Difference between revisions of "Chromosome V History"
(→Annotation Changes without sequence changes) |
|||
Line 317: | Line 317: | ||
| [https://www.yeastgenome.org/locus/YER109C YER109C] <br> | | [https://www.yeastgenome.org/locus/YER109C YER109C] <br> | ||
The feature_type annotation of FLO8/YER109C was changed from ORF to blocked_reading_frame (SO:0000718) as part of SGD's genome annotation revision R64.2. <br> <br> | The feature_type annotation of FLO8/YER109C was changed from ORF to blocked_reading_frame (SO:0000718) as part of SGD's genome annotation revision R64.2. <br> <br> | ||
+ | |- | ||
+ | | 2014-07-18 | ||
+ | | [https://www.yeastgenome.org/locus/YER038W-A YER038W-A] <br> | ||
+ | ORF YER038W-A was upgraded from 'Dubious' to 'Uncharacterized' on 2014-01-30 because its protein product was found in the mitochondria in both the Sickmann et al 2003 and Reinders et al 2006 studies. <br> <br> | ||
+ | '''Sickmann A, et al.''' (2003) The proteome of Saccharomyces cerevisiae mitochondria. Proc Natl Acad Sci U S A 100(23):13207-12. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000075100 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/14576278 PubMed] | [https://www.pnas.org/content/100/23/13207 Full-Text] | [https://www.pnas.org/content/suppl/2003/10/17/2135385100.DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=14576278&db=pmid YFGdb] <br> | ||
+ | '''Reinders J, et al.''' (2006) Toward the complete yeast mitochondrial proteome: multidimensional separation techniques for mitochondrial proteomics. J Proteome Res 5(7):1543-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000117178 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16823961 PubMed] | [https://pubs.acs.org/doi/abs/10.1021/pr050477f Full-Text] | [https://pubs.acs.org/doi/abs/10.1021/pr050477f Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=16823961&db=pmid YFGdb] <br> | ||
+ | |- | ||
+ | | 2007-07-09 | ||
+ | | [https://www.yeastgenome.org/locus/YEL003W YEL003W] <br> | ||
+ | The start of GIM4/YEL003W was moved 52 nt upstream, and an intron was added at relative coordinates 20-107, based on GenBank EF123144, Juneau et al. 2007, and Miura et al. 2006. According to Juneau et al. 2007, the intron is "inefficiently spliced" (splicing rate = 72%). ''The old coding coordinates were 148227..148598 (372 nt, 123 aa), and the new coding coordinates are 148175..148193,148282..148598 (1..19,108..424; 111 aa).''<br> <br> | ||
+ | '''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br> | ||
+ | '''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7. | ||
+ | <br> | ||
+ | |- | ||
+ | | 2007-04-04 | ||
+ | | [https://www.yeastgenome.org/locus/YER131W YER131W] <br> | ||
+ | RPS26B/YER131W mRNA contains an intron in the 5' untranslated region (UTR).<br> <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | '''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br> | ||
+ | '''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7. | ||
+ | <br> | ||
+ | |- | ||
+ | | 2007-04-04 | ||
+ | | [https://www.yeastgenome.org/locus/YER102W YER102W] <br> | ||
+ | RPS8B/YER102W mRNA contains an intron in the 5' untranslated region (UTR).<br> <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | '''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br> | ||
+ | '''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7. | ||
+ | <br> |
Revision as of 12:01, 4 October 2019
This page lists all sequence and annotation changes that have been made to the Chromosome V systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome V has been updated 20 times, affecting 19 features.
- The annotation of Chromosome V has been updated 41 times, affecting 92 features.
- Current and past versions can be obtained from SGD's Download site.
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YER075C | 308627 | 308627 | Substitution | C | G |
308984 | 308984 | Substitution | G | T | ||
309047 | 309047 | Substitution | G | C | ||
Nucleotide substitutions within the coding region of PTP3/YER075C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 717 is now Alanine rather than Proline, and residue 738 is now Lysine rather than Q, and residue 857 is now Glutamine rather than Glutamic Acid.
New 308581 GTCATAAATGAAAATAAATTGATTAATGTTCTGGACCATGGATATTCGTTGCTTTCTAAA 308640 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Old 308577 GTCATAAATGAAAATAAATTGATTAATGTTCTGGACCATGGATATTCGTTCCTTTCTAAA 308636 New 308941 TAACAATTCATAAGGTTTCTCTTGATCATGATATGTTAGCAGAATTTTTCTTATGAGAAT 309000 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 308937 TAACAATTCATAAGGTTTCTCTTGATCATGATATGTTAGCAGAATTTGTCTTATGAGAAT 308996 New 309001 TGCGTCATCATCATCATCATCATCATCATCACAAGCAGCAGCAGTAACAGCAATATTACT 309060 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Old 308997 TGCGTCATCATCATCATCATCATCATCATCACAAGCAGCAGCAGTAACAGGAATATTACT 309056 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YER162C | 502222 | 502222 | Substitution | T | A |
A single nucleotide substitution within the coding region of RAD4/YER162C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 223 is now Valine rather than Glutamic Acid.
New 502201 CTTTCCAGGTTCTCATATAAAGTCCCACATTATCATATTTTTTAGTGATCTTCCAGTGTT 502260 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 502196 CTTTCCAGGTTCTCATATAAAGTCCCTCATTATCATATTTTTTAGTGATCTTCCAGTGTT 502255 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YER041W | 232634 | 232634 | Substitution | C | G |
A single nucleotide substitution within the coding region of YEN1/YER041W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 59 is now Alanine rather than Proline.
New 232621 ATATAGATATAAGCGCCAGATCTAGATCAAGATCAAGGAGTCCTACCCGTTCTCCGCGTG 232680 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 232620 ATATAGATATAAGCCCCAGATCTAGATCAAGATCAAGGAGTCCTACCCGTTCTCCGCGTG 232679 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YER061C | 278525 | 278526 | Substitution | CG | GC |
Nucleotide changes within the coding region of CEM1/YER061C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 367 is now Alanine rather than Arginine.
New 278521 GCGCCAGCTGCACCTAAAAGATGGCCAATTGCACCTTTGTTACTGGATATGTACAGTGGC 278580 |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Old 278519 GCGCCACGTGCACCTAAAAGATGGCCAATTGCACCTTTGTTACTGGATATGTACAGTGGC 278578 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YER073W | 305258 | 305258 | Substitution | G | A |
A single nucleotide substitution within the coding region of ALD5/YER073W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 411 is now Glutamic Acid rather than Glycine.
New 305221 GGTTATTTTGTCAAGCCAACAGTGTTTGCTGATGTCAAAGAAGATATGAGAATTGTTAAG 305280 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old 305218 GGTTATTTTGTCAAGCCAACAGTGTTTGCTGATGTCAAAGGAGATATGAGAATTGTTAAG 305277 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YEL007W, YEL008W | 141112 | 141112 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs YEL008W and YEL007W.
New 141061 GCAATGATCTGTCCAACTCACCGAAACAAGAAAAAATTTTGCGTTTTTTTTTTCCTACAAATCCCCCATT 141130 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 141061 GCAATGATCTGTCCAACTCACCGAAACAAGAAAAAATTTTGCGTTTTTTTTT-CCTACAAATCCCCCATT 141129 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YEL070W, YEL071W | 18079 | 18079 | Substitution | A | T |
A single nucleotide substitution was made in the intergenic region between ORFs DLD3/YEL071W and DSF1/YEL070W.
New 18061 ATCTCCTGATTGCGTACTTCAAAAAGTGTTCGTCCATTTTTTCTTTACTACATTAGATAA 18120 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 18061 ATCTCCTGATTGCGTACTACAAAAAGTGTTCGTCCATTTTTTCTTTACTACATTAGATAA 18120 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YER056C, YER056C-A | 268857 | 268857 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs FCY2/YER056C and RPL34A/YER056C-A.
New 268801 AACTTGGTTGAAAGTGGCTGAATTTACGACGTAATCTGTCTTGACATCTTTTTTTTTTTCAGCGAGCATT 268870 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 268800 AACTTGGTTGAAAGTGGCTGAATTTACGACGTAATCTGTCTTGACATCTTTTTTTTTT-CAGCGAGCATT 268868 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YER072W, YER073W | 303532 | 303532 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs VTC1/YER072W and ALD5/YER073W.
New 303481 CCGTTTACACATCAATGATAAATAAGTATACAAAAAGGGTTCCATTTTTTTTTTTGGCCGCTACCGGACT 303550 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 303479 CCGTTTACACATCAATGATAAATAAGTATACAAAAAGGGTTCCATTTTTTTTTT-GGCCGCTACCGGACT 303547 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YER133W, tH(GUG)E2 | 434284 | 434284 | Substitution | C | T |
A single nucleotide substitution was made in the intergenic region between GLC7/YER133W and tH(GUG)E2.
New 434281 CAATTTTTCTTTATTTTCTTTTATTACTATTATCATTACTATTATTATTAGTATTATTAT 434340 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Old 434277 CAATTTTCCTTTATTTTCTTTTATTACTATTATCATTACTATTATTATTAGTATTATTAT 434336 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YER138W-A, YER139C | 449959 | 449959 | Insertion | A | |
A single nucleotide insertion was made in the intergenic region between ORFs YER138W-A and RTR1/YER139C.
New 449941 GTGGGTTTCCTATGTTCTCGAAGAGAGCTTCAAGTGTATTCTATAAACTAAGAATATTAG 450000 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old 449937 GTGGGTTTCCTATGTTCTCGAAG-GAGCTTCAAGTGTATTCTATAAACTAAGAATATTAG 449995 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YER073W, ER074W | 305968 | 305968 | Substitution | T | A |
305885 | 305886 | Substitution | CA | TC | ||
305880 | 305880 | Substitution | T | G | ||
305828 | 305828 | Substitution | A | G | ||
305710 | 305710 | Insertion | A | |||
A single nucleotide insertion and several different substitutions were made in the intergenic region between ORFs ALD5/YER073W and RPS24A/YER074W.
New 305701 CAAAAAAAAAAAAACAAAACAAAAAAATAATAACGTGATAAACATTAATGAACAATGTAT 305760 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 305698 CAAAAAAAAAAAA-CAAAACAAAAAAATAATAACGTGATAAACATTAATGAACAATGTAT 305756 New 305821 TATTGTATATTGAAATATATAGTAATCAAATTCGTTTCATTGATCAAATTGCTCACTAGT 305880 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 305817 TATTGTATATTAAAATATATAGTAATCAAATTCGTTTCATTGATCAAATTGCTCACTAGT 305876 New 305881 TCTGTTTTTCAAAATTTCATCTTTATAGGTAGATACAAGTGCCAGAGAGATATATAAACA 305940 ||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| Old 305877 TCTTTTTTCAAAAATTTCATCTTTATAGGTAGATACAAGTGCCAGAGAGATATATAAACA 305936 New 305941 GAAAACTCTATCGATGTGATAATGTATGCCAATATCGGGACTGTACACCCACACATTTAC 306000 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old 305937 GAAAACTCTATCGATGTGATAATGTATGCCATTATCGGGACTGTACACCCACACATTTAC 305996 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | ARS504 | 9168 | 9168 | Substitution | G | T |
A single nucleotide substitution was made within ARS504.
New 9121 GTTGGCCTGCCATACTTTAATTGAATAAAAGCTCCGTATATGCTTCTTAAAAATAAGCAA 9180 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 9121 GTTGGCCTGCCATACTTTAATTGAATAAAAGCTCCGTATATGCTTCTGAAAAATAAGCAA 9180 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2000-03-16 | YER123W | 406383 | 406383 | Deletion | G | |
A single G nucleotide was deleted within ORF YER123W at chromosomal coordinate 406383, creating a new stop codon; this ORF is shortened, but a prenylation site is created.
Old: 406381 TGGATAAAGCGATTTTTATACTTTTCTCTTTTTCCTTTTTTTTTTTGATTGGCTGTTTCC 406440 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| New: 406381 TG-ATAAAGCGATTTTTATACTTTTCTCTTTTTCCTTTTTTTTTTTGATTGGCTGTTTCC 406439 Wang X, et al. (1996) Prenylated isoforms of yeast casein kinase I, including the novel Yck3p, suppress the gcs1 blockage of cell proliferation from stationary phase. Mol Cell Biol 16(10):5375-85. |
Annotation Changes without sequence changes
Date | Affected Features |
---|---|
2014-11-19 | ARS507, ARS508, ARS511, ARS512, ARS513.7, ARS514, ARS516, ARS518, ARS520, ARS523 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome V based on Liachko et al. 2013: ARS507, ARS508, ARS511, ARS512, ARS513.7, ARS514, ARS516, ARS518, ARS520, ARS523. |
2014-11-19 | ARS503, ARS507, ARS510, ARS511, ARS514, ARS516, ARS520, ARS523 The chromosomal coordinates of the following ARS elements on Chromosome V were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS503, ARS507, ARS510, ARS511, ARS514, ARS516, ARS520, ARS523. |
2014-11-19 | ARS513.5, ARS513.7 The following new ARS elements on Chromosome V were added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS513.5, ARS513.7. |
2014-11-18 | YER109C The feature_type annotation of FLO8/YER109C was changed from ORF to blocked_reading_frame (SO:0000718) as part of SGD's genome annotation revision R64.2. |
2014-07-18 | YER038W-A ORF YER038W-A was upgraded from 'Dubious' to 'Uncharacterized' on 2014-01-30 because its protein product was found in the mitochondria in both the Sickmann et al 2003 and Reinders et al 2006 studies. |
2007-07-09 | YEL003W The start of GIM4/YEL003W was moved 52 nt upstream, and an intron was added at relative coordinates 20-107, based on GenBank EF123144, Juneau et al. 2007, and Miura et al. 2006. According to Juneau et al. 2007, the intron is "inefficiently spliced" (splicing rate = 72%). The old coding coordinates were 148227..148598 (372 nt, 123 aa), and the new coding coordinates are 148175..148193,148282..148598 (1..19,108..424; 111 aa). |
2007-04-04 | YER131W RPS26B/YER131W mRNA contains an intron in the 5' untranslated region (UTR). |
2007-04-04 | YER102W RPS8B/YER102W mRNA contains an intron in the 5' untranslated region (UTR). |