Difference between revisions of "Chromosome XIV History"
(→Sequence Changes) |
(→Sequence Changes) |
||
Line 569: | Line 569: | ||
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br> | '''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br> | ||
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br> | [https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2004-02-18 | ||
+ | | [https://www.yeastgenome.org/locus/YNL195C YNL195C] | ||
+ | | 271649 | ||
+ | | 271649 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
+ | |- | ||
+ | | || colspan="6" | Kellis et al. predicted and confirmed the insertion of a single G nt. As a consequence of this sequence change, YNL195C was extended at the 3' end, altering the C-terminus and increasing the predicted protein from 243 to 261 amino acids. | ||
+ | <pre>New: TTGTGCCGATCACCCACACCGTAGGCGTAGGTTTCCTTTTCCTCAGTTTCCTGATTGAAT | ||
+ | |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||
+ | Sbjct: 271626 TTGTGCCGATCACCCACACCGTAG-CGTAGGTTTCCTTTTCCTCAGTTTCCTGATTGAAT 271684</pre> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 1998-11-10 | ||
+ | | [https://www.yeastgenome.org/locus/YNL180C YNL180C] | ||
+ | | 299726 | ||
+ | | 299726 | ||
+ | | Deletion | ||
+ | | AT | ||
+ | | | ||
+ | |- | ||
+ | | || colspan="6" | An AT dinucleotide at chromosomal coordinates 299726-299727 within YNL180C was removed. This corresponds to relative coordinates 171-172, and causes a frameshift. The protein is now annotated as 331 amino acids in length. | ||
+ | <pre>Old: 299701 TTGGTTTAGCTTGCTTGTTGTGATGATATTATTTGAGGCAATTTTACTACCTTTGCTTTT 299760 | ||
+ | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||
+ | New: 299701 TTGGTTTAGCTTGCTTGTTGTGATGAT--TATTTGAGGCAATTTTACTACCTTTGCTTTT 299758</pre> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 1997-07-27 | ||
+ | | [https://www.yeastgenome.org/locus/YNL051W YNL051W], [https://www.yeastgenome.org/locus/YNL052W YNL052W] | ||
+ | | 532300 | ||
+ | | 532300 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
+ | |- | ||
+ | | || colspan="6" | A single G was inserted after the G at 532300 in the intergenic region between COX5A/YNL052W and COG5/YNL051W. | ||
+ | <pre>New: 532260 ACGAAAGTGAATATCTTATTACATTATAAGTGTATCCATGGGCATCCGCCCAATACAATG 532319 | ||
+ | ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||
+ | Old: 532260 ACGAAAGTGAATATCTTATTACATTATAAGTGTATCCATGG-CATCCGCCCAATACAATG 532318</pre> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 1997-07-27 | ||
+ | | [https://www.yeastgenome.org/locus/YNL059C YNL059C], [https://www.yeastgenome.org/locus/YNL061W YNL061W] | ||
+ | | 512412 | ||
+ | | 512412 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
+ | |- | ||
+ | | || colspan="6" | A single G was inserted after the G at 512412 in the intergenic region between NOP2/YNL061W and ARP5/YNL059C. | ||
+ | <pre>New: 512401 ACAAACGTAGTGGCATCATGTTAGCATAGTTTTCTCTCTCTAATCTTTCTCTGTCTACAT 512460 | ||
+ | |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | ||
+ | Old: 512401 ACAAACGTAGTG-CATCATGTTAGCATAGTTTTCTCTCTCTAATCTTTCTCTGTCTACAT 512459</pre> | ||
+ | |||
+ | |} | ||
+ | |||
+ | <br><br> | ||
+ | |||
+ | =Annotation Changes ''without sequence changes''= | ||
+ | {| border="1" style="border-collapse:collapse; width:90%" cellpadding="6" | ||
+ | ! Date !! Affected Features |
Revision as of 13:58, 2 October 2019
This page lists all sequence and annotation changes that have been made to the Chromosome XIV systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome XIV has been updated 43 times, affecting 41 features.
- The annotation of Chromosome XIV has been updated 33 times, affecting 59 features.
- Current and past versions can be obtained from SGD's Download site.
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YNL008C | 618198 | 618198 | Deletion | G | |
A single C nucleotide was deleted within ORF YNL008C, altering its coding sequence. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 7 amino acids longer.
New 618178 AAAAGCTAAATACATCTC-TGTTATGGAGCAATTGCTTAACATGTTGCAATATATTTGTA 618236 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 618180 AAAAGCTAAATACATCTCGTGTTATGGAGCAATTGCTTAACATGTTGCAATATATTTGTA 618239 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL243W | 189081 | 189081 | Substitution | CG | GC |
Nucleotide change(s) in the coding region of SLA2/YNL243W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 344 is now Alanine rather than Arginine.
New 189059 ATCCCCACTGCCACTGGTGCAGCTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAG 189118 ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 189060 ATCCCCACTGCCACTGGTGCACGTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAG 189119 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL175C | 307728 | 307728 | Substitution | T | G |
Nucleotide change(s) in the coding region of NOP13/YNL175C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 296 is now Alanine rather than Glutamic Acid.
New 307678 ATTCGCAATGGCCTTCCGGCAATTTTTCTACAACTTTTATCCTTTAATGCATTAGTAGAT 307737 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 307680 ATTCGCAATGGCCTTCCGGCAATTTTTCTACAACTTTTATCCTTTAATTCATTAGTAGAT 307739 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL176C | 306231 | 306231 | Substitution | C | A |
Nucleotide change(s) in the coding region of YNL176C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 251 is now Phenylalanine rather than Cysteine.
New 306178 GAAAGCGATGAACTGTAAAACGATGTGGAAGTATTCCGACTGGAACTTGGGAATGTGGTA 306237 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Old 306180 GAAAGCGATGAACTGTAAAACGATGTGGAAGTATTCCGACTGGAACTTGGGCATGTGGTA 306239 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL271C | 132573 | 132573 | Substitution | T | C |
Nucleotide change(s) in the coding region of BNI1/YNL271C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 938 is now Alanine rather than Threonine.
New 132539 TGGAAATATCATTACTTTCCATTTGGATTTCAGCCAAAGCCCGCCTTAGGTCATTTAGTT 132598 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 132540 TGGAAATATCATTACTTTCCATTTGGATTTCAGTCAAAGCCCGCCTTAGGTCATTTAGTT 132599 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL177C | 304165 | 304165 | Substitution | G | T |
Nucleotide change(s) in the coding region of MRPL22/YNL177C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 151 is now Leucine rather than Phenylalanine.
New 304138 CTAGTACTTCAATTTCTCTTTTTGTTAACTTTAGCTTGTAACGTTCGCTAGAATTTGGTA 304197 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 304140 CTAGTACTTCAATTTCTCTTTTTGTGAACTTTAGCTTGTAACGTTCGCTAGAATTTGGTA 304199 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL193W | 274732 | 274732 | Substitution | G | C |
Nucleotide change(s) in the coding region of YNL193W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 122 is now Leucine rather than Valine.
New 274679 GCAATACGTGAAAATGGATGATATGCCTGATCTTTCCAATTTGGTGTTATCTCTGCCACA 274738 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Old 274680 GCAATACGTGAAAATGGATGATATGCCTGATCTTTCCAATTTGGTGTTATCTGTGCCACA 274739 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL172W | 315278 | 315278 | Substitution | T | G |
Nucleotide change(s) in the coding region of APC1/YNL172W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1547 is now Methionine rather than Isoleucine.
New 315238 CCACATCCCTTACAAGAATTGAAGCATTTCTGGAGCATGGCTGTAGAGCCTCGTTGCCTT 315297 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Old 315240 CCACATCCCTTACAAGAATTGAAGCATTTCTGGAGCATTGCTGTAGAGCCTCGTTGCCTT 315299 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL327W | 25775 | 25775 | Substitution | G | A |
Nucleotide change(s) in the coding region of EGT2/YNL327W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 577 is now Threonine rather than Alanine.
New 25741 CCAGTTTATCATCCGGCCCATTTGTTTCAAACACAACGGTTGCCTCTGGGTCTTATATTC 25800 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old 25740 CCAGTTTATCATCCGGCCCATTTGTTTCAAACACAGCGGTTGCCTCTGGGTCTTATATTC 25799 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL192W | 278945 | 278945 | Substitution | T | G |
Nucleotide change(s) in the coding region of CHS1/YNL192W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 815 is now Valine rather than Phenylalanine.
New 278939 TCCTAGTCTTTAGAATTCTCACTGTTTCTATTGCACTGGCATACCATTCAGCATTTAATG 278998 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 278940 TCCTATTCTTTAGAATTCTCACTGTTTCTATTGCACTGGCATACCATTCAGCATTTAATG 278999 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL186W | 290429 | 290429 | Substitution | T | G |
Nucleotide change(s) in the coding region of UBP10/YNL186W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 310 is now Glutamic Acid rather than Aspartic Acid.
New 290398 GGAGAGGAGGAGGAAGAAGAGGAAGAAGAGCTGAAACATAAATCTAGGTCAATCACCCCT 290457 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old 290400 GGAGAGGAGGAGGAAGAAGAGGAAGAAGATCTGAAACATAAATCTAGGTCAATCACCCCT 290459 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL181W | 299120 | 299120 | Substitution | C | G |
Nucleotide change(s) in the coding region of YNL181W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 262 is now Alanine rather than Proline.
New 299098 AAAACCAAAAGACGAATGGCGCTGAAAGAACAGGAAAAAATGTTACCATTACTATGGTTC 299157 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 299100 AAAACCAAAAGACGAATGGCCCTGAAAGAACAGGAAAAAATGTTACCATTACTATGGTTC 299159 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL271C, YNL272C | 129279 | 129279 | Deletion | A | |
A single nucleotide deletion was made in the intergenic region between ORFs SEC2/YNL272C and BNI1/YNL271C.
New 129240 TAAACGAGAGCCATGTTTTAAAGGTGCTTCAGCGAACGC-GAAATACAAGTTCCGGGTAG 129298 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old 129240 TAAACGAGAGCCATGTTTTAAAGGTGCTTCAGCGAACGCAGAAATACAAGTTCCGGGTAG 129299 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNR055C, YNR056C | 731363 | 731363 | Insertion | C | |
A single nucleotide insertion was made in the intergenic region between ORFs HOL1/YNR055C and BIO5/YNR056C.
New 731337 GTAAAATGGCTTTATGTGTTCTGATCTTATAATGAATCGTAATCGAAATCCACATATTTC 731396 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 731339 GTAAAATGGCTTTATGTGTTCTGAT-TTATAATGAATCGTAATCGAAATCCACATATTTC 731397 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNR053C | 721794 | 721794 | Insertion | A | |
A single nucleotide insertion was made within the intron of ORF NOG2/YNR053C.
New 721737 GACGTTCCTTTGACAAATGTTTGACCCAAGCTGCCTACTTGTAAAGTTAGAATTGAAAAAAAAAAACCTT 721806 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 721740 GACGTTCCTTTGACAAATGTTTGACCCAAGCTGCCTACTTGTAAAGTTAGAATTG-AAAAAAAAAACCTT 721808 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNR070W | 766524 | 766524 | Substitution | C | T |
A single nucleotide substitution was made within ORF PDR18/YNR070W. Note that the protein sequence was not changed.
New 766497 ATTAGACTTTGCACTATTAGAGGTTTTCTAAGGATTTACGGTGATAAGTCATACACCGTT 766556 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 766498 ATTAGACTTTGCACTATTAGAGGTTTCCTAAGGATTTACGGTGATAAGTCATACACCGTT 766557 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL128W | 383566 | 383566 | Substitution | A | G |
A single nucleotide substitution was made within ORF TEP1/YNL128W. Note that the protein sequence was not changed.
New 383518 CAGATTACTTTCAAGTAGAGAGGTTAAAGAGAGACGAAATGCTTGGGACAACCATAAGCT 383577 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 383520 CAGATTACTTTCAAGTAGAGAGGTTAAAGAGAGACGAAATGCTTGGAACAACCATAAGCT 383579 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL133C, tF(GAA)N | 374744 | 374744 | Substitution | T | C |
374768 | 374768 | Substitution | A | C | ||
374810 | 374810 | Substitution | A | C | ||
Three separate single nucleotide substitutions were made in the intergenic region between ORF FYV6/YNL133C and tRNA tF(GAA)N.
New 374698 TATAACAGAGCCCACAGTCTTTTGTTGGAACCGCTTTCTCTAGGCTTCGATGGACTTACA 374757 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 374700 TATAACAGAGCCCACAGTCTTTTGTTGGAACCGCTTTCTCTAGGTTTCGATGGACTTACA 374759 New 374758 TCTAATTGCACATTCTCGTGCGTTTAAACGTCATTTTTCCCTCAGATTGGCAGTGCATCA 374817 |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| Old 374760 TCTAATTGAACATTCTCGTGCGTTTAAACGTCATTTTTCCCTCAGATTGGAAGTGCATCA 374819 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL141W, YNL142W | 359024 | 359024 | Substitution | C | T |
A single nucleotide substitution was made in the intergenic region between ORFs MEP2/YNL142W and AAH1/YNL141W.
New 358978 TTATGTTTAATCTTTATGTAACGCTTCATTTAATAATTTTATTTTTAATATTTGATATAT 359037 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 358980 TTATGTTTAATCTTTATGTAACGCTTCATTTAATAATTTTATTTCTAATATTTGATATAT 359039 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL173C, YNL175C | 308753 | 308753 | Substitution | G | C |
A single nucleotide substitution was made in the intergenic region between NOP13/YNL175C and MDG1/YNL173C.
New 308698 CATCTATGCTCATCGCAATTTTTTCTTTCAGACTGAAAAATTTCAGGTTTTTGCATTTCA 308757 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Old 308700 CATCTATGCTCATCGCAATTTTTTCTTTCAGACTGAAAAATTTCAGGTTTTTGGATTTCA 308759 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL327W, YNL328C | 23471 | 23471 | Insertion | C | |
A single nucleotide insertion was made in the intergenic region between ORFs MDJ2/YNL328C and EGT2/YNL327W.
New 23461 GGCAGTAATGCCATAACGAAGATCAATAGTGTATGGGATGTTGGATATGTCGTTTCCCTG 23520 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 23461 GGCAGTAATGC-ATAACGAAGATCAATAGTGTATGGGATGTTGGATATGTCGTTTCCCTG 23519 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL307C, YNL308C | 56227 | 56227 | Deletion | A | |
A single nucleotide deletion was made in the intergenic region between ORFs KRI1/YNL308C and MCK1/YNL307C.
New 56221 AAAAAAA-TTAGGAACATAAAATAAAAAATAAAGAAGAAATTGAAGGAGTGACTGGATAA 56279 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Old 56220 AAAAAAAATTAGGAACATAAAATAAAAAATAAAGAAGAAATTGAAGGAGTGACTGGATAA 56279 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL187W, YNL188W | 287983 | 287983 | Deletion | A | |
A single nucleotide deletion was made in the intergenic region between ORFs KAR1/YNL188W and SWT21/YNL187W.
New 287939 CGAGTATCCACGACTAGGAGAATCACCATATATCAATATGACA-GACGACTTCAGAATGG 287997 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 287940 CGAGTATCCACGACTAGGAGAATCACCATATATCAATATGACAAGACGACTTCAGAATGG 287999 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL192W, YNL193W | 276356 | 276356 | Substitution | A | G |
A single nucleotide substitution was made in the intergenic region between ORFs YNL193W and CHS1/YNL192W.
New 276299 ATTGATTTTAATATATATCTCGGGTTCATTTTTTACGTCGGTACTCCAAAGGATCAGAACACTTACATTT 276368 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 276300 ATTGATTTTAATATATATCTCGGGTTCATTTTTTACGTCGGTACTCCAAAGGATCAAAACACTTACATTT 276369 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2010-01-05 | YNL083W | 472581 | 472581 | Substitution | T | G |
472585 | 472585 | Substitution | C | GG | ||
SAL1 contains a frameshift mutation (the sal1-1 allele) in certain laboratory strains, including S288C. The sal1-1 frameshift mutation results in the encoding of missense amino acids starting with the 403rd codon, and truncates the protein to 494 amino acids from its "wild-type" length in other strains of 545 amino acids. The annotation of SAL1 was altered in SGD in February 2004 away from the sal1-1 allele after sequence comparisons to related fungi (Belenkiy et al. 2000; Brachat et al. 2003). Dimitrov et al. (2009) sequenced the SAL1 gene from strains BY4716 and S288C, and discovered that these strains do both indeed contain the sal1-1 allele despite the previous annotation change in SGD. The correct annotation of SAL1 has now been reinstated in SGD. Belenkiy R, et al. (2000) The yeast mitochondrial transport proteins: new sequences and consensus residues, lack of direct relation between consensus residues and transmembrane helices, expression patterns of the transport protein genes, and protein-protein interactions with other proteins. Biochim Biophys Acta 1467(1):207-18. | ||||||
2006-11-09 | YNL103W | 429061 | 429061 | Substitution | G | C |
429057 | 429058 | Substitution | CG | GC | ||
The systematic sequence is being updated within the ORF YNL103W with the following three transversions: C to G at chromosomal coordinate 429057, G to C at 429058, and G to C at 429061. These are nucleotide positions 1321, 1322, and 1325 within ORF YNL103W, changing amino acids 441 and 442 from Arg-Gly to Ala-Ala. Thanks to Phil Robinson in Roger Kornberg's lab for alerting SGD to these sequencing errors.
New: 1311 GGCTGAAACTGCTGCGCCAACTACCTTATCAACGTCGCCTTCGTTCAATGAGCACGGTGTAGTAGCAGAG 1380 |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old: 429047 GGCTGAAACTCGTGGGCCAACTACCTTATCAACGTCGCCTTCGTTCAATGAGCACGGTGTAGTAGCAGAG 429116 | ||||||
2005-11-07 | YNL304W | 60402 | 60402 | Insertion | C | |
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. and Cliften et al. suggested that the start site for YPT11/YNL304W be moved 185 nt upstream. This change required a sequencing error in the reference strain. SGD confirmed a sequencing error in this position, and the systematic sequence has been updated accordingly. As a consequence of this sequence change, YPT11/YN304W was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 355 to 417 amino acids.
New: 60367 CACCGATACGGACTAACGAATCCAATTGGGAAGCTGCTTCGCCAGCGAGTGCTGCATCTT 60426 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old: 60367 CACCGATACGGACTAACGAATCCAATTGGGAAGCTG-TTCGCCAGCGAGTGCTGCATCTT 60425 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2005-11-03 | YNL299W | 68349 | 68349 | Insertion | C | |
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the stop site for TRF5/YNL299W be moved 50 nt downstream. The insertion of a single C nt was confirmed in S. cerevisiae strains BMA38, BY4741, LMA210 (Jon Houseley, personal communication) and S288C (SGD). The systematic sequence has been updated accordingly. As a consequence of this sequence change, TRF5/YNL299W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 625 to 642 amino acids.
New: 68328 GATCAAAAAGGAAGAGATACCCCTTCGGGACAAGATGAGAAATCACCACTGGAAACT 68384 |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old: 68328 GATCAAAAAGGAAGAGATACCC-TTCGGGACAAGATGAGAAATCACCACTGGAAACT 68383 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-07-22 | YNL064C, YNL065W | 505515 | 505515 | Insertion | C | |
The work of Kellis et al. proposed an indel that would shorten the YNL065W reading frame. Sequencing of S288C by SGD confirmed the current sequence for YNL065W, but an error in the intergenic region between YNL065W and YNL064C was identified. This insertion does not affect any coding features.
New: ATTAATTGGCATTCTTCAATTTGATAGACACTTATCCCTGCATATTTTTTTTATAAACAG ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old: 505479 ATTAATTGGCATTCTTCAATTTGATAGACACTTATCC-TGCATATTTTTTTTATAAACAG 505537 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-02-19 | YNL208W | 254767 | 254767 | Insertion | G | |
254927 | 254927 | Insertion | G | |||
Kellis et al. predicted and confirmed the insertion of two nucleotides. As a consequence of this sequence change, YNL208W was shortened at the 3' end, altering the C-terminus and decreasing the predicted protein from 204 to 199 amino acids.
New: AAGGTGGACACAACAACCATCACCGTCAGGACAATAACAACAATAACGGTGGATTTGGCG ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 254739 AAGGTGGACACAACAACCATCACCGTCAG-ACAATAACAACAATAACGGTGGATTTGGCG 254797 New: AAGGATTCGGTGGTCCAAATCCTCAAGAATTCGGCGGGCCAGGTGGCCAAGGATTCGGTG ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 254891 AAGGATTCGGTGGTCCAAATCCTCAAGAATTCGGCGG-CCAGGTGGCCAAGGATTCGGTG 254949 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-02-18 | YNL083W | 472580 | 472580 | Substitution | G | C |
471764 | 471764 | Substitution | G | A | ||
472576 | 472576 | Substitution | G | T | ||
472581 | 472581 | Deletion | G | |||
Brachat et al. 2003 predicted the extension of the 3' end of YNL083W based on the automated comparison of related fungi. Belenkiy et al. 2000 had previously confirmed the sequence change in strain CG379. The sequence is available in GenBank (accession number AF419344). As a consequence, YNL083W was extended in the 3' end, increasing the size of the predicted protein from 494 amino acids to 545 amino acids. This C-terminal extension is also conserved in S. bayanus, S. mikatae, S. paradoxus, and S. kluyveri.
New: GAACTTAATCATGAACTTTCAAATGAAAAGATGAACAAATTCTCGAGGTTTTTTGAATGG |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 471734 GAACTTAATCATGAACTTTCAAATGAAAAGGTGAACAAATTCTCGAGGTTTTTTGAATGG 471793 New: GTGGGC-TCAGATTATTTTACAGAGGTGTCACAGTCGGTATAGTGGGCATATTTCCCTA | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 472574 GGGGGGGTCAGATTATTTTACAGAGGTGTCACAGTCGGTATAGTGGGCATATTTCCCTA 472633 Belenkiy R, et al. (2000) The yeast mitochondrial transport proteins: new sequences and consensus residues, lack of direct relation between consensus residues and transmembrane helices, expression patterns of the transport protein genes, and protein-protein interactions with other proteins. Biochim Biophys Acta 1467(1):207-18. | ||||||
2004-02-18 | YNL195C | 271649 | 271649 | Insertion | G | |
Kellis et al. predicted and confirmed the insertion of a single G nt. As a consequence of this sequence change, YNL195C was extended at the 3' end, altering the C-terminus and increasing the predicted protein from 243 to 261 amino acids.
New: TTGTGCCGATCACCCACACCGTAGGCGTAGGTTTCCTTTTCCTCAGTTTCCTGATTGAAT |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 271626 TTGTGCCGATCACCCACACCGTAG-CGTAGGTTTCCTTTTCCTCAGTTTCCTGATTGAAT 271684 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
1998-11-10 | YNL180C | 299726 | 299726 | Deletion | AT | |
An AT dinucleotide at chromosomal coordinates 299726-299727 within YNL180C was removed. This corresponds to relative coordinates 171-172, and causes a frameshift. The protein is now annotated as 331 amino acids in length.
Old: 299701 TTGGTTTAGCTTGCTTGTTGTGATGATATTATTTGAGGCAATTTTACTACCTTTGCTTTT 299760 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| New: 299701 TTGGTTTAGCTTGCTTGTTGTGATGAT--TATTTGAGGCAATTTTACTACCTTTGCTTTT 299758 | ||||||
1997-07-27 | YNL051W, YNL052W | 532300 | 532300 | Insertion | G | |
A single G was inserted after the G at 532300 in the intergenic region between COX5A/YNL052W and COG5/YNL051W.
New: 532260 ACGAAAGTGAATATCTTATTACATTATAAGTGTATCCATGGGCATCCGCCCAATACAATG 532319 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old: 532260 ACGAAAGTGAATATCTTATTACATTATAAGTGTATCCATGG-CATCCGCCCAATACAATG 532318 | ||||||
1997-07-27 | YNL059C, YNL061W | 512412 | 512412 | Insertion | G | |
A single G was inserted after the G at 512412 in the intergenic region between NOP2/YNL061W and ARP5/YNL059C.
New: 512401 ACAAACGTAGTGGCATCATGTTAGCATAGTTTTCTCTCTCTAATCTTTCTCTGTCTACAT 512460 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Old: 512401 ACAAACGTAGTG-CATCATGTTAGCATAGTTTTCTCTCTCTAATCTTTCTCTGTCTACAT 512459 |
Annotation Changes without sequence changes
Date | Affected Features |
---|