Difference between revisions of "Chromosome XIV History"
(Created page with "This page lists all sequence and annotation changes that have been made to the Chromosome XIV systematic reference sequence since its intial release on 1996-07-31. <br> *The s...") |
(→Sequence Changes) |
||
Line 71: | Line 71: | ||
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||
Old 306180 GAAAGCGATGAACTGTAAAACGATGTGGAAGTATTCCGACTGGAACTTGGGCATGTGGTA 306239</pre> | Old 306180 GAAAGCGATGAACTGTAAAACGATGTGGAAGTATTCCGACTGGAACTTGGGCATGTGGTA 306239</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YNL271C YNL271C] | ||
+ | | 132573 | ||
+ | | 132573 | ||
+ | | Substitution | ||
+ | | T | ||
+ | | C | ||
+ | |- | ||
+ | | || colspan="6" | Nucleotide change(s) in the coding region of BNI1/YNL271C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 938 is now Alanine rather than Threonine. | ||
+ | <pre>New 132539 TGGAAATATCATTACTTTCCATTTGGATTTCAGCCAAAGCCCGCCTTAGGTCATTTAGTT 132598 | ||
+ | ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | ||
+ | Old 132540 TGGAAATATCATTACTTTCCATTTGGATTTCAGTCAAAGCCCGCCTTAGGTCATTTAGTT 132599</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YNL177C YNL177C] | ||
+ | | 304165 | ||
+ | | 304165 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | T | ||
+ | |- | ||
+ | | || colspan="6" | Nucleotide change(s) in the coding region of MRPL22/YNL177C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 151 is now Leucine rather than Phenylalanine. | ||
+ | <pre>New 304138 CTAGTACTTCAATTTCTCTTTTTGTTAACTTTAGCTTGTAACGTTCGCTAGAATTTGGTA 304197 | ||
+ | ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | ||
+ | Old 304140 CTAGTACTTCAATTTCTCTTTTTGTGAACTTTAGCTTGTAACGTTCGCTAGAATTTGGTA 304199</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YNL193W YNL193W] | ||
+ | | 274732 | ||
+ | | 274732 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | C | ||
+ | |- | ||
+ | | || colspan="6" | Nucleotide change(s) in the coding region of YNL193W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 122 is now Leucine rather than Valine. | ||
+ | <pre>New 274679 GCAATACGTGAAAATGGATGATATGCCTGATCTTTCCAATTTGGTGTTATCTCTGCCACA 274738 | ||
+ | |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | ||
+ | Old 274680 GCAATACGTGAAAATGGATGATATGCCTGATCTTTCCAATTTGGTGTTATCTGTGCCACA 274739</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YNL172W YNL172W] | ||
+ | | 315278 | ||
+ | | 315278 | ||
+ | | Substitution | ||
+ | | T | ||
+ | | G | ||
+ | |- | ||
+ | | || colspan="6" | Nucleotide change(s) in the coding region of APC1/YNL172W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1547 is now Methionine rather than Isoleucine. | ||
+ | <pre>New 315238 CCACATCCCTTACAAGAATTGAAGCATTTCTGGAGCATGGCTGTAGAGCCTCGTTGCCTT 315297 | ||
+ | |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | ||
+ | Old 315240 CCACATCCCTTACAAGAATTGAAGCATTTCTGGAGCATTGCTGTAGAGCCTCGTTGCCTT 315299</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YNL327W YNL327W] | ||
+ | | 25775 | ||
+ | | 25775 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | A | ||
+ | |- | ||
+ | | || colspan="6" | Nucleotide change(s) in the coding region of EGT2/YNL327W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 577 is now Threonine rather than Alanine. | ||
+ | <pre>New 25741 CCAGTTTATCATCCGGCCCATTTGTTTCAAACACAACGGTTGCCTCTGGGTCTTATATTC 25800 | ||
+ | ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||
+ | Old 25740 CCAGTTTATCATCCGGCCCATTTGTTTCAAACACAGCGGTTGCCTCTGGGTCTTATATTC 25799</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YNL192W YNL192W] | ||
+ | | 278945 | ||
+ | | 278945 | ||
+ | | Substitution | ||
+ | | T | ||
+ | | G | ||
+ | |- | ||
+ | | || colspan="6" | Nucleotide change(s) in the coding region of CHS1/YNL192W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 815 is now Valine rather than Phenylalanine. | ||
+ | <pre>New 278939 TCCTAGTCTTTAGAATTCTCACTGTTTCTATTGCACTGGCATACCATTCAGCATTTAATG 278998 | ||
+ | ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||
+ | Old 278940 TCCTATTCTTTAGAATTCTCACTGTTTCTATTGCACTGGCATACCATTCAGCATTTAATG 278999</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YNL186W YNL186W] | ||
+ | | 290429 | ||
+ | | 290429 | ||
+ | | Substitution | ||
+ | | T | ||
+ | | G | ||
+ | |- | ||
+ | | || colspan="6" | Nucleotide change(s) in the coding region of UBP10/YNL186W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 310 is now Glutamic Acid rather than Aspartic Acid. | ||
+ | <pre>New 290398 GGAGAGGAGGAGGAAGAAGAGGAAGAAGAGCTGAAACATAAATCTAGGTCAATCACCCCT 290457 | ||
+ | ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | ||
+ | Old 290400 GGAGAGGAGGAGGAAGAAGAGGAAGAAGATCTGAAACATAAATCTAGGTCAATCACCCCT 290459</pre> | ||
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
Revision as of 12:58, 2 October 2019
This page lists all sequence and annotation changes that have been made to the Chromosome XIV systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome XIV has been updated 43 times, affecting 41 features.
- The annotation of Chromosome XIV has been updated 33 times, affecting 59 features.
- Current and past versions can be obtained from SGD's Download site.
Contents
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YNL008C | 618198 | 618198 | Deletion | G | |
A single C nucleotide was deleted within ORF YNL008C, altering its coding sequence. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 7 amino acids longer.
New 618178 AAAAGCTAAATACATCTC-TGTTATGGAGCAATTGCTTAACATGTTGCAATATATTTGTA 618236 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 618180 AAAAGCTAAATACATCTCGTGTTATGGAGCAATTGCTTAACATGTTGCAATATATTTGTA 618239 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL243W | 189081 | 189081 | Substitution | CG | GC |
Nucleotide change(s) in the coding region of SLA2/YNL243W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 344 is now Alanine rather than Arginine.
New 189059 ATCCCCACTGCCACTGGTGCAGCTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAG 189118 ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 189060 ATCCCCACTGCCACTGGTGCACGTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAG 189119 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL175C | 307728 | 307728 | Substitution | T | G |
Nucleotide change(s) in the coding region of NOP13/YNL175C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 296 is now Alanine rather than Glutamic Acid.
New 307678 ATTCGCAATGGCCTTCCGGCAATTTTTCTACAACTTTTATCCTTTAATGCATTAGTAGAT 307737 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 307680 ATTCGCAATGGCCTTCCGGCAATTTTTCTACAACTTTTATCCTTTAATTCATTAGTAGAT 307739 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL176C | 306231 | 306231 | Substitution | C | A |
Nucleotide change(s) in the coding region of YNL176C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 251 is now Phenylalanine rather than Cysteine.
New 306178 GAAAGCGATGAACTGTAAAACGATGTGGAAGTATTCCGACTGGAACTTGGGAATGTGGTA 306237 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Old 306180 GAAAGCGATGAACTGTAAAACGATGTGGAAGTATTCCGACTGGAACTTGGGCATGTGGTA 306239 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL271C | 132573 | 132573 | Substitution | T | C |
Nucleotide change(s) in the coding region of BNI1/YNL271C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 938 is now Alanine rather than Threonine.
New 132539 TGGAAATATCATTACTTTCCATTTGGATTTCAGCCAAAGCCCGCCTTAGGTCATTTAGTT 132598 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 132540 TGGAAATATCATTACTTTCCATTTGGATTTCAGTCAAAGCCCGCCTTAGGTCATTTAGTT 132599 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL177C | 304165 | 304165 | Substitution | G | T |
Nucleotide change(s) in the coding region of MRPL22/YNL177C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 151 is now Leucine rather than Phenylalanine.
New 304138 CTAGTACTTCAATTTCTCTTTTTGTTAACTTTAGCTTGTAACGTTCGCTAGAATTTGGTA 304197 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 304140 CTAGTACTTCAATTTCTCTTTTTGTGAACTTTAGCTTGTAACGTTCGCTAGAATTTGGTA 304199 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL193W | 274732 | 274732 | Substitution | G | C |
Nucleotide change(s) in the coding region of YNL193W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 122 is now Leucine rather than Valine.
New 274679 GCAATACGTGAAAATGGATGATATGCCTGATCTTTCCAATTTGGTGTTATCTCTGCCACA 274738 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Old 274680 GCAATACGTGAAAATGGATGATATGCCTGATCTTTCCAATTTGGTGTTATCTGTGCCACA 274739 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL172W | 315278 | 315278 | Substitution | T | G |
Nucleotide change(s) in the coding region of APC1/YNL172W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1547 is now Methionine rather than Isoleucine.
New 315238 CCACATCCCTTACAAGAATTGAAGCATTTCTGGAGCATGGCTGTAGAGCCTCGTTGCCTT 315297 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Old 315240 CCACATCCCTTACAAGAATTGAAGCATTTCTGGAGCATTGCTGTAGAGCCTCGTTGCCTT 315299 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL327W | 25775 | 25775 | Substitution | G | A |
Nucleotide change(s) in the coding region of EGT2/YNL327W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 577 is now Threonine rather than Alanine.
New 25741 CCAGTTTATCATCCGGCCCATTTGTTTCAAACACAACGGTTGCCTCTGGGTCTTATATTC 25800 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old 25740 CCAGTTTATCATCCGGCCCATTTGTTTCAAACACAGCGGTTGCCTCTGGGTCTTATATTC 25799 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL192W | 278945 | 278945 | Substitution | T | G |
Nucleotide change(s) in the coding region of CHS1/YNL192W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 815 is now Valine rather than Phenylalanine.
New 278939 TCCTAGTCTTTAGAATTCTCACTGTTTCTATTGCACTGGCATACCATTCAGCATTTAATG 278998 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 278940 TCCTATTCTTTAGAATTCTCACTGTTTCTATTGCACTGGCATACCATTCAGCATTTAATG 278999 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL186W | 290429 | 290429 | Substitution | T | G |
Nucleotide change(s) in the coding region of UBP10/YNL186W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 310 is now Glutamic Acid rather than Aspartic Acid.
New 290398 GGAGAGGAGGAGGAAGAAGAGGAAGAAGAGCTGAAACATAAATCTAGGTCAATCACCCCT 290457 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old 290400 GGAGAGGAGGAGGAAGAAGAGGAAGAAGATCTGAAACATAAATCTAGGTCAATCACCCCT 290459 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. |