providing the coordinates of the following ORFs on Chromosome VI: YFL015W-A, YFL021C-A, YFR036W-A, YFR052C-A.<br><br>
 +
|-
 +
| 2003-03-13
 +
| [https://www.yeastgenome.org/locus/YFR024C YFR024C], [https://www.yeastgenome.org/locus/YFR024C-A YFR024C-A] <br>
 +
YFR024C is not a genuine ORF, but is the C-terminus of LSB3/YFR024C-A. The LSB3 gene contains an intron that has been demonstrated to be spliced. The ORF YFR024C has been deleted and the name YFR024C has been made an alias for LSB3/YFR024C-A. <br><br>
 +
'''Davis CA, et al.''' (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6. <br>
 +
[https://www.yeastgenome.org/reference/S000042737 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10734188 PubMed] | [https://academic.oup.com/nar/article/28/8/1700/1009222 Full-Text] <br>
 +
|-
 +
| 2003-03-06
 +
| [https://www.yeastgenome.org/locus/RUF7 RUF7] <br>
 +
Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8. <br><br>
 +
'''McCutcheon JP and Eddy SR''' (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28. <br>
 +
[https://www.yeastgenome.org/reference/S000074006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12853629 PubMed] | [https://academic.oup.com/nar/article/31/14/4119/2904330 Full-Text] <br>
 +
|-
 +
| 2001-03-15
 +
| [https://www.yeastgenome.org/locus/ARS603.5 ARS603.5] <br>
 +
Coordinates courtesy of Katsuhiro Shirahige - Personal communication <br><br>
 +
|-
 +
| 2001-03-02
 +
| [https://www.yeastgenome.org/locus/ARS601 ARS601], [https://www.yeastgenome.org/locus/ARS602 ARS602], [https://www.yeastgenome.org/locus/ARS603 ARS603], [https://www.yeastgenome.org/locus/ARS604 ARS604], [https://www.yeastgenome.org/locus/ARS605 ARS605], [https://www.yeastgenome.org/locus/ARS606 ARS606], [https://www.yeastgenome.org/locus/ARS607 ARS607], [https://www.yeastgenome.org/locus/ARS608 ARS608], [https://www.yeastgenome.org/locus/ARS609 ARS609] <br>
 +
The coordinates for the following ARS elements on Chromosome VI are courtesy of Katsuhiro Shirahige, based on Shirahige et al. 1993: ARS601, ARS602, ARS603, ARS604, ARS605, ARS606, ARS607, ARS608, ARS609.<br><br>
 +
'''Shirahige K, et al.''' (1993) Location and characterization of autonomously replicating sequences from chromosome VI of Saccharomyces cerevisiae. Mol Cell Biol 13(8):5043-56. <br>
 +
[https://www.yeastgenome.org/reference/S000050050 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/8336734 PubMed] | [https://mcb.asm.org/content/13/8/5043.long Full-Text] <br>
 +
 +
|}

Latest revision as of 14:32, 4 October 2019

This page lists all sequence and annotation changes that have been made to the Chromosome VI systematic reference sequence since its intial release on 1996-07-31.

  • The sequence of Chromosome VI has been updated 36 times, affecting 43 features.
  • The annotation of Chromosome VI has been updated 24 times, affecting 39 features.
  • Current and past versions can be obtained from SGD's Download site.


Sequence Changes

Date Affected Features Start Coordinate of Change End Coordinate of Change Type of Change Old Sequence New Sequence
2011-02-03 YFL034W 66443 66443 Substitution C A
Nucleotide change(s) in the coding region of YFL034W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 323 is now Lysine rather than Asparagine. 
New    66421   TATTGACATTAAATCCCACAAGAAACTAGCACATAGATTACAGTTTACCCAGAAGGATAT  66480
               |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old    66419   TATTGACATTAAATCCCACAAGAACCTAGCACATAGATTACAGTTTACCCAGAAGGATAT  66478

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFR040W 236216 236216 Substitution C A
Nucleotide change(s) in the coding region of SAP155/YFR040W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 663 is now Asparagine rather than Threonine. 
New    236219  ATGAAGCAAAACATAAAACTTAGGACCGACCCCACGGTCGGGGACCTATTCAAAATCAAA  236278
               |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Old    236206  ATGAAGCAAACCATAAAACTTAGGACCGACCCCACGGTCGGGGACCTATTCAAAATCAAA  236265

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFR019W 191312 191312 Substitution T A
Nucleotide change(s) in the coding region of FAB1/YFR019W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 2275 is now Arginine rather than Tryptophan. 
New    191280  AAGCAATGGAGAGGTATATTTTGATGGTTCCTGATCCGTGGTATAGGGAAGGAAATTAAT  191339
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    191268  AAGCAATGGAGAGGTATATTTTGATGGTTCCTGATCCGTGGTATTGGGAAGGAAATTAAT  191327

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFL026W 83382 83382 Substitution G A
Nucleotide change(s) in the coding region of STE2/YFL026W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 269 is now Lysine rather than Glutamic Acid. 
New    83341   TTTGTTGGTTCCATCGATAATATTCATCCTCGCATACAGTTTGAAACCAAACCAGGGAAC  83400
               ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old    83339   TTTGTTGGTTCCATCGATAATATTCATCCTCGCATACAGTTTGGAACCAAACCAGGGAAC  83398

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFR020W, YFRCdelta9
192393 192393 Deletion C
A single nucleotide deletion was made in the intergenic region between Ty1 LTR YFRCdelta9 and ORF YFR020W. 
New    192360  TTTTAGGAATACTGTTGTTCAAGATAGAGCATTTGCATACCTTAT-CGAGGTTCACTATC  192418
               ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    192348  TTTTAGGAATACTGTTGTTCAAGATAGAGCATTTGCATACCTTATCCGAGGTTCACTATC  192407

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFR020W, YFR021W
192393 192393 Insertion T
A single nucleotide insertion was made in the intergenic region between ORFs YFR020W and ATG18/YFR021W. 
New    194759  GTTAGTAATAGTGTTCCAGTTAACTCTGTATCCTTTTCTTCTTCGGCCTGACAATGTCTG  194818
               |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Old    194748  GTTAGTAATAGTGTTCCAGTTAACTCTGTATCCTTTTC-TCTTCGGCCTGACAATGTCTG  194806

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFR019W, tS(GCU)F
191388 191388 Substitution G T
A single nucleotide substitution was made within the intergenic region between ORF FAB1/YFR019W and tRNA tS(GCU)F. 
New    191390  CGCACATTAGTGTTCTTTAACTTTCAGTACCTTAGTAGTTATCAACTATGAAAAGGTGGT  191449
               |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Old    191378  CGCACATTAGGGTTCTTTAACTTTCAGTACCTTAGTAGTTATCAACTATGAAAAGGTGGT  191437

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFR014C
173057 173057 Substitution C T
A single nucleotide substitution was made within ORF CMK1/YFR014C. Note that the protein sequence was not affected. 
New    173040  GAGCCTTCAAGATGAATTGTTTTGCTTTATTGGAAACGGAATCCCAATAAGGCCTATGAA  173099
               ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Old    173032  GAGCCTTCAAGATGAATTGTTTTGCCTTATTGGAAACGGAATCCCAATAAGGCCTATGAA  173091

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFR012W, YFR012W-A
168869 168869 Insertion A
A single nucleotide insertion was made in the intergenic region between ORFs YFR012W and YFR012W-A. 
New    168840  TTACCTGCAAAGCAAGAAAATGTGGAAATGCCTACTGAAAAAAAAAAGGCAAATATTTTA  168899
               ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Old    168833  TTACCTGCAAAGCAAGAAAATGTGGAAATGCCTACTG-AAAAAAAAAGGCAAATATTTTA  168891

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFR009W, YFR010W
164814 164814 Insertion T
A single nucleotide insertion was made in the intergenic region between ORFs GCN20/YFR009W and UBP6/YFR010W. 
New    164810  CCCCATGATACTTTTTTTTTTTGACTACTTGTATTGGAATCTAATTGACCTAACTGGGCA  164869
               ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old    164804  CCCCATGATAC-TTTTTTTTTTGACTACTTGTATTGGAATCTAATTGACCTAACTGGGCA  164862

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFR005C, YFR006W
155980 155980 Insertion T
A single nucleotide insertion was made in the intergenic region between ORFs SAD1/YFR005C and YFR006W. 
New    155940  CCAATTTTTTTTCCTATTTCGTCATTTTTTTATCAAGATTTTCCAGTTTTTTTTTTTTTT  155999
               |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    155935  CCAATTTTTTTTCCTATTTCGTCATTTTTTTATCAAGATTTTCCAG-TTTTTTTTTTTTT  155993

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFR044C, YFR045W
241576 241576 Substitution A T
A single nucleotide substitution was made within the intergenic region between ORFs DUG1/YFR044C and YFR045W. 
New    241559  GAATGACGAATATAAGGGATATTGCTAAAATATGCTGTGGCATTGGTCAACTTAAAAGAA  241618
               |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Old    241546  GAATGACGAATATAAGGGATATTGCTAAAAAATGCTGTGGCATTGGTCAACTTAAAAGAA  241605

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 RUF21 58032 58032 Substitution G A
58035 58035 Substitution G A
Two separate single nucleotide substitutions were made within ncRNA RUF21. 
New    58021   TATATATATATAAGGAGGCCGATAAAAAAGAACTTGCAATATTACGCAGATCAGGGATTT  58080
               |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Old    58020   TATATATATATAGGGGGGCCGATAAAAAAGAACTTGCAATATTACGCAGATCAGGGATTT  58079

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFR035C, tK(CUU)F
226684 226684 Insertion G
A single nucleotide insertion was made in the intergenic region between ORF YFR035C and tRNA tK(CUU)F. 
New    226679  AAAGAGATAAGCCCTGTAGGGGGCTCGAACCCCTAACCTTATGATTAAGAGTCATACGCG  226738
               |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old    226667  AAAGAGATAAGCCCTGTA-GGGGCTCGAACCCCTAACCTTATGATTAAGAGTCATACGCG  226725

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFR031C
219387 219387 Substitution A G
A single nucleotide substitution was made within ORF SMC2/YFR031C. Note that the protein sequence was not affected. 
New    219359  TTATTGATGTATGTTTATGTTTAATGTTATAGTATTCATAGGATACAACAATTCGTTCAG  219418
               |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old    219347  TTATTGATGTATGTTTATGTTTAATGTTATAGTATTCATAAGATACAACAATTCGTTCAG  219406

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 ARS603.5, YFL009W 118584 118584 Substitution G A
118606 118614 Substitution CTGGATGTG TTGTATGT
Several nucleotides were changed in the intergenic region between ORF CDC4/YFL009W and ARS603.5. 
New    118571  ACTTCGTACATTTTATTGAATATAAACTGCAGCTAAACTGCTTGTATGT-TCAATTTTAA  118629
               ||||||||||||||||||| ||||||||||||||||||||| || |||| ||||||||||
Old    118565  ACTTCGTACATTTTATTGAGTATAAACTGCAGCTAAACTGCCTGGATGTGTCAATTTTAA  118624

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFL020C, YFL021W 97503 97503 Insertion A
98796 98796 Insertion TGA
A single nucleotide insertion and a trinucleotide insertion were made in the intergenic region between ORFs GAT1/YFL021W and PAU5/YFL020C. 
New    97491   ATTTATAGATCCCCCAAAAAAAAAAAAGTACTCGCTTCTTTCCATGTCCGCTTCATATAT  97550
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    97489   ATTTATAGATCCCCC-AAAAAAAAAAAGTACTCGCTTCTTTCCATGTCCGCTTCATATAT  97547
New    98761   CTGCAATTTTTTTTTTTGTATTAACTCATCGAGTATGTCTGATGTGTAAACTGAACCAGG  98820
               |||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||
Old    98758   CTGCAATTTTTTTTTTTGTATTAACTCATCGAGTATGTC---TGTGTAAACTGAACCAGG  98814

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFL021C-A, YFL022C 95385 95385 Substitution C G
95410 95410 Substitution T C
Two separate single nucleotide substitutions were made within the intergenic region between ORFs FRS2/YFL022C and YFL021C-A. 
New    95371   TTTCCGATTTTAGCCGGCGAAGACGTACTTGGCGCCATAATCAAAACCTAGCTTGCCCAA  95430
               |||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||
Old    95369   TTTCCGATTTTAGCCGCCGAAGACGTACTTGGCGCCATAATTAAAACCTAGCTTGCCCAA  95428

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 TEL06L-XR
4827 4827 Substitution T A
A single nucleotide substitution was made within TEL06L-XR. 
New    4801    CCCACACACCACACCCACACCCTAATACTACCTCAACCCTACCCTAATCCAACCCTTCCA  4860
               |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Old    4801    CCCACACACCACACCCACACCCTAATTCTACCTCAACCCTACCCTAATCCAACCCTTCCA  4860

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFL039C
54494 54494 Insertion T
A single nucleotide insertion was made within the intron of ORF ACT1/YFL039C. 
New    54481   CGAAAATATTTCAGTTTTTTTTTTTTTTCCAAATTTCAAGCCCCTATTTATTCCAATAAT  54540
               |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Old    54481   CGAAAATATTTCAG-TTTTTTTTTTTTTCCAAATTTCAAGCCCCTATTTATTCCAATAAT  54539

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFL034C-A, YFL034W
65112 65112 Insertion A
A single nucleotide insertion was made in the intergenic region between ORFs RPL22B/YFL034C-A and YFL034W. 
New    65101   GCTCGCGTTGTCTAAAAAAAAAAGTTTGGAAACTTTTTTGTATAATTTATGGGTGTTATC  65160
               ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old    65100   GCTCGCGTTGTCT-AAAAAAAAAGTTTGGAAACTTTTTTGTATAATTTATGGGTGTTATC  65158

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 tG(GCC)F2
181039 181039 Insertion TTTC
A tetranucleotide insertion was made within tRNA tG(GCC)F2. 
New    181020  GATTTTACCACTAAACCACTTGCGCTTATTTCTTGGAAGTGTTCGTGTTCTAATAAGGTC  181079
               ||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||
Old    181012  GATTTTACCACTAAACCACTTGCGCTTA----TTGGAAGTGTTCGTGTTCTAATAAGGTC  181067

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFR048W, YFR049W
248160 248160 Substitution A T
A single nucleotide substitution was made in the intergenic region between ORFs RMD8/YFR048W and YMR31/YFR049W. 
New    248159  CATTAAAAATAAATTAATGATATATTTAGTTATCAAGGTTTTTAGTCATATATTTCACCG  248218
               |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Old    248146  CATTAAAAATAAATAAATGATATATTTAGTTATCAAGGTTTTTAGTCATATATTTCACCG  248205

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YFL022C
95000 95000 Substitution A G
A single nucleotide substitution was made within ORF FRS2/YFL022C. Note that the protein sequence was not affected. 
New    94981   TTTTAGAATTTCTAATTGGAAGTCAGACATCTTTACGTTAGGGGGTGAGAGAGGGAGGGG  95040
               ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Old    94979   TTTTAGAATTTCTAATTGGAAATCAGACATCTTTACGTTAGGGGGTGAGAGAGGGAGGGG  95038

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2004-02-05 YFR038W
231670 231670 Deletion G
Based on the automated comparison of related fungi, Kellis et al. and Brachat et al. suggested that the stop site for YFR038W be moved 226 nt downstream. Hui-fen Kuo and Eric Richards resequenced this portion of the genome and found that a G nt. should be deleted (personal communication to SGD). This sequence error was confirmed by SGD. As a consequence of this sequence change, YFR038W was extended 226 nt at the 3' end, altering the the C-terminus and increasing the size of the predicted protein from 778 to 853 amino acids. 
New: 231648 AAAAATTGGCGTTAAATGAAGG-TTCTTTTTTGAAGGCAAA 231687 
            |||||||||||||||||||||| ||||||||||||||||||
Old: 231648 AAAAATTGGCGTTAAATGAAGGGTTCTTTTTTGAAGGCAAA 231688

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text

2004-02-05 YFR045W
242181 242181 Insertion G
Based on the automated comparison of related Saccharomyces species, Kellis et al. and Brachat et al. suggested that the start site for YFR045W be moved 320 nt upstream. Belenkiy R et al. demonstrated a G nt insertion in that region and this sequence change was confirmed in S288c, by SGD. As a consequence of this sequence change, YFR045W was extended 320 nt at the 5' end, altering the the N-terminus and increasing the size of the predicted protein from 537 to 858 amino acids. Note that Belenkiy et al. also demonstrated a silent G to C substitution 701 nts downstream from the new start site; however, SGD could not confirm this sequence change in S288c, so it has not been incorporated. 
New: 242152 TAAAGACTGGTTTACAATTGCAACCGAAGGGTACCGCTTTCGAAATCATTTTACCTCAGA 242211
            |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Old: 242152 TAAAGACTGGTTTACAATTGCAACCGAAGG-TACCGCTTTCGAAATCATTTTACCTCAGA 242210

Belenkiy R, et al. (2000) The yeast mitochondrial transport proteins: new sequences and consensus residues, lack of direct relation between consensus residues and transmembrane helices, expression patterns of the transport protein genes, and protein-protein interactions with other proteins. Biochim Biophys Acta 1467(1):207-18.
SGD paper | PubMed | Full-Text
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text

2003-09-26 YFR050C, YFR051C
250082 250082 Deletion G
A single G nucleotide was deleted from the intergenic region between ORFs YFR050C and YFR051C. 
Old: 250051 TAAACTATATATATAGAAGGACGAAAGAAAAGGATACCTCGATTTTTATTTATTTAGTTT 250110
            |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
New: 250051 TAAACTATATATATAGAAGGACGAAAGAAAAG-ATACCTCGATTTTTATTTATTTAGTTT 250109

Robben J, et al. (2002) Revisiting the yeast chromosome VI DNA sequence reveals a correction merging YFL007w and YFL006w to a single ORF. Yeast 19(8):699-702.
SGD paper | PubMed | Full-Text

2003-09-26 YFL006W, YFL007W
128870 128870 Insertion G
Due to the insertion of a G at 128870 on Chromosome VI, YFL006W has been merged with BLM10/YFL007W. YFL006W is now an alias of BLM10/YFL007W. Personal communication from Tim Formosa, University of Utah. 
Old: 128841 TTTGATCACCCATACGATCAGGTTCGCCAG-CTGTCGCTAAACTATTGACGACCTTAGTT 128899
            |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New: 128841 TTTGATCACCCATACGATCAGGTTCGCCAGGCTGTCGCTAAACTATTGACGACCTTAGTT 128900

Robben J, et al. (2002) Revisiting the yeast chromosome VI DNA sequence reveals a correction merging YFL007w and YFL006w to a single ORF. Yeast 19(8):699-702.
SGD paper | PubMed | Full-Text
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata

2003-09-26 TEL06R, TEL06R-XC
270023 270023 Insertion G
After sequence verification in AB972 (S288c derivative) by SGD, a single G nucleotide was inserted after chromosomal coordinate 270023. This change lies within TEL06R-XC, the X element core sequence of TEL06R, the right telomere of chromosome VI. 
Old: 270000 TACTATTGATGGAAATGAGGACTG-GTCATGGGGCGCAATGGAGTGAAGTAATATATACT 270058
            |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
New: 270000 TACTATTGATGGAAATGAGGACTGGGTCATGGGGCGCAATGGAGTGAAGTAATATATACT 270059

Robben J, et al. (2002) Revisiting the yeast chromosome VI DNA sequence reveals a correction merging YFL007w and YFL006w to a single ORF. Yeast 19(8):699-702.
SGD paper | PubMed | Full-Text

2003-09-26 YFR040W
234451 234451 Deletion G
Due to the deletion of a G at 234450 on Chr VI, the coordinates of ORF YFR040W changed from 234521-237238 to 234229-237237.

References:

1. Sequence verification in AB972 (S288c derivative strain) background by SGD.
2. Personal communication from Margaret Shirra, University of Pittsburgh.

Old: 234421 CATGGTGATGAAGTGAAAACGGCACGTGGGAGATCAGAAGAGTCGATTTGAGAAGGATGA 234480
            ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New: 234421 CATGGTGATGAAGTGAAAACGGCACGTGG-AGATCAGAAGAGTCGATTTGAGAAGGATGA 234479

Luke MM, et al. (1996) The SAP, a new family of proteins, associate and function positively with the SIT4 phosphatase. Mol Cell Biol 16(6):2744-55.
SGD paper | PubMed | Full-Text
Jablonowski D, et al. (2001) Sit4p protein phosphatase is required for sensitivity of Saccharomyces cerevisiae to Kluyveromyces lactis zymocin. Genetics 159(4):1479-89.
SGD paper | PubMed | Full-Text
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2001-05-29 YFL042C, YFL043C
46151 46151 Deletion C
Due to the deletion of G at chromosomal coordinate 46151, which was within the ORF YFL043C, YFL043C is now part of YFL042C. The new coordinates for YFL042C are 47744-45720. See Genbank file YSCCHRVIN. The old coordinates for YFL042C were 47745-46078, and for YFL043C were 46157-45720. 
Old: 46141 CACGTTATTTCCGTCATTCCAACGGATTAGATACCTTGTCTTAGTTGAGAAACTACCACC 46200
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New: 46141 CACGTTATTTC-GTCATTCCAACGGATTAGATACCTTGTCTTAGTTGAGAAACTACCACC 46199
2001-05-29 YFL031W
75751 75751 Insertion C
A single C was inserted after the C at chromosomal coordinate 75751 (see GenBank file YSCCHRVIN). In addition, a new intron was annotated at relative coordinates 662-913. As a result, the chromosomal coordinates for ORF YFL031W are now 75177-75837..76090-76145, with relative coordinates 1-661..914-969. The old chromosomal coordinates for YFL031W were 75178-75780, with old relative coordinates 1-603. 
Old: 75721 AACAACAATTTGTTTGATGCGGTGGCCTCGC-GTTGGCAGACCCACTCTGCGACGATATA 75779
           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
New: 75720 AACAACAATTTGTTTGATGCGGTGGCCTCGCCGTTGGCAGACCCACTCTGCGACGATATA 75779



Annotation Changes without sequence changes

Date Affected Features
2014-11-18 ARS600, ARS603, ARS606

The chromosomal coordinates of the following ARS elements on Chromosome VI were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS600, ARS603, ARS606.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704.
SGD paper | PubMed | Full-Text

2014-11-18 ARS600.4, ARS603.1

The following new ARS elements on Chromosome VI were added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS600.4, ARS603.1.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704.
SGD paper | PubMed | Full-Text

2014-11-18 YFL056C, YFL057C

The ORF AAD16/YFL057C was merged into neighboring ORF AAD6/YFL056C and the combined feature is now annotated as a pseudogene. This update was made as part of SGD's genome annotation revision R64.2.

Delneri D, et al. (1999) Analysis of the seven-member AAD gene set demonstrates that genetic redundancy in yeast may be more apparent than real. Genetics 153(4):1591-600.
SGD paper | PubMed | Full-Text

2009-05-04 RUF20, RUF21, RUF22, RUF23

The following RNA features were added to the S. cerevisiae genome annotation based on Kavanaugh & Dietrich 2009: RUF20, RUF21, RUF22, and RUF23. Note that Kavanaugh & Dietrich state that the 3' ends of RUF22 and RUF23 are uncertain, meaning that these two RNAs may possibly be longer than currently annotated.

Kavanaugh LA and Dietrick FS (2009) Non-Coding RNA Prediction and Verification in Saccharomyces cerevisiae. PLoS Genet 5(1):e1000321.
SGD paper | PubMed | Full-Text

2008-06-02 YFR024C-A

Based on the sequencing of the cloned cDNA, as the genomic DNA has an intron, Kathryn Ayscough and E.G. Allwood from the University of Sheffield conclude that the intron is not spliced at the predicted site, but rather 24 nt upstream. This annotation was updated in SGD, and as a result, the predicted protein product is 8 amino acids longer. The relative coding coordinates had been 1-47..166-1474, but are now 1-47..142-1474. Special thanks to Kathryn Ayscough and E.G. Allwood from the University of Sheffield for bringing this error to our attention.

This annotation change is also supported by RNA sequencing data from Yassour et al. 2009.

Ayscough K and Allowed E (2008)
SGD paper
Yassour M, et al. (2009) Ab initio construction of a eukaryotic transcriptome by massively parallel mRNA sequencing. Proc Natl Acad Sci U S A 106(9):3264-9.
SGD paper | PubMed | Full-Text

2007-04-04 YFR032C-A

RPL29/YFR032C-A mRNA contains an intron in the 5' untranslated region (UTR).

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement
Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51.
SGD paper | PubMed | Full-Text
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7.
SGD paper | PubMed | Full-Text

2007-04-04 YFR045W

Based on cDNA data from Miura et al. and sequence conservation among closely related fungal species, a new intron and 5' exon were added to YFR045W. This alters and extends the N-terminus, changing the size of the protein product from 285 to 309 amino acids. Special thanks to Michel Satre for bringing this update to our attention.

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51.
SGD paper | PubMed | Full-Text

2007-03-08 ARS601, ARS602, ARS604, ARS605, ARS606, ARS607, ARS608, ARS609

ACS annotated based on Xu et al. 2006 and Shirahige et al. 1993.

Shirahige K, et al. (1993) Location and characterization of autonomously replicating sequences from chromosome VI of Saccharomyces cerevisiae. Mol Cell Biol 13(8):5043-56.
SGD paper | PubMed | Full-Text
Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276.
SGD paper | PubMed | Full-Text

2007-03-08 ARS603.5

ACS was annotated based on Xu et al. 2006 and Yamashita et al. 1997.

Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276.
SGD paper | PubMed | Full-Text
Yamashita M, et al. (1997) The efficiency and timing of initiation of replication of multiple replicons of Saccharomyces cerevisiae chromosome VI. Genes Cells 2(11):655-65.
SGD paper | PubMed | Full-Text

2007-03-08 ARS603

Both ACS's within ARS603 were annotated based on Xu et al. 2006 and Shirahige et al. 1993.

Shirahige K, et al. (1993) Location and characterization of autonomously replicating sequences from chromosome VI of Saccharomyces cerevisiae. Mol Cell Biol 13(8):5043-56.
SGD paper | PubMed | Full-Text
Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276.
SGD paper | PubMed | Full-Text

2007-03-08 ARS610

ARS610 was added to the genome annotation based on Xu et al. 2006.

Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276.
SGD paper | PubMed | Full-Text

2006-05-08 CEN6

The previously annotated 5' boundary of CEN6 was slightly adjusted to coincide with the 5' end of CDEI, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60.
SGD paper | PubMed | Full-Text
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68.
SGD paper | PubMed | Full-Text

2006-03-02 ARS600

This ARS element ARS600 (originally published as ARS120) was added to the genome annotation based on Eisenberg et al. 1988 and Wyrick et al. 2001. ARS120 was originally added to SGD as "not in systematic sequence of S288C".

Eisenberg S, et al. (1988) Specific interaction between a Saccharomyces cerevisiae protein and a DNA element associated with certain autonomously replicating sequences. Proc Natl Acad Sci U S A 85(3):743-6.
SGD paper | PubMed | Full-Text
Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60.
SGD paper | PubMed | Full-Text | Comments & Errata

2004-10-12 CEN6

Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60.
SGD paper | PubMed | Full-Text
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68.
SGD paper | PubMed | Full-Text

2004-04-01 RUF7

Feature annotation removed per John McCutcheon and Sean Eddy.

McCutcheon JP and Eddy SR (2004) Detailed correction to: Computational identification of noncoding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res. 31:4119-4128, 2003.
SGD paper | PubMed | Full-Text

2003-09-09 TEL06L, TEL06R

The chromosomal locations for the following telomeric features on Chromosome VI were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL06L, TEL06L-XC, TEL06L-XR, TEL06L-TR, TEL06L-YP, TEL06R, TEL06R-XC, TEL06R-TR.

2003-07-29 YFR009W-A, YFR010W-A

Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following ORFs on Chromosome VI: YFR009W-A, YFR010W-A.

Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9.
SGD paper | PubMed | Full-Text
Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51.
SGD paper | PubMed | Full-Text | YFGdb
Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20.
SGD paper | PubMed | Full-Text | Web Supplement | YFGdb

2003-07-29 YFL041W-A

Thanks to Kessler et al. for providing the coordinates of ORF YFL041W-A.

Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71.
SGD paper | PubMed | Full-Text

2003-07-29 YFL013W-A, YFL031C-A, YFR032C-B, YFR034W-A

Thanks to Kumar et al. for providing the coordinates of the following ORFs on Chromosome VI: YFL013W-A, YFL031C-A, YFR032C-B, YFR034W-A.

Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63.
SGD paper | PubMed | Full-Text | YFGdb | Comments & Errata

2003-07-29 YFL015W-A, YFL021C-A, YFR036W-A, YFR052C-A

Thanks to MIPS for providing the coordinates of the following ORFs on Chromosome VI: YFL015W-A, YFL021C-A, YFR036W-A, YFR052C-A.

2003-03-13 YFR024C, YFR024C-A

YFR024C is not a genuine ORF, but is the C-terminus of LSB3/YFR024C-A. The LSB3 gene contains an intron that has been demonstrated to be spliced. The ORF YFR024C has been deleted and the name YFR024C has been made an alias for LSB3/YFR024C-A.

Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6.
SGD paper | PubMed | Full-Text

2003-03-06 RUF7

Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8.

McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28.
SGD paper | PubMed | Full-Text

2001-03-15 ARS603.5

Coordinates courtesy of Katsuhiro Shirahige - Personal communication

2001-03-02 ARS601, ARS602, ARS603, ARS604, ARS605, ARS606, ARS607, ARS608, ARS609

The coordinates for the following ARS elements on Chromosome VI are courtesy of Katsuhiro Shirahige, based on Shirahige et al. 1993: ARS601, ARS602, ARS603, ARS604, ARS605, ARS606, ARS607, ARS608, ARS609.

Shirahige K, et al. (1993) Location and characterization of autonomously replicating sequences from chromosome VI of Saccharomyces cerevisiae. Mol Cell Biol 13(8):5043-56.
SGD paper | PubMed | Full-Text

Retrieved from "https://wiki.yeastgenome.org/index.php?title=Chromosome_VI_History&oldid=401410"