Difference between revisions of "Chromosome XV History"
(→Sequence Changes) |
|||
Line 731: | Line 731: | ||
||||||||||||||||||||||||||||| |||||||||| | ||||||||||||||||||||||||||||| |||||||||| | ||
Old: 42507 AAGGTATACCGTCGGAAATTCCGTGGCAG-TTTACAGGCC 42545</pre> | Old: 42507 AAGGTATACCGTCGGAAATTCCGTGGCAG-TTTACAGGCC 42545</pre> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2006-01-05 | ||
+ | | [https://www.yeastgenome.org/locus/YOR252W YOR252W] | ||
+ | | 803745 | ||
+ | | 803745 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
+ | |- | ||
+ | | || colspan="6" | SGD confirmed the sequence error predicted by the work of Kellis, et al, and have updated the systematic sequence accordingly. | ||
+ | <pre>New: 803730 ACGGTTCATCCGAAGGGTAGAAAGTATGAAAAGCT 803764 | ||
+ | |||||||||||||||| |||||||||||||||||| | ||
+ | Old: 803730 ACGGTTCATCCGAAGG-TAGAAAGTATGAAAAGCT 803763</pre> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2004-02-13 | ||
+ | | [https://www.yeastgenome.org/locus/YOR298C-A YOR298C-A] | ||
+ | | 877622 | ||
+ | | 877622 | ||
+ | | Insertion | ||
+ | | | ||
+ | | GC | ||
+ | |- | ||
+ | | || colspan="6" | Two nucleotides GC were inserted after the G at coordinate 877622 in what had previously been annotated as the intergenic region between YOR298C-A and YOR299W. This region is now part of YOR298C-A, as the start for this ORF was moved 279 bp upstream from 877403 to 877682 (note that YOR298C-A is encoded on the Crick strand). As a result, YOR298C-Ap was increased from 58 aa to 151 aa. See Brachat et al. 2003 and GenBank AY260886. This change was also predicted by Kellis et al. and Cliften et al. | ||
+ | <pre>Query: 361 AATTTGGCCTTGAGATCTGGCAACGTTGGCCCTTGGGCCAGAACCACCAGCTCTTGCTCT 420 | ||
+ | |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||
+ | Sbjct: 877587 AATTTGGCCTTGAGATCTGGCAACGTTGGCCCTTGG--CAGAACCACCAGCTCTTGCTCT 877644</pre> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br> | ||
+ | '''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2003-01-09 | ||
+ | | [https://www.yeastgenome.org/locus/YOR087W YOR087W], [https://www.yeastgenome.org/locus/YOR088W YOR088W] | ||
+ | | 488439 | ||
+ | | 488439 | ||
+ | | Insertion | ||
+ | | | ||
+ | | T | ||
+ | |- | ||
+ | | || colspan="6" | Due to the insertion of a T after the A at 488439 on chromosome 15, YOR087W and YOR088W have been merged to one single ORF - YVC1/YOR087W, with YOR088W as an alias. The old chromosomal coordinates for YOR087W were 487708-488451, and for YOR088W were 488286-489734. The new chromosomal coordinates for the fused ORF are 487708-489735. The old relative coordinates for YOR087W were 1-744, and for YOR088W were 1-1449. The new relative coordinates for the fused ORF are 1-2028.<br><br> | ||
+ | '''Denis V and Cyert MS''' (2002) Internal Ca(2+) release in yeast is triggered by hypertonic shock and mediated by a TRP channel homologue. J Cell Biol 156(1):29-34.<br> | ||
+ | [https://www.yeastgenome.org/reference/S000069157 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11781332 PubMed] | [http://jcb.rupress.org/content/156/1/29.long Full-Text] <br> | ||
+ | '''Palmer CP, et al.''' (2001) A TRP homolog in Saccharomyces cerevisiae forms an intracellular Ca(2+)-permeable channel in the yeast vacuolar membrane. Proc Natl Acad Sci U S A 98(14):7801-5. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000069248 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11427713 PubMed] | [https://www.pnas.org/content/98/14/7801.long Full-Text] <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2001-05-31 | ||
+ | | [https://www.yeastgenome.org/locus/YOR068C YOR068C], [https://www.yeastgenome.org/locus/YOR069W YOR069W] | ||
+ | | 453804 | ||
+ | | 453804 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
+ | |- | ||
+ | | || colspan="6" | Inserted one G nucleotide after the G at chromosomal coordinate 453805, in the intergenic region to the left of overlapping ORFs YOR068C and YOR068W: | ||
+ | <pre>Old: 453752 ATCCTGCAATAACAAGCCATGGACTACGAGGATAATCTAGAAGCACCTGTTTGG-ACGAA 453810 | ||
+ | |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||
+ | New: 453752 ATCCTGCAATAACAAGCCATGGACTACGAGGATAATCTAGAAGCACCTGTTTGGGACGAA 453811</pre> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 1997-08-11 | ||
+ | | [https://www.yeastgenome.org/locus/YOL025W YOL025W] | ||
+ | | 276609 | ||
+ | | 276609 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | A | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide substitution was made in the systematic sequence in the region covering the ORF LAG2/YOL025W. The G at 276609 was changed to an A. | ||
+ | <pre>New: 276601 AAAGCAGGAAATTTTACCCAAAAAATTGATGAAGGAGTGACCTTAAGAACAATGATTCTT 276660 | ||
+ | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||
+ | Old: 276601 AAAGCAGGGAATTTTACCCAAAAAATTGATGAAGGAGTGACCTTAAGAACAATGATTCTT 276660</pre> | ||
+ | |||
+ | |} | ||
+ | |||
+ | <br><br> | ||
+ | |||
+ | =Annotation Changes ''without sequence changes''= | ||
+ | {| border="1" style="border-collapse:collapse; width:90%" cellpadding="6" | ||
+ | ! Date !! Affected Features |
Revision as of 15:51, 2 October 2019
This page lists all sequence and annotation changes that have been made to the Chromosome XV systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome XV has been updated 63 times, affecting 53 features.
- The annotation of Chromosome XV has been updated 51 times, affecting 90 features.
- Current and past versions can be obtained from SGD's Download site.
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YOL138C | 64173 | 64173 | Substitution | G | C |
61985 | 61985 | Substitution | A | T | ||
63708 | 63708 | Substitution | C | T | ||
Nucleotide change(s) in the coding region of RTC1/YOL138C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 393 is now Cysteine rather than Serine, and residue 548 is now Aspartic Acid rather than Glycine.
New 61970 CGCATGTCTGGGCGATCCGATTATTGGTGCTGTATGGGAAGAAAGCTTTTTAAAAGTTTC 62029 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 61970 CGCATGTCTGGGCGAACCGATTATTGGTGCTGTATGGGAAGAAAGCTTTTTAAAAGTTTC 62029 New 63660 GTAGGTTGAAGCTCCGGTTCTACCACCTCATATGAGCCTATCTCTTGGTCAACTGAAAGT 63719 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 63660 GTAGGTTGAAGCTCCGGTTCTACCACCTCATATGAGCCTATCTCTTGGCCAACTGAAAGT 63719 New 64140 GCATTGGCATTGTCGCCAACAAACCAGAGGCAGCATTTACCGTCTCTACCACCTGTAGCA 64199 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 64140 GCATTGGCATTGTCGCCAACAAACCAGAGGCAGGATTTACCGTCTCTACCACCTGTAGCA 64199 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL142W | 56036 | 56036 | Substitution | C | G |
Nucleotide change(s) in the coding region of RRP40/YOL142W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 160 is now Leucine rather than Phenylalanine.
New 55991 CTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTGAATTTCGCACGCC 56050 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 55990 CTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTCAATTTCGCACGCC 56049 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL077C | 186243 | 186243 | Substitution | A | C |
Nucleotide change(s) in the coding region of BRX1/YOL077C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 161 is now Glycine rather than Cysteine.
New 186230 TTTGGTGGTACACCAAAATTATGCACTAGCAACTCCTTAATTAATTGGTAGTGTGGGGAG 186289 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 186230 TTTGGTGGTACACAAAAATTATGCACTAGCAACTCCTTAATTAATTGGTAGTGTGGGGAG 1862890 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL075C | 190052 | 190052 | Substitution | CG | GC |
Nucleotide change(s) in the coding region of YOL075C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1164 is now Alanine rather than Arginine.
New 190020 TTTCGAAAAATGTATTTGTCATTATACCAAGAGCTTCGCCACAACAGGTAACAATAAAGG 190079 |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 190020 TTTCGAAAAATGTATTTGTCATTATACCAAGACGTTCGCCACAACAGGTAACAATAAAGG 190079 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR306C | 889947 | 889947 | Substitution | G | C |
Nucleotide change(s) in the coding region of MCH5/YOR306C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 495 is now Cysteine rather than Serine.
New 889913 ATGTAGCAAACAGCGCTTACAAAAGTTGCCAAACCGCAAAAAATAATATAGTGTTGGTAA 889972 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 889911 ATGTAGCAAACAGCGCTTACAAAAGTTGCCAAACCGGAAAAAATAATATAGTGTTGGTAA 889970 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR149C | 611036 | 611036 | Substitution | A | G |
611023 | 611024 | Substitution | GC | TG | ||
Nucleotide change(s) in the coding region of SMP3/YOR149C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 122-123 are now IK rather than MQ.
New 610993 TACGTAAGAAGTTAAAAGTAGACTTTTTTTGATGAATTGTACGGCCTTTCTCTCATCCCT 611052 ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| Old 610994 TACGTAAGAAGTTAAAAGTAGACTTTTTTGCATGAATTGTACAGCCTTTCTCTCATCCCT 611053 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR140W | 588363 | 588365 | Substitution | GCG | AGC |
588344 | 588344 | Deletion | C | |||
588318 | 588318 | Insertion | T | |||
Nucleotide change(s) in the coding region of SFL1/YOR140W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 446-462 are now FVQYQPQSQQHVTYAKQ rather than LYNTNRSRNQHVTYASE.
New 588314 TTTTTGTACAATACCAACCGCAGTCGCAAC-AACATGTGACTTATGCGAAGCAACCGGCA 588372 |||| ||||||||||||||||||||||||| |||||||||||||||||| |||||||| Old 588315 TTTT-GTACAATACCAACCGCAGTCGCAACCAACATGTGACTTATGCGAGCGAACCGGCA 588373 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL058W | 220195 | 220195 | Deletion | T | |
220207 | 220207 | Insertion | C | |||
Nucleotide change(s) in the coding region of ARG1/YOL058W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 329-332 are now SYFT rather than FLLH.
New 220179 TTGATATATAACGGTT-CCTACTTCACCCCAGAGTGTGAGTACATCAGATCTATGATCCA 220238 |||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| Old 220179 TTGATATATAACGGTTTCCTACTTCACCC-AGAGTGTGAGTACATCAGATCTATGATCCA 220237 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR130C | 570495 | 570495 | Substitution | A | G |
Nucleotide change(s) in the coding region of ORT1/YOR130C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 105 is now Serine rather than Phenylalanine.
New 570474 TCAGGATTTGCCCCAACGGGGAAACGTTTGTATGTTTTTCTAAAAATTTAGAACATTGGT 570533 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 570475 TCAGGATTTGCCCCAACGGGAAAACGTTTGTATGTTTTTCTAAAAATTTAGAACATTGGT 570534 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR297C | 874911 | 874911 | Substitution | C | T |
Nucleotide change(s) in the coding region of TIM18/YOR297C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 137 is now Glutamic Acid rather than Glycine.
New 874863 TCCTCCATAGAGGCAATAAAGGGCGAGCTTATGCCATCTTGGATACTTTTCCTTCGGTAT 874922 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 874862 TCCTCCATAGAGGCAATAAAGGGCGAGCTTATGCCATCTTGGATACTTTCCCTTCGGTAT 874921 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL022C | 280393 | 280393 | Substitution | A | G |
A single nucleotide substitution was made within ORF TSR4/YOL022C. Note that the protein sequence was not changed.
New 280377 GGTACCCCATTCCATGCCGTTATCGACAGACACTACTTCTTCCAGATCAAAAATCATCTT 280436 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 280378 GGTACCCCATTCCATACCGTTATCGACAGACACTACTTCTTCCAGATCAAAAATCATCTT 280437 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR255W, YOR256C | 808197 | 808197 | Insertion | A | |
A single nucleotide insertion was made in the intergenic region between ORFs OSW1/YOR255W and TRE2/YOR256C.
New 808183 TTACATAATTAAAGAAAAAATTTTATTAACATACTTCCTTATACTTACAATATGTATTCT 808242 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 808184 TTACATAATTAAAG-AAAAATTTTATTAACATACTTCCTTATACTTACAATATGTATTCT 808242 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR298C-A, YOR299W | 877795 | 877795 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs MBF1/YOR298C-A and BUD7/YOR299W.
New 877783 CTATTATTGGTTAAGCGACAGGCGCCTTTCCAGCTACCTAATATATACCACCACCGTCAA 877842 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 877782 CTATTATTGGTTAA-CGACAGGCGCCTTTCCAGCTACCTAATATATACCACCACCGTCAA 877840 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | ARS1531 | 35765 | 35765 | Substitution | G | C |
A single nucleotide substitution was made within ARS1531.
New 35751 TTTTCAAAATCCGCGCAAAATTATAGAATTCATCATATATAATGAAGGAACTGTGTTCCT 35810 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 35750 TTTTCAAAATCCGCGGAAAATTATAGAATTCATCATATATAATGAAGGAACTGTGTTCCT 35809 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2004-01-23 | ARS1531, YOL152W | 36149 | 36149 | Substitution | G | A |
36119 | 36119 | Substitution | G | C | ||
36056 | 36056 | Substitution | G | A | ||
36013 | 36013 | Substitution | T | A | ||
Four separate single nucleotide substitutions were made in the intergenic region between ARS1531 and ORF FRE7/YOL152W.
New 36001 AAAACTTGAGAATAACATAACCCTTTAATAGGCCAATGCAACTGATAGAACACCAGAAAA 36060 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| Old 36000 AAAACTTGAGAATTACATAACCCTTTAATAGGCCAATGCAACTGATAGAACACCAGGAAA 36059 New 36061 AGTTGTAATGCCAGTGCGGCTGAACAGAATCTGTGGTAATAGATTTCGGGTATAATGCGC 36120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 36060 AGTTGTAATGCCAGTGCGGCTGAACAGAATCTGTGGTAATAGATTTCGGGTATAATGCGG 36119 New 36121 AAATTAGGAATACTCATATGTTCAGATAGAATAAATAATAAAGAGACCTTCAACATAAAA 36180 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old 36120 AAATTAGGAATACTCATATGTTCAGATAGGATAAATAATAAAGAGACCTTCAACATAAAA 36179 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR256C | 809751 | 809751 | Substitution | C | T |
A single nucleotide substitution was made within ORF TRE2/YOR256C. Note that the protein sequence was not changed.
New 809693 GTCTATATTCTCACCATATGGCTCAGATATGAAGATTACAGCTTTAGCTCCGAATTTCTC 809762 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 809693 GTCTATATTCTCACCATATGGCTCAGATATGAAGATTACAGCTTTAGCCCCGAATTTCTC 809762 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL125W | 84121 | 84121 | Substitution | T | C |
A single nucleotide substitution was made within ORF TRM13/YOL125W.
New 84110 AAAAAATGCAACAAGACCAAACTAAGCCATTTAAACGATGATAAGCCATACTATGAACCG 84169 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 84110 AAAAAATGCAATAAGACCAAACTAAGCCATTTAAACGATGATAAGCCATACTATGAACCG 84169 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL058W, YOL059W | 219000 | 219000 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs GPD2/YOL059W and ARG1/YOL058W.
New 218990 ATGACTGCGTAGCGGCAGATAGTGTAATCTGAGCAGTTGCGAGACCCAGACTGGCACTGT 219049 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 218990 ATGACTGCGTA-CGGCAGATAGTGTAATCTGAGCAGTTGCGAGACCCAGACTGGCACTGT 219048 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL036W, snR50 | 259235 | 259235 | Deletion | A | |
259230 | 259230 | Deletion | T | |||
Two single nucleotide deletions were made in the intergenic region between ORF YOL036W and snoRNA SNR50.
New 259199 ATTAGGATGGTAGCCCTACCTTTTTTTTTTTT-GGCA-CACATGGTCAACTTTTCTTCTC 259256 |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| Old 259198 ATTAGGATGGTAGCCCTACCTTTTTTTTTTTTTGGCAACACATGGTCAACTTTTCTTCTC 259257 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR106W, YOR107W | 521099 | 521099 | Deletion | C | |
521071 | 521071 | Insertion | A | |||
A single nucleotide insertion and a single nucleotide deletion were made in the intergenic region between ORFs VAM3/YOR106W and RGS2/YOR107W.
New 521055 TGGAGATGAAAAAAAAACTTGCTGAATAAAGATAGTTAAGGCGC-TAGTAATCAAATTAA 521113 |||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| Old 521056 TGGAGATGAAAAAAAA-CTTGCTGAATAAAGATAGTTAAGGCGCCTAGTAATCAAATTAA 521114 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR090C, YOR091W | 492979 | 492979 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs PTC5/YOR090C and TMA46/YOR091W.
New 492955 TACCCTCCAATCGATCCTTTTTTTCTTTTTTGTATCTTGTGTAGAAAGAAGTGAATCCTG 493014 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old 492957 TACCCTCCAATCGATCCTTTTTT-CTTTTTTGTATCTTGTGTAGAAAGAAGTGAATCCTG 493015 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL145C | 52199 | 52199 | Substitution | C | T |
50767 | 50767 | Substitution | C | T | ||
50430 | 50431 | Substitution | GG | CC | ||
50081 | 50081 | Substitution | T | C | ||
50069 | 50069 | Substitution | G | T | ||
49941 | 49941 | Substitution | G | T | ||
49922 | 49922 | Substitution | T | A | ||
49919 | 49919 | Substitution | A | T | ||
49912 | 49912 | Substitution | A | T | ||
49829 | 49829 | Substitution | G | T | ||
Several nucleotide changes were made in the coding region of CTR9/YOL145C, resulting in an altered protein sequence. The start, stop, and reading frame remain the same, but with the following changes: Gly197->Lys, Gly674->Glu, Thr786->Arg, Lys903->Glu, Arg907->Ser, residues 956-959 are now LIQE not IFQV, and Glu987->Lys.
New 49811 GTCTTGGCTTTTCTTCGTCATATTCATTGTCTTTATCAGACAGATCTGAA 49870 ||||||||| |||||||||||||||||||||||||||||||||||||||| Old 49820 GTCTTGGCTGTTCTTCGTCATATTCATTGTCTTTATCAGACAGATCTGAA 49869 New 49871 TCATCTTTAACATTATGTTCACTTATGGCCATGGCTTCTCGCTCCTGGAT 49920 |||||||||||||||||||||||||||||||||||||||||| |||||| Old 49870 TCATCTTTAACATTATGTTCACTTATGGCCATGGCTTCTCGCACCTGGAA 49919 New 49921 TAACTTTTGTGCCTCATCTTGTAGTTTCCTATACTCCTCTGCCTGTTTTT 49970 || |||||||||||||||||| |||||||||||||||||||||||||||| Old 49920 TATCTTTTGTGCCTCATCTTGGAGTTTCCTATACTCCTCTGCCTGTTTTT 49969 New 50041 AATTTTACGTGCTTCATCAATTTTGGCGCTTTGTTCCTTCTCAAATTCTT 50090 ||||||||||||||||||||||||||||| ||||||||||| |||||||| Old 50040 AATTTTACGTGCTTCATCAATTTTGGCGCGTTGTTCCTTCTTAAATTCTT 50089 New 50401 TTCCAAGGCTTTTTGATAAAAATTCACAGACCTTTCCTTAATGGCACGTG 50450 |||||||||||||||||||||||||||||| |||||||||||||||||| Old 50400 TTCCAAGGCTTTTTGATAAAAATTCACAGAGGTTTCCTTAATGGCACGTG 50449 New 50761 TGATTTTTCCTGTTCCTTTGGATTCCTGGACTTTTTACCGTCTCTGGCAA 50810 ||||||| |||||||||||||||||||||||||||||||||||||||||| Old 50760 TGATTTTCCCTGTTCCTTTGGATTCCTGGACTTTTTACCGTCTCTGGCAA 50809 New 52161 GCAATTCTTGAAAAATTTTCAGACTGGCCATATAATTTTTCTTCTGATAA 52210 ||||||||||||||||||||||||||||||||||||||| |||||||||| Old 52160 GCAATTCTTGAAAAATTTTCAGACTGGCCATATAATTTTCCTTCTGATAA 52209 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL140W, YOL141W | 58601 | 58601 | Substitution | C | G |
58558 | 58558 | Deletion | T | |||
A single nucleotide deletion and a single nucleotide substitution were made in the intergenic region between ORFs PPM2/YOL141W and ARG8/YOL140W.
New 58550 GGATTCGA-ATGGTTGCCAGCTCGCTATGTGACTCACTTAAAGTACATGATGCGTCATTG 58609 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Old 58550 GGATTCGATATGGTTGCCAGCTCGCTATGTGACTCACTTAAAGTACATGATCCGTCATTG 58609 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL139C, YOL140W | 60173 | 60173 | Substitution | A | G |
A single nucleotide substitution was made in the intergenic region between ORFs ARG8/YOL140W and CDC33/YOL139C.
New 60130 CTTACGTGATATGTACATGTGGTGCGTCTTTCATACCTTGAATGATATAATTAATAAGAG 60189 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 60130 CTTACGTGATATGTACATGTGGTGCGTCTTTCATACCTTGAATAATATAATTAATAAGAG 60189 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL135C, YOL136C | 69084 | 69084 | Substitution | C | T |
A single nucleotide substitution was made in the intergenic region between ORFs PFK27/YOL136C and MED7/YOL135C.
New 69060 AACCGAGTAATCCAATTTACTTTTTCTACTTTTTTTTCATTATCAATCGATTCAGATGCC 69119 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Old 69060 AACCGAGTAATCCAATTTACTTTTCCTACTTTTTTTTCATTATCAATCGATTCAGATGCC 69119 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR008C-A, YOR008W-B | 343142 | 343142 | Insertion | A | |
A single nucleotide insertion was made in the intergenic region between ORFs YOR008C-A and YOR008W-B.
New 343127 GAAGTATGTAAAAAAATTACACACCATTAAGTTCTTATGTAAACCGAAGTCTGGAAGAGA 343186 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 343128 GAAGTATGTAAAAAA-TTACACACCATTAAGTTCTTATGTAAACCGAAGTCTGGAAGAGA 343186 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR261C, YOR262W | 816959 | 816959 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs RPN8/YOR261C and YOR262W.
New 816943 TTTCCTTTCTTTCTTTCTTTTTTTAAATTCGAAAAATGCCCTCAATCAGTAGCAGTTGTA 817002 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 816943 TTTCCTTTCTTTCTTTC-TTTTTTAAATTCGAAAAATGCCCTCAATCAGTAGCAGTTGTA 817001 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL076W, YOL077C | 186978 | 186979 | Substitution | CG | GC |
A single nucleotide substitution was made in the intergenic region between ORFs BRX1/YOL077C and MDM20/YOL076W.
New 186960 ACAGAATTCATTGGCGAAGCAACGATACATAACGAGCTCGGTACAGCAATCATCGCATCG 187019 |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Old 186960 ACAGAATTCATTGGCGAACGAACGATACATAACGAGCTCGGTACAGCAATCATCGCATCG 187019 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL062C, YOL063C | 210486 | 210487 | Substitution | AC | CA |
210453 | 210454 | Substitution | AC | CA | ||
Two separate dinucleotide substitutions were made in the intergenic region between ORFs CRT10/YOL063C and APM4/YOL062C.
New 210440 TTAACAAAATGTGCATTCTAAAGGAAATTACTATAAAAAATACAGGCATGATAAAAATAT 210499 ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| Old 210440 TTAACAAAATGTGACTTCTAAAGGAAATTACTATAAAAAATACAGGACTGATAAAAATAT 210499 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR306C, YOR307C | 892173 | 892173 | Insertion | C | |
A single nucleotide insertion was made in the intergenic region between ORFs MCH5/YOR306C and SLY41/YOR307C.
New 892133 TTTCTCTCAACCTTTCGAGTACTTGGAAAAAGGAGTAGATCCGCTTTCAGCAATCGAAGC 892192 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 892131 TTTCTCTCAACCTTTCGAGTACTTGGAAAAAGGAGTAGATCCG-TTTCAGCAATCGAAGC 892189 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR354C, YOR355W | 1004737 | 1004737 | Deletion | T | |
A single nucleotide deletion was made in the intergenic region between ORFs MSC6/YOR354C and GDS1/YOR355W.
New 1004693 TCAGCATTCCATTATTGAAGGCTTTAAAATAATAGTTTCTTTTTTCC-TATTATTTTATT 1004751 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 1004690 TCAGCATTCCATTATTGAAGGCTTTAAAATAATAGTTTCTTTTTTCCTTATTATTTTATT 1004749 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR045W, YOR046C | 414326 | 414326 | Deletion | T | |
A single nucleotide deletion was made in the intergenic region between ORFs TOM6/YOR045W and DBP5/YOR046C.
New 414297 ATATGCTGTGTTTGTATTTATATAAGCTT-GCCTCACAAGTAAAAGTGGATCAACAAACT 414355 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old 414297 ATATGCTGTGTTTGTATTTATATAAGCTTTGCCTCACAAGTAAAAGTGGATCAACAAACT 414356 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL163W, YOL164W | 8476 | 8476 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs BDS1/YOL164W and YOL163W.
New 8461 AGAGCTTTTCGTATATTCTGTTTTCCTAATAACATTTACTATTGTGAATTGAAATTTAAA 8520 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 8461 AGAGCTTTTCGTATAT-CTGTTTTCCTAATAACATTTACTATTGTGAATTGAAATTTAAA 8519 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR049C, YOR050C | 423752 | 423752 | Deletion | T | |
A single nucleotide deletion was made in the intergenic region between ORFs RSB1/YOR049C and YOR050C.
New 423716 CGAAGGTTCGGTACCATACCACCATAAAGGGAATT-ACTGTTAGCTGCTGCTTCTAACTG 423774 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old 423717 CGAAGGTTCGGTACCATACCACCATAAAGGGAATTTACTGTTAGCTGCTGCTTCTAACTG 423776 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2006-01-05 | YOL152W | 42535 | 42535 | Insertion | G | |
A sequencing error was demonstrated in BY4741 (a derivative of S288C) by Mark Rinnerthaler and Michael Breitenbach, and SGD has updated the sequence accordingly. As a consequence of this change, the stop codon has been moved 27 nts upstream, shortening the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 629 to 620 amino acids. (Personal communication from MIPS, Mark Rinnerthaler and Michael Breitenbach)
New: 42507 AAGGTATACCGTCGGAAATTCCGTGGCAGGTTTACAGGCC 42546 ||||||||||||||||||||||||||||| |||||||||| Old: 42507 AAGGTATACCGTCGGAAATTCCGTGGCAG-TTTACAGGCC 42545 | ||||||
2006-01-05 | YOR252W | 803745 | 803745 | Insertion | G | |
SGD confirmed the sequence error predicted by the work of Kellis, et al, and have updated the systematic sequence accordingly.
New: 803730 ACGGTTCATCCGAAGGGTAGAAAGTATGAAAAGCT 803764 |||||||||||||||| |||||||||||||||||| Old: 803730 ACGGTTCATCCGAAGG-TAGAAAGTATGAAAAGCT 803763 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-02-13 | YOR298C-A | 877622 | 877622 | Insertion | GC | |
Two nucleotides GC were inserted after the G at coordinate 877622 in what had previously been annotated as the intergenic region between YOR298C-A and YOR299W. This region is now part of YOR298C-A, as the start for this ORF was moved 279 bp upstream from 877403 to 877682 (note that YOR298C-A is encoded on the Crick strand). As a result, YOR298C-Ap was increased from 58 aa to 151 aa. See Brachat et al. 2003 and GenBank AY260886. This change was also predicted by Kellis et al. and Cliften et al.
Query: 361 AATTTGGCCTTGAGATCTGGCAACGTTGGCCCTTGGGCCAGAACCACCAGCTCTTGCTCT 420 |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 877587 AATTTGGCCTTGAGATCTGGCAACGTTGGCCCTTGG--CAGAACCACCAGCTCTTGCTCT 877644 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2003-01-09 | YOR087W, YOR088W | 488439 | 488439 | Insertion | T | |
Due to the insertion of a T after the A at 488439 on chromosome 15, YOR087W and YOR088W have been merged to one single ORF - YVC1/YOR087W, with YOR088W as an alias. The old chromosomal coordinates for YOR087W were 487708-488451, and for YOR088W were 488286-489734. The new chromosomal coordinates for the fused ORF are 487708-489735. The old relative coordinates for YOR087W were 1-744, and for YOR088W were 1-1449. The new relative coordinates for the fused ORF are 1-2028. Denis V and Cyert MS (2002) Internal Ca(2+) release in yeast is triggered by hypertonic shock and mediated by a TRP channel homologue. J Cell Biol 156(1):29-34. | ||||||
2001-05-31 | YOR068C, YOR069W | 453804 | 453804 | Insertion | G | |
Inserted one G nucleotide after the G at chromosomal coordinate 453805, in the intergenic region to the left of overlapping ORFs YOR068C and YOR068W:
Old: 453752 ATCCTGCAATAACAAGCCATGGACTACGAGGATAATCTAGAAGCACCTGTTTGG-ACGAA 453810 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| New: 453752 ATCCTGCAATAACAAGCCATGGACTACGAGGATAATCTAGAAGCACCTGTTTGGGACGAA 453811 | ||||||
1997-08-11 | YOL025W | 276609 | 276609 | Substitution | G | A |
A single nucleotide substitution was made in the systematic sequence in the region covering the ORF LAG2/YOL025W. The G at 276609 was changed to an A.
New: 276601 AAAGCAGGAAATTTTACCCAAAAAATTGATGAAGGAGTGACCTTAAGAACAATGATTCTT 276660 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Old: 276601 AAAGCAGGGAATTTTACCCAAAAAATTGATGAAGGAGTGACCTTAAGAACAATGATTCTT 276660 |
Annotation Changes without sequence changes
Date | Affected Features |
---|