Difference between revisions of "Chromosome X History"
(→Annotation Changes without sequence changes) |
|||
(5 intermediate revisions by 2 users not shown) | |||
Line 1: | Line 1: | ||
This page lists all sequence and annotation changes that have been made to the Chromosome X systematic reference sequence since its intial release on 1996-07-31. <br> | This page lists all sequence and annotation changes that have been made to the Chromosome X systematic reference sequence since its intial release on 1996-07-31. <br> | ||
*The sequence of Chromosome X has been updated '''106''' times, affecting '''81''' features. <br> | *The sequence of Chromosome X has been updated '''106''' times, affecting '''81''' features. <br> | ||
− | *The annotation of Chromosome X has been updated ''' | + | *The annotation of Chromosome X has been updated '''33''' times, affecting '''67''' features. <br> |
*Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site]. | *Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site]. | ||
Line 1,455: | Line 1,455: | ||
{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6" | {| border="1" style="border-collapse:collapse; width:90%" cellpadding="6" | ||
! Date !! Affected Features | ! Date !! Affected Features | ||
+ | |- | ||
+ | |2021-04-21 | ||
+ | |[https://www.yeastgenome.org/locus/S000003773 YJR012C]<br> | ||
+ | Moved start to Met76 | ||
+ | *old coordinates: 459795..460418 Crick | ||
+ | *new coordinates: 459795..460193 Crick | ||
+ | :[https://www.yeastgenome.org/reference/S000216555 Sadhu et al 2018] PMID:29632376 | ||
+ | |- | ||
+ | |2021-04-21 | ||
+ | |[https://www.yeastgenome.org/locus/S000303810 YJR107C-A]<br> | ||
+ | New ORF | ||
+ | *coordinates 628457..628693 Crick | ||
+ | :[https://www.yeastgenome.org/reference/S000182052 Yagoub et al 2015] PMID:26554900 | ||
+ | :[https://www.yeastgenome.org/reference/S000217202 He et al 2018] PMID:29897761 | ||
|- | |- | ||
| 2014-11-19 | | 2014-11-19 | ||
Line 1,542: | Line 1,556: | ||
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
+ | |- | ||
+ | | 2004-01-27 | ||
+ | | [https://www.yeastgenome.org/locus/YJL031C YJL031C] <br> | ||
+ | Moved start 198 bp upstream, added an intron which was previously absent from the annotation. Encoded protein is 327 aa, as opposed to the previously annotated 290 aa.<br> <br> | ||
+ | '''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br> | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YJL096W YJL096W] <br> | ||
+ | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for MRPL49/YJL096W be moved 189 nt (63 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Graack et al (1998) identify MRPL49/YJL096W as 16kDa protein, a size consistent with the proposed change.<br><br> | ||
+ | '''Graack HR and Wittmann-Liebold B''' (1998) Mitochondrial ribosomal proteins (MRPs) of yeast. Biochem J 329 ( Pt 3)():433-48. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000058278 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9445368 PubMed] | [http://www.biochemj.org/content/329/3/433.long Full-Text] <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YJL091C YJL091C] <br> | ||
+ | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for GWT1/YJL091C be moved 24 nt (8 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br><br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YJL153C YJL153C] <br> | ||
+ | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for INO1/YJL153C be moved 66 nt (22 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 2) this N-terminus confirmed by sequencing of purified protein (Dean-Johnson M and Henry SA).<br><br> | ||
+ | '''Dean-Johnson M and Henry SA''' (1989) Biosynthesis of inositol in yeast. Primary structure of myo-inositol-1-phosphate synthase (EC 5.5.1.4) and functional analysis of its structural gene, the INO1 locus. J Biol Chem 264(2):1274-83. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000049582 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/2642902 PubMed] | [http://www.jbc.org/content/264/2/1274.long Full-Text] <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YJR022W YJR022W] <br> | ||
+ | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for LSM8/YJR022W be moved 57 nt (19 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br><br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YJR017C YJR017C] <br> | ||
+ | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for ESS1/YJR017C be moved 60 nt (20 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) This is the start site published by Hanes et al.<br><br> | ||
+ | '''Hanes SD, et al.''' (1989) Sequence and mutational analysis of ESS1, a gene essential for growth in Saccharomyces cerevisiae. Yeast 5(1):55-72. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000040668 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/2648698 PubMed] | [https://onlinelibrary.wiley.com/doi/abs/10.1002/yea.320050108 Full-Text] <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] | ||
+ | |- | ||
+ | | 2003-09-09 | ||
+ | | [https://www.yeastgenome.org/locus/TEL10L TEL10L], [https://www.yeastgenome.org/locus/TEL10R TEL10R] <br> | ||
+ | The chromosomal locations for TEL10L-XC, TEL10L-TR, TEL10L-XR, TEL10L, TEL10R-XC, TEL10R-XR, TEL10R-TR, TEL10L-YP and TEL10R were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).<br><br> | ||
+ | |- | ||
+ | | 2003-07-29 | ||
+ | | [https://www.yeastgenome.org/locus/YJL047C-A YJL047C-A], [https://www.yeastgenome.org/locus/YJL133C-A YJL133C-A], [https://www.yeastgenome.org/locus/YJL136W-A YJL136W-A] <br> | ||
+ | Thanks to [https://bioinformatik.wzw.tum.de/index.php?id=63 MIPS] for providing the coordinates of the following Chromosome X ORFs: YJL047C-A, YJL133C-A, and YJL136W-A. <br><br> | ||
+ | |- | ||
+ | | 2003-07-29 | ||
+ | | [https://www.yeastgenome.org/locus/YJL197C-A YJL197C-A] <br> | ||
+ | Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of YJL197C-A. <br><br> | ||
+ | '''Basrai MA, et al.''' (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000042214 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10490641 PubMed] | [https://mcb.asm.org/content/19/10/7041.long Full-Text] <br> | ||
+ | '''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br> | ||
+ | '''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073672 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] | [https://genome.cshlp.org/content/12/8/1210.long Full-Text] | [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br> | ||
+ | |- | ||
+ | | 2003-07-29 | ||
+ | | [https://www.yeastgenome.org/locus/YJL020W-A YJL020W-A], [https://www.yeastgenome.org/locus/YJL026C-A YJL026C-A], [https://www.yeastgenome.org/locus/YJL077W-A YJL077W-A], [https://www.yeastgenome.org/locus/YJL077W-B YJL077W-B], [https://www.yeastgenome.org/locus/YJL222W-A YJL222W-A], [https://www.yeastgenome.org/locus/YJL222W-B YJL222W-B], [https://www.yeastgenome.org/locus/YJL225W-A YJL225W-A], [https://www.yeastgenome.org/locus/YJR140W-A YJR140W-A] <br> | ||
+ | Thanks to Kumar et al. for providing the coordinates of the following Chromosome X ORFs: YJL026C-A, YJL077W-B, YJL222W-B, YJL225W-A, YJR140W-A, YJL222W-A, YJL077W-A, and YJL020W-A. <br><br> | ||
+ | '''Kumar A, et al.''' (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073673 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11753363 PubMed] | [https://www.nature.com/articles/nbt0102-58 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11753363&db=pmid YFGdb] | [https://www.yeastgenome.org/reference/S000141796 Comments & Errata] <br> | ||
+ | |- | ||
+ | | 2003-07-29 | ||
+ | | [https://www.yeastgenome.org/locus/YJR151W-A YJR151W-A] <br> | ||
+ | Thanks to Kessler et al. for providing the coordinates for YJR151W-A. <br><br> | ||
+ | '''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073671 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] | [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2003-07-29 | ||
+ | | [https://www.yeastgenome.org/locus/YJL127C-B YJL127C-B], [https://www.yeastgenome.org/locus/YJR005C-A YJR005C-A], [https://www.yeastgenome.org/locus/YJR112W-A YJR112W-A] <br> | ||
+ | Thanks to Brachat et al. for providing the coordinates of the following Chromosome X ORFs: YJR005C-A, YJR112W-A and YJL127C-B. <br><br> | ||
+ | '''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] | ||
+ | |- | ||
+ | | 2002-12-16 | ||
+ | | [https://www.yeastgenome.org/locus/ARS1001 ARS1001], [https://www.yeastgenome.org/locus/ARS1002 ARS1002], [https://www.yeastgenome.org/locus/ARS1003 ARS1003], [https://www.yeastgenome.org/locus/ARS1004 ARS1004], [https://www.yeastgenome.org/locus/ARS1005 ARS1005], [https://www.yeastgenome.org/locus/ARS1006 ARS1006], [https://www.yeastgenome.org/locus/ARS1007 ARS1007], [https://www.yeastgenome.org/locus/ARS1008 ARS1008], [https://www.yeastgenome.org/locus/ARS1009 ARS1009], [https://www.yeastgenome.org/locus/ARS1010 ARS1010], [https://www.yeastgenome.org/locus/ARS1011 ARS1011], [https://www.yeastgenome.org/locus/ARS1012 ARS1012], [https://www.yeastgenome.org/locus/ARS1013 ARS1013], [https://www.yeastgenome.org/locus/ARS1014 ARS1014], [https://www.yeastgenome.org/locus/ARS1015 ARS1015], [https://www.yeastgenome.org/locus/ARS1016 ARS1016], [https://www.yeastgenome.org/locus/ARS1017 ARS1017], [https://www.yeastgenome.org/locus/ARS1018 ARS1018], [https://www.yeastgenome.org/locus/ARS1019 ARS1019], [https://www.yeastgenome.org/locus/ARS1020 ARS1020], [https://www.yeastgenome.org/locus/ARS1022 ARS1022], [https://www.yeastgenome.org/locus/ARS1023 ARS1023], [https://www.yeastgenome.org/locus/ARS1024 ARS1024], [https://www.yeastgenome.org/locus/ARS1025 ARS1025] <br> | ||
+ | Coordinates courtesy of Dr. Oscar M. Aparicio, University of Southern California.<br> <br> | ||
+ | '''Wyrick JJ, et al.''' (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000069019 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11743203 PubMed] | [https://science.sciencemag.org/content/294/5550/2357.long Full-Text] | [https://www.ncbi.nlm.nih.gov/pubmed/11743187 Comments & Errata]<br> | ||
+ | |- | ||
+ | | 2002-11-19 | ||
+ | | [https://www.yeastgenome.org/locus/YJLWTy4-1 YJLWTy4-1], [https://www.yeastgenome.org/locus/YJLWdelta2 YJLWdelta2] <br> | ||
+ | The YJLWdelta2 element was initially mistakenly annotated as a separate LTR, though its coordinates completely overlapped with the full length transposon [https://www.yeastgenome.org/locus/YJLWTy4-1 YJLWTy4-1]. Thus, YJLWdelta2 has been deleted from the database.<br><br> | ||
+ | |- | ||
+ | | 2001-05-16 | ||
+ | | [https://www.yeastgenome.org/locus/snR128 snR128], [https://www.yeastgenome.org/locus/snR190 snR190] <br> | ||
+ | Personal communication: Dr. Eric Steinmetz Dept. of Biomolecular Chemistry University of Wisconsin 1300 University Ave. Madison, WI 53706<br><br> | ||
+ | |- | ||
+ | | 2000-10-17 | ||
+ | | [https://www.yeastgenome.org/locus/ARS1021 ARS1021] <br> | ||
+ | ARS1021 (aka ARS121) and ARS1501 were added to the genome annotation after personal communication from Shlomo Eisenberg. See Walker et al. 1991 for ARS1021 and Raychaudhuri et al. 1997 for ARS1501. <br><br> | ||
+ | '''Raychaudhuri S, et al.''' (1997) Functional analysis of a replication origin from Saccharomyces cerevisiae: identification of a new replication enhancer. Nucleic Acids Res 25(24):5057-64. | ||
+ | [https://www.yeastgenome.org/reference/S000044083 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9396816 PubMed] | [https://academic.oup.com/nar/article/25/24/5057/1749133 Full-Text] <br> | ||
+ | '''Walker SS, et al.''' (1991) Analysis of the interactions of functional domains of a nuclear origin of replication from Saccharomyces cerevisiae. Nucleic Acids Res 19(22):6255-62. | ||
+ | [https://www.yeastgenome.org/reference/S000049529 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/1956786 PubMed] | [https://academic.oup.com/nar/article/19/22/6255/1015625 Full-Text] <br> | ||
+ | |- | ||
+ | | 2000-08-11 | ||
+ | | [https://www.yeastgenome.org/locus/YJL205C YJL205C] <br> | ||
+ | Old name: YJL206C-A; new name: YJL205C-A; date: 11/1998; old coord: ChrX 50443 50139; SGDID: S0003742; Name changed due to nomenclature. <br><br> | ||
+ | |||
+ | |} |
Latest revision as of 15:08, 21 April 2022
This page lists all sequence and annotation changes that have been made to the Chromosome X systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome X has been updated 106 times, affecting 81 features.
- The annotation of Chromosome X has been updated 33 times, affecting 67 features.
- Current and past versions can be obtained from SGD's Download site.
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YJR103W | 622414 | 622414 | Insertion | C | |
A single C nucleotide was inserted very near the 3' end of ORF URA8/YJR103W, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 14 amino acids longer.
New 622379 GAAGGTGCTGGAACCATCAAGACCGTTTTGGGGGCTTGTGGCCGCAGCCTCCGGCACACT 622438 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 622368 GAAGGTGCTGGAACCATCAAGACCGTTTTGGGGGCTTGTGGCCGCAG-CTCCGGCACACT 622426 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL171C | 99777 | 99778 | Substitution | CG | GC |
99767 | 99767 | Substitution | G | C | ||
99792 | 99793 | Substitution | AA | TT | ||
Nucleotide changes within the coding region of YJL171C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 366 is now Lysine rather than Leucine, residue 371 is now Alanine rather than Arginine, and residue 374 is now Lysine rather than Asparagine.
New 99757 ATACACCGTTTTGCATCTTCGTTAAAGCAACACCATTCGACTTCGAGGTGGTCGAAGGCG 99816 |||||||||||||||| ||||||||| ||||||||||||| ||||||||||||||||| Old 99751 ATACACCGTTTTGCATGTTCGTTAAACGAACACCATTCGACAACGAGGTGGTCGAAGGCG 99810 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR107W | 627524 | 627525 | Substitution | CC | GG |
627367 | 627369 | Substitution | CCT | TCC | ||
Nucleotide change(s) in the coding region of YJR107W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 14 is now Proline rather than Leucine, and residue 66 is now Glycine rather than Proline.
New 627368 TGCCCATCACTCCATATATCTATGAGCGTCTAGTATATTTCTTCAACGACGGAGGTTGTC 627427 |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| Old 627357 TGCCCATCACCCTATATATCTATGAGCGTCTAGTATATTTCTTCAACGACGGAGGTTGTC 627416 New 627488 CACCACATATTAACTTCTGCAATGATGAGATAATTAACCCAACAGCGGGTCAAACAGTGG 627547 ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 627477 CACCACATATTAACTTCTGCAATGATGAGATAATTAACCCAACAGCGCCTCAAACAGTGG 627536 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR098C | 613918 | 613918 | Insertion | T | |
613905 | 613905 | Insertion | T | |||
613904 | 613904 | Insertion | T | |||
Three nucleotides were inserted near the middle of ORF YJR098C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
New 613899 TAAAAAAGTTGGTTTCTTTAGTGAAAATAGTTTTATTCCACATCACATCATCTCCAAACC 613958 |||||||||||||| | ||||||||||||| ||||||||||||||||||||||||||||| Old 613891 TAAAAAAGTTGGTT-C-TTAGTGAAAATAG-TTTATTCCACATCACATCATCTCCAAACC 613947 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL015C | 407437 | 407437 | Insertion | A | |
A single nucleotide was inserted within the ORF YJL015C very near its 5' end, necessitating a change in annotation to a downstream start codon. The sequence change makes the longer version of the protein no longer possible in the reference sequence. The stop and reading frame remain the same, but the annotated protein is now 30 amino acids shorter.
New 407400 TAAACTTTTTCGTTTAACGTGACGCATGGTGCGAAGAAAAAAAAATAGCAAATCGCCACT 407459 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 407394 TAAACTTTTTCGTTTAACGTGACGCATGGTGCGAAGAAAAAAAA-TAGCAAATCGCCACT 407452 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL130C | 171996 | 171997 | Substitution | CG | GC |
Nucleotide changes within the coding region of URA2/YJL130C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 123 is now Alanine rather than Arginine.
New 171954 AGCTGGGATCCCTTCATTTTGTAACCATTTACCTAAGGAAGATTTAGCAAGATAATGAGA 172013 |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 171950 AGCTGGGATCCCTTCATTTTGTAACCATTTACCTAAGGAAGATTTACGAAGATAATGAGA 172009 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL128C | 179435 | 179435 | Substitution | G | C |
179433 | 179433 | Substitution | C | G | ||
Nucleotide changes within the coding region of PBS2/YJL128C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 222-223 are now GL rather than AV.
New 179394 TTAGTGGGCATTTTTAATGACATTCCTCCTGGTGGTAATTTGAGCCCTCGACGGGCACTT 179453 ||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| Old 179390 TTAGTGGGCATTTTTAATGACATTCCTCCTGGTGGTAATTTGACCGCTCGACGGGCACTT 179449 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR150C | 709354 | 709354 | Substitution | C | T |
A single nucleotide substitution within the coding region of DAN1/YJR150C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 115 is now Glutamic Acid rather than Glycine.
New 709317 TGGAAGAAGCCTCTGTGGTAGAAGCTGGTACTGCAGTAGCAATACCTTCATTCGCAAGTG 709376 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 709307 TGGAAGAAGCCTCTGTGGTAGAAGCTGGTACTGCAGTAGCAATACCTCCATTCGCAAGTG 709366 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR149W | 708354 | 708354 | Substitution | T | A |
A single nucleotide substitution within the coding region of YJR149W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 402 is now Aspartic Acid rather than Valine.
New 708347 CGCAAGATTGAAAATTGACGGAAAATAATATAAATACATATAAAAGACCTGATACTTATT 708406 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 708337 CGCAAGATTGAAAATTGTCGGAAAATAATATAAATACATATAAAAGACCTGATACTTATT 708396 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR132W | 670283 | 670283 | Substitution | T | G |
A single nucleotide substitution within the coding region of NMD5/YJR132W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 258 is now Alanine rather than Serine.
New 670247 TTTTTTTGTCAGCATCATTCAGCAGCCATTGCCTCAGGAAGTTTTGGCTATATCAGATAT 670306 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 670237 TTTTTTTGTCAGCATCATTCAGCAGCCATTGCCTCAGGAAGTTTTGTCTATATCAGATAT 670296 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL179W | 89005 | 89005 | Substitution | C | A |
A single nucleotide substitution within the coding region of PFD1/YJL179W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 74 is now Aspartic Acid rather than Alanine.
New 88981 CAAATACGTTAATGATTTATCACATGACGAAACTGTTCTTCTGGATCAAAGAAAAACATT 89040 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 88979 CAAATACGTTAATGATTTATCACATGCCGAAACTGTTCTTCTGGATCAAAGAAAAACATT 89038 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL164C | 110920 | 110920 | Insertion | T | |
110898 | 110898 | Deletion | T | |||
Nucleotide changes within the coding region of TPK1/YJL164C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 79-86 are now SGKYSLQD rather than VGSIVYKN.
New 110877 TACCCAGTGTCCTTAATATCTGAAAGT-CTTGTAAACTATACTTCCCACTTGTAACTCTC 110935 ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| Old 110871 TACCCAGTGTCCTTAATATCTGAAAGTTCTTGTAAACTATACTTCCCACT-GTAACTCTC 110929 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR129C | 664657 | 664657 | Substitution | G | T |
A single nucleotide substitution within the coding region of YJR129C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 118 is now Lysine rather than Threonine.
New 664657 TTCCTCAATTTTGATCTTTACGTCCTCGTCAAACCTGTACCTCACGACGTCTTTCATCAT 664716 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 664647 TTCCTCAATTGTGATCTTTACGTCCTCGTCAAACCTGTACCTCACGACGTCTTTCATCAT 664706 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR106W | 625480 | 625480 | Substitution | G | A |
A single nucleotide substitution within the coding region of ECM27/YJR106W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 219 is now Asparagine rather than Aspartic Acid.
New 625479 GAGCCTCAGAGAAAACTCCGTTTCTCCTTTTTTGGATGACTCTCTGATGGCTTCTGGTTT 625538 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 625467 GAGCCTCAGAGAAGACTCCGTTTCTCCTTTTTTGGATGACTCTCTGATGGCTTCTGGTTT 625526 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL011C | 414287 | 414288 | Substitution | CG | GC |
Nucleotide substitutions within the coding region of RPC17/YJL011C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 159 is now Glycine rather than Alanine.
New 414280 TACACTCATGCGTAGCCAGAGATGATCTCTAGCATTTCCTCAATTGTTTTTTCGTCAAAT 414339 |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 414273 TACACTCATGCGTACGCAGAGATGATCTCTAGCATTTCCTCAATTGTTTTTTCGTCAAAT 414332 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL188C, YJL189W | 76241 | 76241 | Substitution | T | C |
A single nucleotide substitution within the coding region of BUD19/YJL188C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 90 is now Cysteine rather than Tyrosine. This nucleotide change is also present in the intron of the overlapping ORF, RPL39/YJL189W, but does not change the protein coding sequence of RPL39/YJL189W.
New 76201 TTTATGTCAGGTGGTATTGCCTTGGATCCGTGAATGCATCACATTGATGAGTTTGAACAT 76260 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 76200 TTTATGTCAGGTGGTATTGCCTTGGATCCGTGAATGCATCATATTGATGAGTTTGAACAT 76259 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL186W | 81335 | 81335 | Substitution | T | G |
A single nucleotide substitution within the coding region of MNN5/YJL186W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 395 is now Valine rather than Phenylalanine.
New 81301 CAAGGCACTGCCGGTGAAGGTGACAAAGACACTTTCGTCGCTGCTGCCCATGCCTTGAAT 81360 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 81299 CAAGGCACTGCCGGTGAAGGTGACAAAGACACTTTCTTCGCTGCTGCCCATGCCTTGAAT 81358 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL183W | 84958 | 84958 | Substitution | G | A |
A single nucleotide substitution within the coding region of MNN11/YJL183W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 298 is now Aspartic Acid rather than Glycine.
New 84911 AATCATTTTGAATATAGTTCGGCAAAGATTATCATTCCACATGATGCGGATGGTAATATT 84970 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 84909 AATCATTTTGAATATAGTTCGGCAAAGATTATCATTCCACATGATGCGGGTGGTAATATT 84968 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL172W, YJL173C | 97650 | 97650 | Insertion | G | |
97583 | 97583 | Insertion | C | |||
97489 | 97489 | Substitution | C | G | ||
97474 | 97474 | Substitution | A | G | ||
97253 | 97253 | Insertion | G | |||
97250 | 97250 | Insertion | T | |||
Several nucleotide changes were made in the intergenic region between ORFs RFA3/YJL173C and CPS1/YJL172W.
New 97211 CAAGGGATTATAGTACCTTCGCGAGTATTGCATATAAGCTTTTAGCGATACACAAACAAA 97270 |||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| Old 97209 CAAGGGATTATAGTACCTTCGCGAGTATTGCATATAAGCTTT-AGC-ATACACAAACAAA 97266 New 97441 AGAAACACCCACTTCTAGTAGCTTTACGTGACGAATTGAACCGCGTGATCTTGTGCACTG 97500 ||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| Old 97437 AGAAACACCCACTTCTAGTAGCTTTACGTGACGAATTAAACCGCGTGATCTTCTGCACTG 97496 New 97561 CTTATCATAGCGGCCTTTTATTTTCCCCTTTGGGCAAAATACGATACAGCCTTCCAAGGT 97620 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Old 97557 CTTATCATAGCGGCCTTTTATTTTCCC-TTTGGGCAAAATACGATACAGCCTTCCAAGGT 97615 New 97621 CGGGCAAGAAAGTTTATGACATATAAAAGAAACGGGTACCCCAAATACGTCTCTTCCCAT 97680 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old 97616 CGGGCAAGAAAGTTTATGACATATAAAAGAAACGG-TACCCCAAATACGTCTCTTCCCAT 97674 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL168C, YJL169W | 102642 | 102643 | Substitution | AA | GC |
102610 | 102610 | Substitution | A | C | ||
102276 | 102276 | Substitution | C | G | ||
Nucleotide changes within the coding regions of overlapping ORFs YJL169W and/or SET2/YJL168C resulted in altered protein sequences for both ORFs. The start, stop, and reading frame of YJL169W remain the same, but protein residue 62 is now Alanine rather than Proline. The start, stop, and reading frame of SET2/YJL168C also remain the same, but protein residue 594 is now Alanine rather than Phenylalanine, residue 605 is now Alanine rather than Serine, and residue 716 is now Alanine rather than Glycine.
New 102237 GTTGAAGGTGGAGGAGAAGACATCCTTGTTGATGCTGATGATAATGCCAACGCCTTTTTT 102296 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 102231 GTTGAAGGTGGAGGAGAAGACATCCTTGTTGATGCTGATGATAATCCCAACGCCTTTTTT 102290 New 102597 GCTTCCACTAGTTTTTTGGCCTCTTCCTTTTGTAACTCCTTCTGTTTGTTGGCCTCCGCT 102656 ||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| Old 102591 GCTTCCACTAGTTTTTTGGACTCTTCCTTTTGTAACTCCTTCTGTTTGTTGAACTCCGCT 102650 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL163C, YJL164C | 111646 | 111646 | Deletion | C | |
111288 | 111288 | Deletion | G | |||
Two separate single nucleotide deletions were made in the intergenic region between ORFs TPK1/YJL164C and YJL163C.
New 111246 AAGCCGATTGAAAATGCAAGCAAGCCAAACAAAAAAAAAAGTATAGGG-TCAGATTCCTT 111304 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 111240 AAGCCGATTGAAAATGCAAGCAAGCCAAACAAAAAAAAAAGTATAGGGGTCAGATTCCTT 111299 New 111605 TAGCAGCACAGCTTCGAACAAGTAACTAAAAATATGTGGTGTATAC-GGTATGTAAATGT 111663 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 111600 TAGCAGCACAGCTTCGAACAAGTAACTAAAAATATGTGGTGTATACCGGTATGTAAATGT 111659 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | ARS1007, YJL162C | 113842 | 113842 | Substitution | G | A |
A single nucleotide substitution was made in the intergenic region between ARS1007 and ORF JJJ2/YJL162C.
New 113814 ATTCAAATTATTTCCATCCTGGCGTAAGGACGACGGGTATATGCTCATTAAGAAGAGCGT 113873 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Old 113810 ATTCAAATTATTTCCATCCTGGCGTAAGGACGGCGGGTATATGCTCATTAAGAAGAGCGT 113869 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL095W, YJL096W | 247045 | 247045 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs MRPL49/YJL096W and BCK1/YJL095W.
New 247010 AAATCATGTAAATAACAATAAAATTTGACACACTTTCTTCGGCCCCAATGGCCATTCAAT 247069 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 247005 AAATCATGTAAATAACAATAAAATTTGACACACTTTCTTCG-CCCCAATGGCCATTCAAT 247063 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR001W, YJR002W | 438633 | 438633 | Insertion | A | |
A single nucleotide insertion was made in the intergenic region between ORFs AVT1/YJR001W and MPP10/YJR002W.
New 438599 ATTATTTCATAATCGACGAGGGGCATACTTACTCTACTTAAAATTCATTTACATTAGCTC 438658 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 438592 ATTATTTCATAATCGACGAGGGGCATACTTACTCTACTTAAA-TTCATTTACATTAGCTC 438650 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJLWtau4 | 422266 | 422266 | Deletion | C | |
A single nucleotide deletion was made within Ty4 LTR YJLWtau4.
New 422260 TCATTAATAAAGC-TTTTTGACCTCTACCTATGAGCAATAAACCATATCCATCAATAGTG 422318 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 422253 TCATTAATAAAGCCTTTTTGACCTCTACCTATGAGCAATAAACCATATCCATCAATAGTG 422312 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJLWdelta10, YJLWtau4 | 422450 | 422450 | Insertion | C | |
422448 | 422448 | Substitution | G | C | ||
A single nucleotide substitution and a single nucleotide insertion were made in the intergenic region between Ty4 LTR YJLWtau4 and Ty1 LTR YJLWdelta10.
New 422439 CAGTAAAATACTACGCGCCTAGTATAATGACTTCTATATCCAAAATTTTTAAGTTAACCT 422498 ||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| Old 422433 CAGTAAAATACTACGGGC-TAGTATAATGACTTCTATATCCAAAATTTTTAAGTTAACCT 422491 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR108W, YJR109C | 422266 | 422266 | Substitution | T | A |
A single nucleotide substitution was made within the intergenic region between ORFs ABM1/YJR108W and CPA2/YJR109C.
New 629447 GATCTACTTTTGTTCAAGATAATAATACTGGGGTAGAATATACACTAAGAAGTCTCTTTG 629506 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 629437 GATCTACTTTTGTTCAAGATAATAATACTGGGGTAGAATATACTCTAAGAAGTCTCTTTG 629496 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR107W, YJR108W | 422266 | 422266 | Deletion | T | |
A single nucleotide deletion was made within the intergenic region between ORFs YJR107W and YJR108W.
New 628608 TTATTCCAGTTCTCCTGGCCACTAATCCCGGCTACGC-TTTTGTTGAAATAGTATTCTTC 628666 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 628597 TTATTCCAGTTCTCCTGGCCACTAATCCCGGCTACGCTTTTTGTTGAAATAGTATTCTTC 628656 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR106W, YJR107W | 627314 | 627314 | Deletion | T | |
A single nucleotide deletion was made within the intergenic region between ORFs ECM27/YJR106W and YJR107W.
New 627289 ATAACAATGATGCCTGCCAGACTTTTCATACTATATC-TTTTTGTAGTACTCATGCCTGT 627347 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 627277 ATAACAATGATGCCTGCCAGACTTTTCATACTATATCTTTTTTGTAGTACTCATGCCTGT 627336 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJLWdelta1, tT(AGU)J | 59471 | 59471 | Insertion | C | |
A single nucleotide insertion was made in the intergenic region between tRNA-Thr tT(AGU)J and Ty1 LTR YJLWdelta1.
New 59461 GAGGCTTCGCCCATTCATTAAAGAGTATAGCTACCGCATACTGTTTAGTAGTATACTATC 59520 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 59461 GAGGCTTCGCC-ATTCATTAAAGAGTATAGCTACCGCATACTGTTTAGTAGTATACTATC 59519 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL157C, YJL158C | 123314 | 123314 | Substitution | T | C |
123309 | 123309 | Substitution | T | C | ||
Two separate single nucleotide substitutions were made in the intergenic region between ORFs CIS3/YJL158C and FAR1/YJL157C.
New 123294 GTATGGAATGCATAGGCGGCCCGGCCAGGCACCACGGAAAAAAGCTGATTGTCCTCTTTT 123353 ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| Old 123290 GTATGGAATGCATAGGCGGTCCGGTCAGGCACCACGGAAAAAAGCTGATTGTCCTCTTTT 123349 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL155C, YJL156C | 129110 | 129110 | Substitution | T | C |
A single nucleotide substitution was made in the intergenic region between ORFs SSY5/YJL156C and FBP26/YJL155C.
New 129104 TCCGCCGCGGCGTTCTACAATTTCACTTAAAATTAGTTTGGGTAATAATTACATACAATG 129163 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 129100 TCCGCCGCGGTGTTCTACAATTTCACTTAAAATTAGTTTGGGTAATAATTACATACAATG 129159 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL008C | 421510 | 421510 | Substitution | G | A |
A single nucleotide substitution was made within ORF CCT8/YJL008C. Note that the protein sequence was not affected.
New 421490 ATGGTTAACAATGATCTTGTTTCTACCACAGGGTCCCATAGAAGTCAAACACATTTGATG 421549 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Old 421483 ATGGTTAACAATGATCTTGTTTCTACCGCAGGGTCCCATAGAAGTCAAACACATTTGATG 421542 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL186W, YJL187C | 79350 | 79350 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs SWE1/YJL187C and MNN5/YJL186W.
New 79321 AGTAAGACCTGTTCAGTAGTAATCCTTTTTTTATTGGACTAACTGCGCAAGATGATGTGC 79380 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old 79320 AGTAAGACCTGTTCAGTAGTAATCCTTTTTT-ATTGGACTAACTGCGCAAGATGATGTGC 79378 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL185C, YJL186W | 81927 | 81927 | Substitution | A | T |
A single nucleotide substitution was made in the intergenic region between ORFs MNN5/YJL186W and YJL185C.
New 81901 GGGGAGAAAAACTAATGAAGTGATTAACTATAATAATTTAATAATAACTCGCCATCCGAC 81960 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Old 81899 GGGGAGAAAAACTAATGAAGTGATTAACAATAATAATTTAATAATAACTCGCCATCCGAC 81958 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL113W, YJL114W, YJLWTy4-1 | 198632 | 198632 | Deletion | G | |
198588 | 198588 | Deletion | A | |||
Two separate single nucleotide deletions were made within retrotransposon YJLWTy4-1, affecting Gag and Pol ORFs YJL114W and YJL113W.
New 198581 AAAAACAAA-TATAGAAGTTTGCATGGTAGAGATGTCAGAATTAGAGCCTGGG-AAAAGG 198639 ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| Old 198579 AAAAACAAAATATAGAAGTTTGCATGGTAGAGATGTCAGAATTAGAGCCTGGGGAAAAGG 198638 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR154W, YJR155W | 727112 | 727112 | Substitution | C | G |
A single nucleotide substitution was made within the intergenic region between ORFs YJR154W and AAD10/YJR155W.
New 727077 GTTGGGGACTGGTTAATTAATTGAATAGCTTCATAACCCACCGCCGCAAAATGTGCTCTT 727136 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 727067 GTTGGGGACTGGTTAATTAATTGAATAGCTTCATAACCCACCGCCCCAAAATGTGCTCTT 727126 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR153W, YJR154W | 724992 | 724992 | Substitution | G | T |
724284 | 724284 | Substitution | T | G | ||
Two separate single nucleotide substitutions were made in the intergenic region between ORFs PGU1/YJR153W and YJR154W.
New 724247 AAATGCGACTAAGTACTACAATTGAAACGAATGAGCGCACTTCATCTGCCTACAAAACGC 724306 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 724237 AAATGCGACTAAGTACTACAATTGAAACGAATGAGCGCACTTCATCTTCCTACAAAACGC 724296 New 724967 TTGTAATATGCGTTACTAGTAATTCCTTTGAATTTTTGAATGCTTTAACTGTGAGTTGGC 725026 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old 724957 TTGTAATATGCGTTACTAGTAATTCCTTTGAATTTGTGAATGCTTTAACTGTGAGTTGGC 725016 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR152W, YJR153W | 722285 | 722285 | Substitution | G | T |
A single nucleotide substitution was made within the intergenic region between ORFs DAL5/YJR152W and PGU1/YJR153W.
New 722267 CCGGATATGAGTAAGAGTGATCTTGCCGTAGAGATAATAGCTGCACAAAGGCCAAGGATT 722326 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Old 722257 CCGGATATGAGTAAGAGTGATCTTGCCGGAGAGATAATAGCTGCACAAAGGCCAAGGATT 722316 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR151W-A, YJR152W | 717775 | 717775 | Substitution | G | A |
717671 | 717671 | Substitution | C | A | ||
Two separate single nucleotide substitutions were made in the intergenic region between ORFs YJR151W-A and DAL5/YJR152W.
New 717672 AAAAAAAAAACCAGATCTGTTGATCAGTTGTAATCGTGTAAACGAGTACAAAAGGCCAGA 717731 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Old 717662 AAAAAAAAACCCAGATCTGTTGATCAGTTGTAATCGTGTAAACGAGTACAAAAGGCCAGA 717721 New 717732 GACAGCTTCTACTCCAAGCTTAAGATACGTATACACAAAAGATTTTTACTTGAAGGAGTA 717791 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Old 717722 GACAGCTTCTACTCCAAGCTTAAGATACGTATACACAAAAGATTTTTACTTGAGGGAGTA 717781 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR151C, YJR151W-A | 716502 | 716502 | Substitution | C | A |
716149 | 716149 | Substitution | A | T | ||
Two separate single nucleotide substitutions were made in the intergenic region between ORFs DAN4/YJR151C and YJR151W-A.
New 716147 TTGATGTCGTCGTTCAATAGACATTCACATAACTTTACTCTACGTGCTATACGCGCTACC 716206 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Old 716137 TTGATGTCGTCGATCAATAGACATTCACATAACTTTACTCTACGTGCTATACGCGCTACC 716196 New 716497 AGTCTACATGTGACAAAAAGAAAACCCAAATACTTCTTGGCTATGAATGTTATCGTTTGA 716556 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 716487 AGTCTACATGTGACACAAAGAAAACCCAAATACTTCTTGGCTATGAATGTTATCGTTTGA 716546 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL127C-B, YJL127W-A | 180996 | 180996 | Deletion | C | |
A single nucleotide deletion was made in the intergenic region between ORFs YJL127W-A and YJL127C-B.
New 180954 TTCCGTGCCTGCTGCTATGCTCAAGGGGAACAGAAAAGCAACACGC-TCAAAATAGTAAT 181012 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 180950 TTCCGTGCCTGCTGCTATGCTCAAGGGGAACAGAAAAGCAACACGCCTCAAAATAGTAAT 181009 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL124C, YJL125C | 187027 | 187027 | Deletion | A | |
A single nucleotide deletion was made in the intergenic region between ORFs GCD14/YJL125C and LSM1/YJL124C.
New 187013 ATTGTTCCATCTCCAAA-GGCAGTTGATTAAGTGTACGGATAGGTAAAACTGAATGTGGA 187071 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 187010 ATTGTTCCATCTCCAAAAGGCAGTTGATTAAGTGTACGGATAGGTAAAACTGAATGTGGA 187069 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL115W, YJL116C | 195502 | 195502 | Insertion | C | |
A single nucleotide insertion was made in the intergenic region between ORFs NCA3/YJL116C and ASF1/YJL115W.
New 180954 TTCCGTGCCTGCTGCTATGCTCAAGGGGAACAGAAAAGCAACACGC-TCAAAATAGTAAT 181012 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 180950 TTCCGTGCCTGCTGCTATGCTCAAGGGGAACAGAAAAGCAACACGCCTCAAAATAGTAAT 181009 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL112W | 205347 | 205347 | Substitution | C | A |
A single nucleotide substitution was made within ORF MDV1/YJL112W. Note that the protein sequence was not affected.
New 205310 AGTGAACGACCAAATAACTCATATAGGAAAAACATTGTCCACAACGGCTTCCGCTTTTTT 205369 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 205305 AGTGAACGACCAAATAACTCATATAGGAAAAACATTGTCCACCACGGCTTCCGCTTTTTT 205364 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR151C | 713832 | 713832 | Substitution | C | G |
A single nucleotide substitution was made within ORF DAN4/YJR151C. Note that the protein sequence was not affected.
New 713807 CTCGAGGAAACAACGGCTGAAGTGAAAGTGGATGTGGCAGATAGACTTTCAGTAGAAGAA 713866 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old 713797 CTCGAGGAAACAACGGCTGAAGTGAAAGTGGATGTCGCAGATAGACTTTCAGTAGAAGAA 713856 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR149W, YJR150C | 708438 | 708438 | Substitution | A | T |
A single nucleotide substitution was made within the intergenic region between ORFs YJR149W and DAN1/YJR150C.
New 708407 GACACAAATTTTCTGGATGACCTTTTTCTATATGATATATATACGTCGCTATTGGATCGT 708466 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 708397 GACACAAATTTTCTGGATGACCTTTTTCTATATGATATATAAACGTCGCTATTGGATCGT 708456 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | ARS1008 | 204550 | 204551 | Substitution | GT | TG |
204535 | 204535 | Insertion | AAT | |||
204533 | 204533 | Substitution | A | T | ||
204519 | 204519 | Insertion | T | |||
Several nucleotide changes were made within ARS1008.
New 204510 ATTACACGTTTTAAATACTAATTATTAAAATTTATCCTGATAAGTTGATCTTTATTTCCG 204569 ||||||||||| ||||||||||||| || |||||||||||||| ||||||||||||| Old 204508 ATTACACGTTT-AAATACTAATTATAAA---TTATCCTGATAAGTGTATCTTTATTTCCG 204564 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | ARS1006 | 99643 | 99643 | Deletion | A | |
99634 | 99634 | Deletion | T | |||
99573 | 99574 | Deletion | TA | |||
99532 | 99532 | Insertion | T | |||
99531 | 99531 | Insertion | A | |||
99525 | 99525 | Insertion | TT | |||
99469 | 99469 | Substitution | C | G | ||
Several nucleotide changes were made within ARS1006.
New 99421 TTGCCTTTGTTTACGAGTATATCGTTAATGTTAACGAATACGCTTAAGCGCAATGATTGA 99480 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Old 99415 TTGCCTTTGTTTACGAGTATATCGTTAATGTTAACGAATACGCTTAAGCGCAATCATTGA 99474 New 99481 ATAGTCAAAGATTTTTTTTTTTTAATTTTTTTTTTTTAATTTTTTTTTTTTTTCATAGAA 99540 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Old 99475 ATAGTCAAAGATTTTTTTTTTTTAATTTTTTTTTTTTAATTTTTTTTTTTT--CATAGA- 99531 New 99541 CTTTTTATTTAAATAAATCACGTCTATATATGTATCAGTATA--ACGTAAAAAAAAAAAC 99598 | |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 99532 C-TTTTATTTAAATAAATCACGTCTATATATGTATCAGTATATAACGTAAAAAAAAAAAC 99590 New 99599 ACCGTCAGTTAAACAAAACATAAATAAAAAAAAAAAGAAGTGT-CAAATCAA-GTGTCAA 99656 ||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| Old 99591 ACCGTCAGTTAAACAAAACATAAATAAAAAAAAAAAGAAGTGTTCAAATCAAAGTGTCAA 99650 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR138W | 687982 | 687982 | Substitution | A | G |
A single nucleotide substitution was made within ORF IML1/YJR138W. Note that the protein sequence was not affected.
New 687947 AGAGAAAGAAAAAAAAGGAAGAAAAACTAAGAGAGAAGAAATACAGCCTGAAGTTATGTT 688006 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 687937 AGAGAAAGAAAAAAAAGGAAGAAAAACTAAGAGAGAAGAAATACAACCTGAAGTTATGTT 687996 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR135C, YJR135W-A | 676910 | 676910 | Substitution | G | A |
A single nucleotide substitution was made within the intergenic region between ORFs MCM22/YJR135C and TIM8/YJR135W-A.
New 676907 ATTCATTTATATGAAAGTATTGAAGAAGAGGTAAAAAGGAAAACAAATTTACAAACAACA 676966 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 676897 ATTCATTTATATGGAAGTATTGAAGAAGAGGTAAAAAGGAAAACAAATTTACAAACAACA 676956 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL177W, YJL178C | 90365 | 90365 | Substitution | A | C |
A single nucleotide substitution was made in the intergenic region between ORFs ATG27/YJL178C and RPL17B/YJL177W.
New 90351 GGCGTGGGAAGTGAAGCTCTTTCGCTCTTTCTGTGATGATCTCCTTCCAGCTAGGCTCGG 90410 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 90349 GGCGTGGGAAGTGAAGATCTTTCGCTCTTTCTGTGATGATCTCCTTCCAGCTAGGCTCGG 90408 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL173C, YJL174W | 96057 | 96057 | Substitution | G | C |
A single nucleotide substitution was made in the intergenic region between ORFs KRE9/YJL174W and RFA3/YJL173C.
New 96011 GGAAGGCGTTAAGGCAGCAAGTACACATTCATTTATCTATCTATACATCTATAAACACAA 96070 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 96009 GGAAGGCGTTAAGGCAGCAAGTACACATTCATTTATCTATCTATACATGTATAAACACAA 96068 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2009-02-18 | YJL156C | 126896 | 126896 | Deletion | T | |
Poulsen et al. 2005 report an error in the systematic reference sequence for SSY5/YJL156C. There is an extra A in codon 685 (GAC) that should not be present in the sequence. SGD curators have corrected the sequence as necessary. Deletion of the A results in a frameshift that makes the Ssy5 protein 12 amino acids longer than previously annotated. Many thanks to Thorsten Pfirrmann for bringing this error to our attention.
new: 2113 TCAAAAAGGCAAATCATCCATCTAGTTGTGGATCAATGTCCCATTGAATTTTAGTTACAG 2054 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| old: 126836 TCAAAAAGGCAAATCATCCATCTAGTTGTGGATCAATGTCCCATTGAATTTTAGTTACAG 126895 new: 2053 -CATGTAGTCTCTCCAGGATATCACCTATAGGTGTGAACAAACCAAACTGCCTCTGTTCA 1995 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| old: 126896 TCATGTAGTCTCTCCAGGATATCACCTATAGGTGTGAACAAACCAAACTGCCTCTGTTCA 126955 Poulsen, et al. (2005) Constitutive Signal Transduction by Mutant Ssy5p and Ptr3p Components of the SPS Amino Acid Sensor System in Saccharomyces cerevisiae. Eukaryot Cell 4(6):1116-24. | ||||||
2008-06-04 | YJR092W | 599750 | 599750 | Substitution | A | T |
599715 | 599715 | Deletion | A | |||
599640 | 599640 | Deletion | A | |||
599597 | 599597 | Deletion | A | |||
John Koschwanez from Andrew Murray's lab at Harvard University sequenced BUD4/YJR092W in the S288C background and noted errors in the systematic reference sequence. As a result, the following corrections were made to the sequence of Chromosome 10 within BUD4/YJR092W: change A to T at 599750, delete A at 599715, delete A at 599640, delete A at 599597.
New: 841 AGTAACAATTCACATTCTGATTCAAGATC-GCCAACAGCCTCTGTGGAGGATTTAAACAT 899 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old: 599568 AGTAACAATTCACATTCTGATTCAAGATCAGCCAACAGCCTCTGTGGAGGATTTAAACAT 599627 New: 900 TTCAACGAATCT-GCCGGGTGCTGATTCCAGCCAAAATAATCCAGTCACTACTGATGCGG 958 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Old: 599628 TTCAACGAATCTAGCCGGGTGCTGATTCCAGCCAAAATAATCCAGTCACTACTGATGCGG 599687 New: 959 ATGCGCTTATTGAAAACGATGTTGTGC-GGGACCTTCAACAGAATATGGAACATATCGAT 1017 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Old: 599688 ATGCGCTTATTGAAAACGATGTTGTGCAGGGACCTTCAACAGAATATGGAACATATCGAT 599747 New: 1018 GATGCTTTTGATGAGAAAAAAGTTCTTGACGAAGGTTGCAGCAATGAGCCCGTTACCTTT 1077 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old: 599748 GAAGCTTTTGATGAGAAAAAAGTTCTTGACGAAGGTTGCAGCAATGAGCCCGTTACCTTT 599807 Koschwanez J and Murray A (2008) | ||||||
2006-10-04 | YJL159W | 120806 | 120909 | Substitution | GTGATGGTCAAATTCAAGCTACCAC CAAGACTACCTCTGCTAAGACTACC GCCGCTGCCGTTTCTCAAATCAGTG ATGGTCAAATCCAAGCTACCACCAC TACT |
AAATTGGTGATGGTCAAATTCAAGC TACCACCAAGACTACCTCTGCTAAG ACTACCGCCGCTGCCGTTTCTCAAA TCAGTGATGGTCAAATCCAAGCTAC CACCACTACTTTAGCCCCAAAGAGC ACCGCTGCTGCCGTTTCTCAAATCG GTGATGGTCAAGTTCAAGCTACCAC CACTACT |
Moukadiri and Zueco 2001 predicted, but did not confirm, two additional sequence insertions in HSP150/YJL159W. These two insertions (6 nts and 72 nts) were later confirmed in S288C by Marinangeli et al. 2004, and have been incorporated in SGD. Special thanks to Ivo Pedruzzi and the team at Swiss-Prot for bringing this change to our attention.
new 120745 TCTCAGATCGGTGATGGTCAAATCCAAGCTACTACTAAGACTACCGCTGCTGCTGTCTCT 120804 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| old 120745 TCTCAGATCGGTGATGGTCAAATCCAAGCTACTACTAAGACTACCGCTGCTGCTGTCTCT 120804 new 120805 CAAATTGGTGATGGTCAAATTCAAGCTACCACCAAGACTACCTCTGCTAAGACTACCGCC 120864 | ||||||||||||||||||||||||||||||||||||||||||||||||||||| old 120805 C------GTGATGGTCAAATTCAAGCTACCACCAAGACTACCTCTGCTAAGACTACCGCC 120858 new 120865 GCTGCCGTTTCTCAAATCAGTGATGGTCAAATCCAAGCTACCACCACTACTTTAGCCCCA 120924 ||||||||||||||||||||||||||||||||||||||||||||||||||| old 120859 GCTGCCGTTTCTCAAATCAGTGATGGTCAAATCCAAGCTACCACCACTACT--------- 120909 new 120924 AAGAGCACCGCTGCTGCCGTTTCTCAAATCGGTGATGGTCAAGTTCAAGCTACCACCACT 120984 old ------------------------------------------------------------ new 120985 ACTTTAGCCCCAAAGAGCACCGCTGCTGCCGTTTCTCAAATCGGTGATGGTCAAGTTCAA 121044 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| old 120910 ---TTAGCCCCAAAGAGCACCGCTGCTGCCGTTTCTCAAATCGGTGATGGTCAAGTTCAA 120966 Moukadiri I and Zueco J (2001) YJL159w does encode Pir2/Hsp150. Yeast 18(4):323-4. | ||||||
2006-01-18 | YJL170C | 101726 | 101726 | Insertion | G | |
SGD confirmed the sequence error suggested by Kellis et al and has updated the sequence accordingly. As a consequence of this change, ASG7/YJL170C has been extended on the 5' end, altering the N-terminus and increasing the size of the predicted protein from 183 to 209 amino acids.
Insert a G after the G at 101726 New: 101713 TCTCGAAGGGCGCGGCTAGATGTTTTGTTTT 101743 |||||||||||||| |||||||||||||||| Old: 101713 TCTCGAAGGGCGCG-CTAGATGTTTTGTTTT 101742 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2006-01-18 | YJL162C | 114328 | 114328 | Substitution | G | C |
114177 | 114177 | Substitution | T | A | ||
SGD confirmed the sequence error suggested by Kellis et al and has updated the sequence accordingly. As a consequence of this change, JJJ2/YJL162C has been extended on the 3' end, altering the C-terminus and increasing the size of the predicted protein from 482 to 583 amino acids.
(1) Substitute A for the T at 114177 New: 114156 ATCTCTGGTATTTCCAAATCTAAGATCTCGGGTGTAAT 114193 ||||||||||||||||||||| |||||||||||||||| Old: 114156 ATCTCTGGTATTTCCAAATCTTAGATCTCGGGTGTAAT 114193 AND (2) Substitute C for the G at 114328 New: 114311 TAACGAGTCATTAATTGCATCCATCATAAAATAATC 114346 ||||||||||||||||| |||||||||||||||||| Old: 114311 TAACGAGTCATTAATTGGATCCATCATAAAATAATC 114346 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-02-19 | YJL160C | 118303 | 118303 | Deletion | T | |
Kellis et al. and Brachat et al. independently predicted and confirmed the deletion of a single T nt. As a consequence of this sequence change, YJL160C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 180 to 287 amino acids.
New: 118271 CTTTTTCATTATTTGGTTTCTTTGTTGGCTCT-AACTTACTCTTGGAAAGCACAGAACTA 118329 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Old: 118271 CTTTTTCATTATTTGGTTTCTTTGTTGGCTCTTAACTTACTCTTGGAAAGCACAGAACTA 118330 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-02-18 | YJL159W | 121258 | 121258 | Insertion | CTACTTCCGCTTCTGCAGCCGCTAC CTCCACTGACCCAGTCGATGCTGTC TCCTGTAAGACTTCTGGTACCTTAG AAATGAACTTAAAGGGCGGTATCTT AACTGACGGTAAGGGTAGAATTGGT TCTATTGTTGCTAACAGACAATTCC AATTTGACGGTCCACCACCACAAGC TGGTGCCATCTACGCTGCTGGTTGG TCTATAACTCCAGACGGTAA | |
Both Brachat et al. 2003 and Moukadiri and Zueco 2001 independently predicted and confirmed a 220-bp insertion within HSP150/YJL159W. As a consequence of this sequence change, HSP150/YJL159W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 310 to 387 amino acids.
New: 121225 CAAGTAAGCGATGGCCAAGTCCAAGCTACTACTGCTACTTCCGCTTCTGCAGCCGCTACC 121284 |||||||||||||||||||||||||||||||||| Old: 121225 CAAGTAAGCGATGGCCAAGTCCAAGCTACTACTG-------------------------- 121258 New: 121285 TCCACTGACCCAGTCGATGCTGTCTCCTGTAAGACTTCTGGTACCTTAGAAATGAACTTA 121344 Old: ------------------------------------------------------------ New: 121345 AAGGGCGGTATCTTAACTGACGGTAAGGGTAGAATTGGTTCTATTGTTGCTAACAGACAA 121404 Old: ------------------------------------------------------------ New: 121405 TTCCAATTTGACGGTCCACCACCACAAGCTGGTGCCATCTACGCTGCTGGTTGGTCTATA 121464 Old: ------------------------------------------------------------ New: 121465 ACTCCAGACGGTAACTTGGCTATTGGTGACAATGATGTCTTCTACCAATGTTTGTCCGGT 121524 |||||||||||||||||||||||||||||||||||||||||||||| Old: 121259 --------------CTTGGCTATTGGTGACAATGATGTCTTCTACCAATGTTTGTCCGGT 121304 Moukadiri I and Zueco J (2001) YJL159w does encode Pir2/Hsp150. Yeast 18(4):323-4. | ||||||
2004-02-17 | YJL012C, YJL012C-A | 411268 | 411268 | Insertion | C | |
Heinz Neumann and coworkers predicted and confirmed a single nt insertion in VTC4/YJL012C (Genbank accession number AY264259). As a consequence of this sequence change, VTC4/YJL012C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 648 to 721 amino acids. As a consequence of this change, YJL012C-A was merged with VTC4/YJL012C.
New: 411230 TTTTGGTTCCACACGAACTGGCACACATATCGTCTTTCCCGGTGGGGCACGAATTTGAGT 411289 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old: 411230 TTTTGGTTCCACACGAACTGGCACACATATCGTCTTTCC-GGTGGGGCACGAATTTGAGT 411288 Muller O, et al. (2003) Role of the Vtc proteins in V-ATPase stability and membrane trafficking. J Cell Sci 116(Pt 6):1107-15. | ||||||
2004-02-12 | YJL178C | 89893 | 89893 | Insertion | G | |
Brachat et al. predicted and confirmed the insertion of a single G nt. As a consequence of this sequence change, YJL178C was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 196 to 271 amino acids.
New: 89864 ATAGCATGTCATTTTTTTTACATTCTTCAGGAGGTTCTACGTTATGCTCTTCGCAAACGT 89923 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Old: 89864 ATAGCATGTCATTTTTTTTACATTCTTCAG-AGGTTCTACGTTATGCTCTTCGCAAACGT 89922 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. | ||||||
2004-02-12 | YJR013W | 460195 | 460195 | Deletion | T | |
Brachat et al. predicted and confirmed the deletion of a single T nt. As a consequence of this sequence change, YJR013W was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 305 to 403 amino acids. This change was also predicted by Cliften et al. and Kellis et al..
New: 460173 GTACACTGATATCGACTATTTT-GTGTTTCATGATGCTGCTAAATATGTATACGAAGGCA 460231 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old: 460173 GTACACTGATATCGACTATTTTTGTGTTTCATGATGCTGCTAAATATGTATACGAAGGCA 460232 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2003-09-29 | YJL016W, YJL017W | 406238 | 406238 | Insertion | G | |
Due to insertion of G after the G at position 406238, the ORF YJL017W (405284-406261 (1-978)) was merged into YJL016W (406453-406968 (1-516)). The resulting longer ORF will retain the name YJL016W, with new coordinates 405284 - 406969 (1-1686). YJL017W is now an alias of YJL016W.
Old: 406201 TAGTGGATCCATCTATAGTAGTGCAAACAACGGCAGTG-TGACAGCAGCTCGACAGCATT 406259 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| New: 406201 TAGTGGATCCATCTATAGTAGTGCAAACAACGGCAGTGGTGACAGCAGCTCGACAGCATT 406260
| ||||||
2003-01-02 | YJL018W, YJL019W | 404443 | 404443 | Insertion | G | |
Due to the insertion of a single G nucleotide after the G at 404443 on chromosome 10, YJL018W and YJL019W have been merged into one single ORF - MPS3/YJL019W. Note that YJL018W and NEP98 are now aliases for this merged ORF. We thank Sue L. Jasperson and Mark Winey for reporting this sequence error to SGD.
Old: 404401 CATATCTCTGAGGAAATTTATCATCAACGGAGTGACACCGCAG-ATTTGCAAATAATTGA 404459 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| New: 404401 CATATCTCTGAGGAAATTTATCATCAACGGAGTGACACCGCAGGATTTGCAAATAATTGA 404460 Jaspersen SL, et al. (2002) Mps3p is a novel component of the yeast spindle pole body that interacts with the yeast centrin homologue Cdc31p. J Cell Biol 159(6):945-56. | ||||||
2001-06-27 | YJL020C, YJL021C | 399923 | 399923 | Insertion | GG | |
399914 | 399914 | Insertion | GG | |||
Sequence update from MIPS introduces two Gs after position 399914, then two more Gs after position 399923 on chromosome 10. Due to these 4 G insertions, the earlier ORFs YJL020C and YJL021C are now merged into one long ORF YJL020C of 1157 amino acids.
Old: 399901 CTGGAGGTACTGGG--TACTGGG--TACTGAAGGTGCAGAGAGTGCTGGAGGTGCTGGAG 399956 |||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| New: 399901 CTGGAGGTACTGGGGGTACTGGGGGTACTGAAGGTGCAGAGAGTGCTGGAGGTGCTGGAG 399960
| ||||||
1997-07-27 | YJR092W | 598745 | 598745 | Deletion | A | |
601831 | 601831 | Substitution | A | G | ||
598678 | 598678 | Deletion | G | |||
598510 | 598510 | Deletion | T | |||
Three separate single nucleotide deletions were made in the systematic sequence in the region upstream of the ORF BUD4/YJR092W. The T at 598510 was deleted, as was the G at 598678, and the A at 598745. In addition, a single nucleotide transition was made within BUD4/YJR092W. The A at 601831 was changed to a G.
New: 598501 ACGCAAAAT-GGTTCCGAAGATACACCACACAACTGGAAGCTTCCGCTGCAGGAAATAGG 598559 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Old: 598501 ACGCAAAATTGGTTCCGAAGATACACCACACAACTGGAAGCTTCCGCTGCAGGAAATAGG 598560 New: 598620 TAGAGGTCGATCACCTTCTAAGATGTCTACCATCTCAAATGAAAGCCTTAATTTGGG-TC 598678 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Old: 598621 TAGAGGTCGATCACCTTCTAAGATGTCTACCATCTCAAATGAAAGCCTTAATTTGGGGTC 598680 New: 598739 AAAA-CTCTGTTGCCAACGGGGCACTTGGTCATGCCAATTCTCCCAAAGTGCTTAATAAT 598797 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old: 598741 AAAAACTCTGTTGCCAACGGGGCACTTGGTCATGCCAATTCTCCCAAAGTGCTTAATAAT 598800 New: 601798 TTTGAATTGCCCATAGATTTTAAAGGAAAAGCCGAAACATCCTCCGCTTCTTCTGAAAGA 601857 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Old: 601801 TTTGAATTGCCCATAGATTTTAAAGGAAAAACCGAAACATCCTCCGCTTCTTCTGAAAGA 601860 | ||||||
1997-07-27 | YJL084C | 275144 | 275145 | Substitution | CC | GG |
The two CC nucleotides at chromosomal coordinates 275144-275145 within the ORF YJL084C were changed to GG.
New: 275101 AAGTTCGTCTTCTATTAAAACTTGATTTAAATCTGTGAAAAAAGGATTATCGTGTCTTAT 275160 ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old: 275101 AAGTTCGTCTTCTATTAAAACTTGATTTAAATCTGTGAAAAAACCATTATCGTGTCTTAT 275160 |
Annotation Changes without sequence changes
Date | Affected Features |
---|---|
2021-04-21 | YJR012C Moved start to Met76
|
2021-04-21 | YJR107C-A New ORF
|
2014-11-19 | ARS1004, ARS1006, ARS1007, ARS1008, ARS1009, ARS1025 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome X based on Liachko et al. 2013: ARS1004, ARS1006, ARS1007, ARS1008, ARS1009, ARS1025. |
2014-11-19 | ARS1005, ARS1006, ARS1007, ARS1010, ARS1021 The chromosomal coordinates of the following ARS elements on Chromosome X were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1005, ARS1006, ARS1007, ARS1010, ARS1021. |
2014-11-19 | IRT1 IRT1 was added to the genome annotation based on van Werven et al. 2012 as part of SGD's genome annotation revision R64.2. |
2014-11-18 | ETC3 The following previously unmapped features were identified as nuclear matrix attachment sites and assigned chromosomal coordinates based on Hiraga et al. 2012 as part of SGD's genome annotation revision R64.2: ETC1, ETC2, ETC3, ETC4, ETC6, ETC7, ETC8. |
2007-05-08 | snR3 Updated coordinates of snR3 based on GenBank Z49627, Z49629, and K01089. Changed from 195 nt in length to 194 nt by removing 1 nt from the 5' end. |
2007-04-04 | YJL130C URA2/YJL130C mRNA contains an intron in the 5' untranslated region (UTR). |
2007-04-04 | YJRCdelta19 YJLWdelta19, a Ty1 LTR on Chromosome X, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YJRCdelta19 and is annotated on the Crick strand. The name YJLWdelta19 is being retained as an alias. |
2007-04-04 | YJRCdelta16 YJLWdelta16, a Ty1 LTR on Chromosome X, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YJRCdelta16 and is annotated on the Crick strand. The name YJLWdelta16 is being retained as an alias. |
2007-04-04 | YJRCdelta15 YJLWdelta15, a Ty1 LTR on Chromosome X, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YJRCdelta15 and is annotated on the Crick strand. The name YJLWdelta15 is being retained as an alias. |
2006-09-07 | ARS1011, ARS1012, ARS1014, ARS1018, ARS1020, ARS1022, ARS1024 The coordinates of the following ARS elements on Chromosome X were updated based on Nieduszynski et al. 2006: ARS1011, ARS1012, ARS1014, ARS1018, ARS1020, ARS1022, ARS1024. |
2006-05-09 | YJR003C The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for YJR003C was moved 60 nt (20 codons) downstream. |
2005-12-01 | YJL046W The start site of YJL046W is being moved 126 bp downstream from 352176 to 352302 based on 5' SAGE data used by Zhang & Dietrich 2005 to study transcription start sites. The size of the predicted protein is reduced from 451 aa to 409 aa. |
2004-10-12 | CEN10 The orientation of this centromere was reversed (from Watson to Crick) and its coordinates expanded to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. (2001) and Espelin et al. (2003). |
2004-04-20 | YJR092W Based on the automated comparison of closely related Saccharomyces species by Kellis et al., the start site for BUD4/YJR092W was moved 384 nt upstream. Evidence supporting this change: 1) This is the predicted start methionine in S. paradoxus, S. mikatae, and S. bayanus orthologs; 2) Significant sequence conservation begins abruptly at this ATG. 3) Sanders and Herskowitz 1996 reported cloning and sequencing the BUD4 gene. Their sequence, GenBank accession number U41641, predicts a protein sequence beginning at the same place (starting with the peptide sequence MHDAE) as in the other three species and with a high level of similarity to them; 4) MIPS also annotates the protein sequence for this ORF as beginning at the earlier possible start site. |
2004-01-27 | YJL031C Moved start 198 bp upstream, added an intron which was previously absent from the annotation. Encoded protein is 327 aa, as opposed to the previously annotated 290 aa. |
2003-09-22 | YJL096W Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for MRPL49/YJL096W be moved 189 nt (63 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Graack et al (1998) identify MRPL49/YJL096W as 16kDa protein, a size consistent with the proposed change. |
2003-09-22 | YJL091C Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for GWT1/YJL091C be moved 24 nt (8 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-22 | YJL153C Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for INO1/YJL153C be moved 66 nt (22 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 2) this N-terminus confirmed by sequencing of purified protein (Dean-Johnson M and Henry SA). |
2003-09-22 | YJR022W Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for LSM8/YJR022W be moved 57 nt (19 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-22 | YJR017C Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for ESS1/YJR017C be moved 60 nt (20 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) This is the start site published by Hanes et al. |
2003-09-09 | TEL10L, TEL10R The chromosomal locations for TEL10L-XC, TEL10L-TR, TEL10L-XR, TEL10L, TEL10R-XC, TEL10R-XR, TEL10R-TR, TEL10L-YP and TEL10R were generously provided by Ed Louis and Dave Barton (University of Leicester, UK). |
2003-07-29 | YJL047C-A, YJL133C-A, YJL136W-A Thanks to MIPS for providing the coordinates of the following Chromosome X ORFs: YJL047C-A, YJL133C-A, and YJL136W-A. |
2003-07-29 | YJL197C-A Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of YJL197C-A. |
2003-07-29 | YJL020W-A, YJL026C-A, YJL077W-A, YJL077W-B, YJL222W-A, YJL222W-B, YJL225W-A, YJR140W-A Thanks to Kumar et al. for providing the coordinates of the following Chromosome X ORFs: YJL026C-A, YJL077W-B, YJL222W-B, YJL225W-A, YJR140W-A, YJL222W-A, YJL077W-A, and YJL020W-A. |
2003-07-29 | YJR151W-A Thanks to Kessler et al. for providing the coordinates for YJR151W-A. |
2003-07-29 | YJL127C-B, YJR005C-A, YJR112W-A Thanks to Brachat et al. for providing the coordinates of the following Chromosome X ORFs: YJR005C-A, YJR112W-A and YJL127C-B. |
2002-12-16 | ARS1001, ARS1002, ARS1003, ARS1004, ARS1005, ARS1006, ARS1007, ARS1008, ARS1009, ARS1010, ARS1011, ARS1012, ARS1013, ARS1014, ARS1015, ARS1016, ARS1017, ARS1018, ARS1019, ARS1020, ARS1022, ARS1023, ARS1024, ARS1025 Coordinates courtesy of Dr. Oscar M. Aparicio, University of Southern California. |
2002-11-19 | YJLWTy4-1, YJLWdelta2 The YJLWdelta2 element was initially mistakenly annotated as a separate LTR, though its coordinates completely overlapped with the full length transposon YJLWTy4-1. Thus, YJLWdelta2 has been deleted from the database. |
2001-05-16 | snR128, snR190 Personal communication: Dr. Eric Steinmetz Dept. of Biomolecular Chemistry University of Wisconsin 1300 University Ave. Madison, WI 53706 |
2000-10-17 | ARS1021 ARS1021 (aka ARS121) and ARS1501 were added to the genome annotation after personal communication from Shlomo Eisenberg. See Walker et al. 1991 for ARS1021 and Raychaudhuri et al. 1997 for ARS1501. |
2000-08-11 | YJL205C Old name: YJL206C-A; new name: YJL205C-A; date: 11/1998; old coord: ChrX 50443 50139; SGDID: S0003742; Name changed due to nomenclature. |