https://wiki.yeastgenome.org/index.php?title=Chromosome_III_History&feed=atom&action=history
Chromosome III History - Revision history
2024-03-28T08:56:38Z
Revision history for this page on the wiki
MediaWiki 1.31.14
https://wiki.yeastgenome.org/index.php?title=Chromosome_III_History&diff=404189&oldid=prev
Stacia at 22:06, 21 April 2022
2022-04-21T22:06:44Z
<p></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr class="diff-title" lang="en">
<td colspan="2" style="background-color: #fff; color: #222; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: #fff; color: #222; text-align: center;">Revision as of 22:06, 21 April 2022</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l1" >Line 1:</td>
<td colspan="2" class="diff-lineno">Line 1:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>This page lists all sequence and annotation changes that have been made to the Chromosome III systematic reference sequence since its intial release on 1996-07-31. <br></div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>This page lists all sequence and annotation changes that have been made to the Chromosome III systematic reference sequence since its intial release on 1996-07-31. <br></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>*The sequence of Chromosome III has been updated '''705''' times, affecting '''132''' features. <br></div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>*The sequence of Chromosome III has been updated '''705''' times, affecting '''132''' features. <br></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>*The annotation of Chromosome III has been updated '''<del class="diffchange diffchange-inline">53</del>''' times, affecting '''<del class="diffchange diffchange-inline">108</del>''' features. <br></div></td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>*The annotation of Chromosome III has been updated '''<ins class="diffchange diffchange-inline">54</ins>''' times, affecting '''<ins class="diffchange diffchange-inline">109</ins>''' features. <br></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site].</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site].</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr>
</table>
Stacia
https://wiki.yeastgenome.org/index.php?title=Chromosome_III_History&diff=404178&oldid=prev
Stacia: /* Annotation Changes without sequence changes */
2022-04-21T20:58:20Z
<p><span dir="auto"><span class="autocomment">Annotation Changes without sequence changes</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr class="diff-title" lang="en">
<td colspan="2" style="background-color: #fff; color: #222; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: #fff; color: #222; text-align: center;">Revision as of 20:58, 21 April 2022</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l6919" >Line 6,919:</td>
<td colspan="2" class="diff-lineno">Line 6,919:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>! Date  !! Affected Features  </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>! Date  !! Affected Features  </div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">|-</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">|2021-04-21</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">|[https://www.yeastgenome.org/locus/S000303804 RE/RE301]<br></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">New recombination enhancer</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">*coordinates 29108..29809</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">:[https://www.yeastgenome.org/reference/S000045456 Wu and Haber 1996] PMID:8861911</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>|-</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>|-</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>| 2014-11-18</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>| 2014-11-18</div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l6926" >Line 6,926:</td>
<td colspan="2" class="diff-lineno">Line 6,931:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br></div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>[https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text]</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>[https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text]</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;"></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>|-</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>|-</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>| 2014-11-18</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>| 2014-11-18</div></td></tr>
</table>
Stacia
https://wiki.yeastgenome.org/index.php?title=Chromosome_III_History&diff=401352&oldid=prev
Pcng: Undo revision 401351 by Pcng (talk)
2019-10-02T20:45:23Z
<p>Undo revision 401351 by <a href="/index.php/Special:Contributions/Pcng" title="Special:Contributions/Pcng">Pcng</a> (<a href="/index.php?title=User_talk:Pcng&action=edit&redlink=1" class="new" title="User talk:Pcng (page does not exist)">talk</a>)</p>
<a href="https://wiki.yeastgenome.org/index.php?title=Chromosome_III_History&diff=401352&oldid=401351">Show changes</a>
Pcng
https://wiki.yeastgenome.org/index.php?title=Chromosome_III_History&diff=401351&oldid=prev
Pcng at 20:44, 2 October 2019
2019-10-02T20:44:28Z
<p></p>
<a href="https://wiki.yeastgenome.org/index.php?title=Chromosome_III_History&diff=401351&oldid=401345">Show changes</a>
Pcng
https://wiki.yeastgenome.org/index.php?title=Chromosome_III_History&diff=401345&oldid=prev
Pcng at 19:47, 2 October 2019
2019-10-02T19:47:01Z
<p></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr class="diff-title" lang="en">
<td colspan="2" style="background-color: #fff; color: #222; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: #fff; color: #222; text-align: center;">Revision as of 19:47, 2 October 2019</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l2586" >Line 2,586:</td>
<td colspan="2" class="diff-lineno">Line 2,586:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>| || colspan="6" | A single nucleotide substitution was made in the systematic sequence within the ORF YCL017C. Several sequence changes were also made in the region upstream of YCL017C. Note that coordinates listed are chromosomal coordinates.</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>| || colspan="6" | A single nucleotide substitution was made in the systematic sequence within the ORF YCL017C. Several sequence changes were also made in the region upstream of YCL017C. Note that coordinates listed are chromosomal coordinates.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>Within YCL017C</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>Within YCL017C</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>Old:  93432 CTACGTAAGCTCTAGCATTTTCCACAGCAGTATTTGTTTCCCAACCGTAAGAGTGAGTGT 93491</div></td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"><pre></ins>Old:  93432 CTACGTAAGCTCTAGCATTTTCCACAGCAGTATTTGTTTCCCAACCGTAAGAGTGAGTGT 93491</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>New:  93816 CTACGTGAGCTCTAGCATTTTCCACAGCAGTATTTGTTTCCCAACCGTAAGAGTGAGTGT 93875</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>New:  93816 CTACGTGAGCTCTAGCATTTTCCACAGCAGTATTTGTTTCCCAACCGTAAGAGTGAGTGT 93875</div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l7035" >Line 7,035:</td>
<td colspan="2" class="diff-lineno">Line 7,035:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>| 2004-08-27</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>| 2004-08-27</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>| [https://www.yeastgenome.org/locus/YCR095W-A YCR095W-A]<br></div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>| [https://www.yeastgenome.org/locus/YCR095W-A YCR095W-A]<br></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>The ORF YCR095W-A was added per Oshiro et al. 2002.</div></td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>The ORF YCR095W-A was added per Oshiro et al. 2002.<ins class="diffchange diffchange-inline"><br> <br></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>'''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br></div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>'''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>[https://www.yeastgenome.org/reference/S000073672 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] | [https://genome.cshlp.org/content/12/8/1210.long Full-Text] | [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br></div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>[https://www.yeastgenome.org/reference/S000073672 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] | [https://genome.cshlp.org/content/12/8/1210.long Full-Text] | [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br></div></td></tr>
</table>
Pcng
https://wiki.yeastgenome.org/index.php?title=Chromosome_III_History&diff=401325&oldid=prev
Pcng: Created page with "This page lists all sequence and annotation changes that have been made to the Chromosome III systematic reference sequence since its intial release on 1996-07-31. <br> *The s..."
2019-10-02T11:37:47Z
<p>Created page with "This page lists all sequence and annotation changes that have been made to the Chromosome III systematic reference sequence since its intial release on 1996-07-31. <br> *The s..."</p>
<a href="https://wiki.yeastgenome.org/index.php?title=Chromosome_III_History&diff=401325">Show changes</a>
Pcng