Difference between revisions of "Chromosome III History"

From SGD-Wiki
Jump to: navigation, search
(Undo revision 401351 by Pcng (talk))
 
(One intermediate revision by the same user not shown)
(No difference)

Latest revision as of 13:45, 2 October 2019

This page lists all sequence and annotation changes that have been made to the Chromosome III systematic reference sequence since its intial release on 1996-07-31.

  • The sequence of Chromosome III has been updated 705 times, affecting 132 features.
  • The annotation of Chromosome III has been updated 53 times, affecting 108 features.

Current and past versions can be obtained from SGD's Download site.


Sequence Changes

Date Affected Features Start Coordinate of Change End Coordinate of Change Type of Change Old Sequence New Sequence
2011-02-03 YCL002C 110880 110880 Insertion A
A single nucleotide was inserted within ORF YCL002C, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 12 amino acids longer.
New 110871  TATGACCAATAAGGTGACAAATTGTATCAATTTTACCCAAAAGGGCGTTGAATTAAATGGTATCTCGTAA 110940
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old 110871  TATGACCAAT-AGGTGACAAATTGTATCAATTTTACCCAAAAGGGCGTTGAATTAAATGGTATCTCGTAA 110939

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD paper | PubMed | Full-Text

2011-02-03 YCR091W 275421 275421 Substitution A G
A single nucleotide substitution in the coding region of KIN82/YCR091W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 341 is now Valine rather than Methionine.
New    275400  GGTGACGTAGGTAAAGTGTATTTAGTGAGGGAACGCGATACCAACCAGATATTCGCCCTG  275459
               |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old    275397  GGTGACGTAGGTAAAGTGTATTTAATGAGGGAACGCGATACCAACCAGATATTCGCCCTG  275456

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD paper | PubMed | Full-Text

2011-02-03 YCR077C 250563 250563 Substitution A T
A single nucleotide substitution in the coding region of PAT1/YCR077C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 688 is now Aspartic Acid rather than Valine.
New    250560  ATGTGGTCGTTATATTCCCTTGGAGGGAAAATCAGCTGAATCTTACTTTCCAATGAAGTG  250619
               |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    250557  ATGTGGACGTTATATTCCCTTGGAGGGAAAATCAGCTGAATCTTACTTTCCAATGAAGTG  250616

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD paper | PubMed | Full-Text

2011-02-03 YCR020W-B, YCR021C 155961 155961 Insertion TG
A dinucleotide insertion was made in the intergenic region between ORFs YCR020W-B and YCR021C.
New  155941  ATTAGATTATTAATTATTGTGTTTGTGTATATAATTTATTTTGCATATTTCATAAAGAAA  156000
             |||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||
Old  155939  ATTAGATTATTAATTATTGTGTT--TGTATATAATTTATTTTGCATATTTCATAAAGAAA  155996

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD paper | PubMed | Full-Text

2011-02-03 YCR019W 152641 152641 Substitution G A
A single nucleotide substitution was made in the intergenic region upstream of ORF YCR019W/MAK32.
New  152641  AAATTTCCGAGATCCTCAGCTGACAAATAAATGTCATATCAAGACAATAAACGGTAGTGC  152700
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old  152639  AAGTTTCCGAGATCCTCAGCTGACAAATAAATGTCATATCAAGACAATAAACGGTAGTGC  152698

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD paper | PubMed | Full-Text

2011-02-03 YCR024C, YCR024C-B 162275 162275 Substitution A G
162392 162392 Substitution C G
Two single nucleotide substitutions were made in the intergenic region between ORFs YCR024C and YCR024C-B.
New  162241  TGTTCTCTTTCTTTCTCTCTTAGTAAGCGATAAGTCGAGCTCTACTTAAATTGTGGTACG  162300
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Old  162237  TGTTCTCTTTCTTTCTCTCTTAGTAAGCGATAAGTCGAACTCTACTTAAATTGTGGTACG  162296

New  162361  TAACTATAAGTTGTGCATACTCATACTCCACACTCGACGGCCTAATCTCTGTAAGGATTG  162420
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Old  162357  TAACTATAAGTTGTGCATACTCATACTCCACACTCCACGGCCTAATCTCTGTAAGGATTG  162416

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD paper | PubMed | Full-Text

2011-02-03 YCL012C 101655 101655 Substitution T A
101652 101652 Substitution A T
Two single nucleotide substitutions were made within the intron of YCL012C.
New  101641  AGCTGTTAGTATTTAGATACGGTTTGCACTTTGCATTTTCAAATGCTTAAATATACATAC  101700
             ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Old  101641  AGCTGTTAGTAATTTGATACGGTTTGCACTTTGCATTTTCAAATGCTTAAATATACATAC  101700

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD paper | PubMed | Full-Text

2011-02-03 YCL001W, YCL002C 111718 111718 Insertion C
A single nucleotide insertion was made in the intergenic region between ORFs YCL002C and YCL001W.
New  111661  AACAATAACAAGCATGTGAATGATTCAATATAATTGCTTCGCAGGGCTCCTCAACCTCTCCTCTGGAAAA  111730
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old  111660  AACAATAACAAGCATGTGAATGATTCAATATAATTGCTTCGCAGGGCTCCTCAACCTCT-CTCTGGAAAA  111728

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD paper | PubMed | Full-Text

2011-02-03 YCR072C, YCR073C 242444 242444 Deletion T
A single nucleotide deletion was made in the intergenic region between ORFs YCR072C and YCR073C.
New  242401  CTTGTGATATATGTCTTTTAAAGATACTCTTTTTGAAGCTCATCGCA-TTTTTTTTTTTT  242459
             ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old  242397  CTTGTGATATATGTCTTTTAAAGATACTCTTTTTGAAGCTCATCGCATTTTTTTTTTTTT  242456

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD paper | PubMed | Full-Text

2006-01-12 YCL025C 76147 76147 Insertion G
SGD confirmed the sequence error predicted by the work of Brachat et al and Schreve et al., and has updated the systematic sequence accordingly. As a consequence of this sequence change, AGP1/YCL025C was extended on the 3' end, altering the C-terminus and increasing the size of the predicted protein from 595 to 633 amino acids
New: 76137 CGATCTTGTCTGCCCTGATGAACAGTTTCCAATCCTTGTGCCAG 76180
           ||||||||||| ||||||||||||||||||||||||||||||||
Old: 76137 CGATCTTGTCT-CCCTGATGAACAGTTTCCAATCCTTGTGCCAG 76179

Schreve JL, et al. (1998) The Saccharomyces cerevisiae YCC5 (YCL025c) gene encodes an amino acid permease, Agp1, which transports asparagine and glutamine. J Bacteriol 180(9):2556-9
SGD paper | PubMed | Full-Text
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text

2004-02-20 YCL012C 101615 101615 Insertion G
101461 101461 Insertion T
101692 101692 Insertion A
101648 101648 Insertion A
Four single nucleotide insertions were made in the region now spanning new feature YCL012C. This feature was independently predicted by Cliften et al. 2003 and Zhang & Dietrich 2003. The sequence changes were confirmed by Zhang and Dietrich (GenBank AY178910).
New:    352 GTTTTCCATAATTTGTTTAATCTCATTCTTGGAGACATCATCCAAACCACCTCTTACGTC 293 
            |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| 
Old: 101436 GTTTTCCATAATTTGTTTAATCTCAT-CTTGGAGACATCATCCAAACCACCTCTTACGTC 101494

New:    172 TGCACGAAATTTGTCGGCTATTACAGCTGTTAGTAATTTGATACGGTTTGCACTTTGCAT 113 
            | ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| 
Old: 101615 T-CACGAAATTTGTCGGCTATTACAGCTGTTAGTA-TTTGATACGGTTTGCACTTTGCAT 101672 

New:    112 TTTCAAATGCTTAAATATACATACCAACTTTGGTTTTCCGGTGTGCCATAAGAAGGCATA 53 
            |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| 
Old: 101673 TTTCAAATGCTTAAATATAC-TACCAACTTTGGTTTTCCGGTGTGCCATAAGAAGGCATA 101731

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement
Zhang Z and Dietrich FS (2003) Verification of a new gene on Saccharomyces cerevisiae chromosome III. Yeast 20(8):731-8
SGD paper | PubMed | Full-text

2004-02-19 YCL008C 105970 105970 Deletion T
Based on Brachat et al. 2003 and GenBank AY260880, the T at 105970 was deleted. This change resulted in a frameshift, moving the stop 267 bp downstream, and extending the protein from 296 aa to 385 aa.
Query:    918 AGTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGT-CAGGACGTCTATCTGTGCGT 860 
              ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| 
Sbjct: 105931 AGTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGTTCAGGACGTCTATCTGTGCGT 105990

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text

2000-09-13 YCR031C, snR189 177189 177190 Deletion AA
177166 177166 Substitution T G
177093 177093 Substitution A G
177003 177004 Deletion AA
The systematic sequence was updated in the region between features RPS14A/YCR031C and snR189. Note that coordinates listed are chromosomal coordinates.
Old:   176967 CTCTCCTTGGGTTTAAAATAGAATCTTCATTAAAAAAAGTGCTTTCTGTAATATATAGTG 177026
              ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||
New:   178235 CTCTCCTTGGGTTTAAAATAGAATCTTCATTAAAAA--GTGCTTTCTGTAATATATAGTG 178292

Old:   177087 CCAGGAAGCGGGATGGTCTGCCGCAAGCAGACAAATTTGCCAAAATGCAGTAGAGAATGG 177146
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   178353 CCAGGAGGCGGGATGGTCTGCCGCAAGCAGACAAATTTGCCAAAATGCAGTAGAGAATGG 178412

Old:   177147 CAATGCTCGTGCTGAAGGTTAAAAAAAGAACGCAAAAAAAAAAAGAGTAGTAAAATGTAC 177206
              ||||||||||||||||||| ||||||||||||||||||||||  ||||||||||||||||
New:   178413 CAATGCTCGTGCTGAAGGTGAAAAAAAGAACGCAAAAAAAAA--GAGTAGTAAAATGTAC 178470
2000-09-13 snR189 177328 177328 Substitution T G
The systematic sequence was updated within feature snR189. Note that coordinates listed are chromosomal coordinates.
Old:   177327 ATGAATAGAGATGTCAGGCCCGTGTGAAGTACTTGAAAGTAATAAGTGAGTATATAGAAT 177386
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   178591 AAGAATAGAGATGTCAGGCCCGTGTGAAGTACTTGAAAGTAATAAGTGAGTATATAGAAT 178650
2000-09-13 YCR032W, snR189 178236 178236 Deletion A
177800 177801 Substitution CA AC
The systematic sequence was updated in the region between features snR189 and BPH1/YCR032W. Note that coordinates listed are chromosomal coordinates.
Old:   177747 CGTTGCAAAGCTTTGTTTGCGGTATGTTAATAAAGTTACCATGAAGCTTTTTTCATGCTC 177806
              |||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||
New:   179011 CGTTGCAAAGCTTTGTTTGCGGTATGTTAATAAAGTTACCATGAAGCTTTTTTACTGCTC 179070

Old:   178227 AAAAAAAAAACACAATACGGATATGAATTCAATTATTAATGCTGCTTCGAAAGTCTTAAG 178286
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
New:   179491 AAAAAAAAA-CACAATACGGATATGAATTCAATTATTAATGCTGCTTCGAAAGTCTTAAG 179549
2000-09-13 snR33 142098 142098 Substitution C G
The systematic sequence was updated within feature snR33. Note that coordinates listed are chromosomal coordinates.
Old:   142091 AAATTACCTAAATAATTTTAGAGTGACACCATCGTACAAAGAGGGCATTAAGCTTATTTT 142150
              ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   142486 AAATTACGTAAATAATTTTAGAGTGACACCATCGTACAAAGAGGGCATTAAGCTTATTTT 142545
2000-09-13 snR33 142397 142498 Deletion AAGAAAAGCAAAAAACATATTAGCC GATAATTTCTATTTTATAAGTAAAA ACATTGGTGAGATAGTGGTAAAGAG TTAGATAATTATTGGGATTCCATTG TT
142388 142388 Substitution G A
142382 142382 Substitution A C
142301 142301 Deletion A
142279 142281 Deletion AAC
142202 142202 Substitution T C
142186 142186 Substitution C T
142178 142178 Substitution G A
142173 142173 Insertion A
142154 142154 Deletion T
The systematic sequence was updated in the region upstream of feature snR33. Note that coordinates listed are chromosomal coordinates.
Old:   142151 TTTTAATTCTTATGAAAAAAAAA-TGTGGAAGAGAGCAGAAAATTTTCATAATGAATCTC 142209
              ||| ||||||||||||||||||| |||| ||||||| ||||||||||||||| |||||||
New:   142546 TTT-AATTCTTATGAAAAAAAAAATGTGAAAGAGAGTAGAAAATTTTCATAACGAATCTC 142604
Old:   142270 AAAAAAAAAAACTAGTATATAAAGTAAAAAAAGATGCGCAAGCCCGGAATCGAACCGGGG 142329
              |||||||||   ||||||||||||||||||| ||||||||||||||||||||||||||||
New:   142665 AAAAAAAAA---TAGTATATAAAGTAAAAAA-GATGCGCAAGCCCGGAATCGAACCGGGG 142720
Old:   142330 GCCCAACGATGGCAACGTTGGATTTTACCACTAAACCACTTGCGCTAGTAATATTGATGC 142389
              |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
New:   142721 GCCCAACGATGGCAACGTTGGATTTTACCACTAAACCACTTGCGCTAGTAATCTTGATAC 142780
Old:   142390 ATTATTCAAGAAAAGCAAAAAACATATTAGCCGATAATTTCTATTTTATAAGTAAAAA 142447
              |||||||
New:   142781 ATGATTC--------------------------------------------------- 142787
Old:   142448 CATTGGTGAGATAGTGGTAAAGAGTTAGATAATTATTGGGATTCCATTGTTGAGAAAAGCAATAATATTATGTA 142521
                                                                 |||||||||||||||||||||||
New:   142787 ---------------------------------------------------GAGAAAAGCAACAATATTATGTA 142810
2000-09-13 YCL023C, YCL025C 78402 78402 Insertion CC
78400 78400 Substitution C G
78035 78035 Insertion A
78027 78027 Insertion A
Several sequence changes were made in the systematic sequence in the intergenic region between features YCL025C and YCL023C. Note that coordinates listed are chromosomal coordinates.
Old:   78005 AACAAATGAGTATTACGAGGAAA-TAACAAAA-GAAACTAATCACGAAGGATATGAGTCT 78062
             ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||
New:   78037 AACAAATGAGTATTACGAGGAAAATAACAAAAAGAAACTAATCACGAAGGATATGAGTCT 78096
Old:   78363 CATCAACGGCAAAGTTGCAGCTTTTTGCAGCAGATCACTG--GCTTAGACGGCACCCTCA 78420
             ||||||||||||||||||||||||||||||||||||| ||  ||||||||||||||||||
New:   78397 CATCAACGGCAAAGTTGCAGCTTTTTGCAGCAGATCAGTGCCGCTTAGACGGCACCCTCA 78456
2000-09-13 YCR048W, YCR051W 212559 212559 Insertion C
The systematic sequence was updated in the intergenic region between ORFs YCR048W and YCR051W. Note that coordinates listed below are chromosomal coordinates.
Old:   212547 GAATGGGCGTCCG-TCCACCGTGGTCAAAGACAGGGGCAAAGAGCTCCTAGGTCTATATA 212605
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
New:   213808 GAATGGGCGTCCGCTCCACCGTGGTCAAAGACAGGGGCAAAGAGCTCCTAGGTCTATATA 213867
2000-09-13 YCR042C, YCR043C 204348 204348 Deletion T
The systematic sequence was updated in the region between ORFs YCR042C and YCR043C. Note that coordinates listed below are chromosomal coordinates.
Old:   204327 TTTATTGAATTAAATAAGACTTGATTTTGTAGCACGATATCCGCAAGAATGATTCACAAC 204386
              ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
New:   205589 TTTATTGAATTAAATAAGACT-GATTTTGTAGCACGATATCCGCAAGAATGATTCACAAC 205647
2000-09-13 YCR023C, YCR024C 160291 160291 Substitution A G
160135 160135 Substitution T C
160129 160129 Substitution G T
The systematic sequence was updated in the intergenic region between ORFs YCR023C and YCR024C. Note that coordinates listed are chromosomal coordinates.
Old:   160101 TCATATGCTTACCACTTCCTAGTTCCTTGGCTAGTATTCCTTTAGGTGATCTAAATTCAA 160160
              |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||
New:   160385 TCATATGCTTACCACTTCCTAGTTCCTTTGCTAGCATTCCTTTAGGTGATCTAAATTCAA 160444
Old:   160281 ATTAACATAGATCAGGCCGAATGCCAAATGGAGTTTAGTACCTTCATATTGAAGAAAAAT 160340
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
New:   160565 ATTAACATAGGTCAGGCCGAATGCCAAATGGAGTTTAGTACCTTCATATTGAAGAAAAAT 160624
2000-09-13 YCR023C 159827 159827 Substitution T C
159753 159753 Substitution T C
159397 159397 Substitution T C
159255 159255 Substitution T A
The systematic sequence was updated within ORF YCR023C. Note that coordinates listed are chromosomal coordinates.
Old:   159201 TTGGTAGTATTCACTAGGGGACTATTTTCATCCTCTTCACTATCTTGTCCTCGATTGCTG 159260
              |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
New:   159485 TTGGTAGTATTCACTAGGGGACTATTTTCATCCTCTTCACTATCTTGTCCTCGAATGCTG 159544
Old:   159381 CCGTAATCTCTTCTATTTTTAAAAGCAGGATGTGTTTCTTCCAAAAACAATGTTGCATTA 159440
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
New:   159665 CCGTAATCTCTTCTATCTTTAAAAGCAGGATGTGTTTCTTCCAAAAACAATGTTGCATTA 159724
Old:   159741 TGATAGAAATTGTGTGAAAATCCCAGTATTAACAATGATACAGATGTTCCTATAAGCCCG 159800
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
New:   160025 TGATAGAAATTGCGTGAAAATCCCAGTATTAACAATGATACAGATGTTCCTATAAGCCCG 160084
Old:   159801 CAAGTCAATGTTATTTTTCTGCCATGTTTTTCAGAGAATCTACCCCAGTGGTACGCAGAT 159860
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New:   160085 CAAGTCAATGTTATTTTTCTGCCATGCTTTTCAGAGAATCTACCCCAGTGGTACGCAGAT 160144
2000-09-13 YCL065W 13811 13811 Substitution C G
A single nucleotide substitution was made in the systematic sequence in the region encompassing ORF YCL065W. The C at 13811 was changed to G. This is coding nucleotide 72 (codon 24, TGC to TGG) resulting in one amino acid substitution in the predicted protein sequence (Cys to Trp). Note that coordinates listed below are chromosomal coordinates.
Old:   13798 GAGTGTGGTCGTGCCGGAGGTTGTTTATCTTTCGAGTACTGAATGTTGTCAGTATAGCTA 13857
             ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
New:   13809 GAGTGTGGTCGTGGCGGAGGTTGTTTATCTTTCGAGTACTGAATGTTGTCAGTATAGCTA 13868
2000-09-13 YCR107W 312725 312725 Substitution T A
The systematic sequence was updated within ORF YCR107W. Note that coordinates listed below are chromosomal coordinates.
Old:   312721 GAGCTCGTTCGGATTTTCTCAAATCAATGAACAAGAATCGAGCTTTTGAATTGCTTGATA 312780
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   313995 GAGCACGTTCGGATTTTCTCAAATCAATGAACAAGAATCGAGCTTTTGAATTGCTTGATA 314054
2000-09-13 YCR105W, YCR106W 309312 309312 Substitution G A
The systematic sequence was updated in the region between ORFs YCR105W and YCR106W. Note that coordinates listed below are chromosomal coordinates.
Old:   309301 ATCATGCTTTTGCTTCGAAATCTAGAGTCCGAGCATGTCTGATGAGGTCCTCTTAAAGCA 309360
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   310575 ATCATGCTTTTACTTCGAAATCTAGAGTCCGAGCATGTCTGATGAGGTCCTCTTAAAGCA 310634
2000-09-13 YCR104W, YCR105W 307323 307323 Deletion T
The systematic sequence was updated in the region between ORFs YCR104W and YCR105W. Note that coordinates listed are chromosomal coordinates.
Old:   307321 TTTCGTCTCCTGTTATACGAATATTTGCATTTCTGTGCCTACTTATGTGTGTATATGTTT 307380
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   308596 TT-CGTCTCCTGTTATACGAATATTTGCATTTCTGTGCCTACTTATGTGTGTATATGTTT 308654
2000-09-13 YCR102W-A, YCR104W 306173 306173 Substitution G T
305943 305943 Insertion G
305908 305908 Insertion C
The systematic sequence was updated in the region between ORFs YCR102W-A and YCR104W. Note that coordinates listed are chromosomal coordinates.
Old:   305883 GAACATCAACTTCTCTCAATACCATC-GCCTTCAGCGGCTACAATTACGTAATTGCACCA 305941
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New:   307156 GAACATCAACTTCTCTCAATACCATCCGCCTTCAGCGGCTACAATTACGTAATTGCACCA 307215
Old:   305942 AG-CATTCGCCGAGAGTTTACATATTTGCAGACCCTAACAGTATACGACTCCCAACACAC 306000
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   307216 AGGCATTCGCCGAGAGTTTACATATTTGCAGACCCTAACAGTATACGACTCCCAACACAC 307275
Old:   306121 TATTCTTTTTGACCGAAAGCGGAAACTTCACAGGCGCGCGTAAAAGGGTTTTGCAAGGCA 306180
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
New:   307396 TATTCTTTTTGACCGAAAGCGGAAACTTCACAGGCGCGCGTAAAAGGGTTTTTCAAGGCA 307455
2000-09-13 YCR102C, YCR102W-A 304740 304740 Insertion A
304543 304543 Insertion A
The systematic sequence was updated in the region between ORFs YCR102C and YCR102W-A. Note that coordinates listed below are chromosomal coordinates.
Old:   304505 CGGGCGGATCCGAGACATCTTAGTCAGCTGAGACAAGAA-GGCACAGCTCTCGGACAGGA 304563
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   305776 CGGGCGGATCCGAGACATCTTAGTCAGCTGAGACAAGAAAGGCACAGCTCTCGGACAGGA 305835
Old:   304684 TGAACTATTGTTAATTGTATGGCGTGTGGCCTTGCTATTTCAGCAAATTTAGAGTAA-GT 304742
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   305956 TGAACTATTGTTAATTGTATGGCGTGTGGCCTTGCTATTTCAGCAAATTTAGAGTAAAGT 306015
2000-09-13 YCR093W 282731 282731 Substitution C T
The systematic sequence was updated within ORF YCR093W. Note that coordinates listed below are chromosomal coordinates.
Old:   282728 GTTCAACTCAGCCTCAGCAACAACAAGCGCAAATGCCTACCCAAATCCTAACCTCCGAAC 282787
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   283999 GTTTAACTCAGCCTCAGCAACAACAAGCGCAAATGCCTACCCAAATCCTAACCTCCGAAC 284058
2000-09-13 YCR091W 275195 275195 Insertion C
274147 274147 Substitution G A
The systematic sequence was updated in the region encompassing ORF YCR091W, causing a frameshift leading to a C-terminally altered and shortened protein from aa 690 onward. The coding region of YCR091W had been annotated as 2181 nt long, but is now 2163 nt. Note that coordinates listed below are chromosomal coordinates.
Old:   274089 TCAATCCTTCGAAAAAATTAGACTACTTGGCCAAGGTGACGTAGGTAAAGTGTATTTAGT 274148
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
New:   275359 TCAATCCTTCGAAAAAATTAGACTACTTGGCCAAGGTGACGTAGGTAAAGTGTATTTAAT 275418
Old:   275169 TATCTTAACCTACTCTGAAAATTATAC-TACGGAAAAATTCTATACAAAGCAACTTGTAC 275227
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
New:   276439 TATCTTAACCTACTCTGAAAATTATACCTACGGAAAAATTCTATACAAAGCAACTTGTAC 276498
2000-09-13 YCR088W, YCR089W 265773 265773 Substitution A G
The systematic sequence was updated in the region between ORFs YCR088W and YCR089W. Note that coordinates listed below are chromosomal coordinates.
Old:   265749 CAACAGACGGTGTGCCCGTACGGCATTGTCAAAACCTCGAACATAAAACAACACTGAAAC 265808
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
New:   267019 CAACAGACGGTGTGCCCGTACGGCGTTGTCAAAACCTCGAACATAAAACAACACTGAAAC 267078
2000-09-13 YCR089W 269261 269262 Substitution TT AA
268390 268390 Substitution A T
The systematic sequence was updated within ORF YCR089W. Note that coordinates listed below are chromosomal coordinates.
Old:   268389 AAGCAAACGCTTGTGCTTTCTACTGTCACAACAACGGTGAACGGTGCTGCTACGGAATAC 268448
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   269659 ATGCAAACGCTTGTGCTTTCTACTGTCACAACAACGGTGAACGGTGCTGCTACGGAATAC 269718
Old:   269229 GTCAGTACGCAAAGTTTGCCTTTGGCATTCACTTGTTCAGAAAAACGCTCCACCACATCT 269288
              ||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||
New:   270499 GTCAGTACGCAAAGTTTGCCTTTGGCATTCACAAGTTCAGAAAAACGCTCCACCACATCT 270558
2000-09-13 YCL074W 3601 3601 Substitution C A
3551 3551 Substitution G T
3538 3538 Substitution C T
3209 3209 Substitution A T
3069 3069 Substitution G C
Five single nucleotide substitutions were made in the systematic sequence in the region encompassing pseudogene YCL074W. Note that coordinates listed are chromosomal coordinates.
Old:    3053 GGTCCCATCTACATTGGCGTATACGTAGACGACTTACTTGTTGCTGCTCCCTCTCCTAAA 3112
             |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
New:    3061 GGTCCCATCTACATTGCCGTATACGTAGACGACTTACTTGTTGCTGCTCCCTCTCCTAAA 3120
Old:    3173 GTTGACAAATTCCTCGGTCTTAACATTCATCAATCGACAAACGGAGACATCACTCTCTCC 3232
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:    3181 GTTGACAAATTCCTCGGTCTTAACATTCATCAATCGTCAAACGGAGACATCACTCTCTCC 3240
Old:    3533 TATCGCTCTGGATCTCAGGTGGCATTAACTGTATATTGTGATGCATCTCATGGAGCTATT 3592
             ||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:    3541 TATCGTTCTGGATCTCAGTTGGCATTAACTGTATATTGTGATGCATCTCATGGAGCTATT 3600
Old:    3593 CACGATCTCCCACACTCTACTGGGGGGTACGTGACTCTACTTGCTGGTGCTCCCGTTACG 3652
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
New:    3601 CACGATCTACCACACTCTACTGGGGGGTACGTGACTCTACTTGCTGGTGCTCCCGTTACG 3660
2000-09-13 YCL074W, YCLWomega2 3858 3858 Substitution C A
A single nucleotide substitution was made in the systematic sequence in the intergenic region between features YCL074W and YCLWomega2. The C at 3858 was changed to A. Note that coordinates listed are chromosomal coordinates.
Old:    3833 CATCCTGTATTTCACACGAGAGCAACACACATTGCTTTGAGATACCACAAGCTAAGAAAT 3892
             ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
New:    3841 CATCCTGTATTTCACACGAGAGCAAAACACATTGCTTTGAGATACCACAAGCTAAGAAAT 3900
2000-09-13 YCL073C, YCLWomega2 5909 5909 Substitution T C
5833 5833 Substitution C T
5683 5683 Substitution C T
5638 5638 Substitution T C
5634 5634 Substitution C T
5631 5631 Substitution T C
5615 5615 Deletion G
5524 5524 Substitution C A
5492 5492 Substitution A T
5486 5486 Substitution T C
5478 5478 Substitution T C
5475 5475 Substitution A G
5468 5468 Substitution T G
5443 5443 Substitution C T
5437 5437 Deletion C
5432 5435 Deletion CATC
5408 5408 Deletion T
5403 5406 Deletion AGGA
5401 5401 Deletion C
5398 5398 Deletion A
5394 5394 Substitution A G
Several sequence changes were made in the systematic sequence in the intergenic region between features YCLWomega2 and YCL073C. Note that coordinates listed are chromosomal coordinates.
Old:    5393 CAACAATCCTAGGAGTTCCAGCTCAATCGGGTATGATATCATCTCTGATACCCCCAAAATACATGGCTGTACCATT 5468
             | ||| || |    | |||||||||||||||||||||||    | ||||| ||||||||||||||||||||||||
New:    5401 CGACA-TC-T----G-TCCAGCTCAATCGGGTATGATAT----T-TGATATCCCCAAAATACATGGCTGTACCATG 5464
Old:    5469 TAAAATAAGTGGTATATTGAAGAACAGTATATTTCAGCCTATACAGGATCCTACTCTTTC 5528
             |||||| || ||||||| ||||| ||||||||||||||||||||||||||||||| ||||
New:    5465 TAAAATGAGCGGTATATCGAAGATCAGTATATTTCAGCCTATACAGGATCCTACTATTTC 5524
Old:    5589 GTTAGTAACATCAATATATCGCGGAGGTAGCTATCATTGTGGTAGCTAATTTAAAGGATA 5648
             |||||||||||||||||||||||||| ||||||||||||||| || ||| ||||||||||
New:    5585 GTTAGTAACATCAATATATCGCGGAG-TAGCTATCATTGTGGCAGTTAACTTAAAGGATA 5643
Old:    5649 TACAGTTAATTCAACAAGATTTTCAAGTCCATTTCTTTTGGGCACGCTGAACACGCTCAA 5708
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
New:    5644 TACAGTTAATTCAACAAGATTTTCAAGTCCATTTTTTTTGGGCACGCTGAACACGCTCAA 5703
Old:    5829 AGACCGTTGCCGACTCCAAGAAAACTATGATCTCAATACAGGCATAAAGAATTGTTGTAT 5888
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:    5824 AGACTGTTGCCGACTCCAAGAAAACTATGATCTCAATACAGGCATAAAGAATTGTTGTAT 5883
Old:    5889 CTGTGCCCATGTGATCTGTATCTTTTTTGCGGTACCAAAATCGCATGTTGCACTCACACT 5948
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
New:    5884 CTGTGCCCATGTGATCTGTACCTTTTTTGCGGTACCAAAATCGCATGTTGCACTCACACT 5943
2000-09-13 YCL073C
7997 7997 Substitution C T
7943 7943 Substitution C T
7778 7778 Substitution T C
7451 7451 Substitution A G
7445 7445 Substitution A G
7415 7415 Substitution T C
6968 6968 Substitution G A
6533 6533 Substitution G A
6504 6504 Substitution T C
6490 6490 Substitution C T
6484 6484 Substitution C T
6480 6480 Substitution G A
Twelve separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL073C. These changes resulted in 4 amino acid differences in the predicted protein sequence. Note that coordinates listed are chromosomal coordinates.
Old:    6468 GATCAACATCCTGATTCCTTGTCACTTCGA 6497
             |||||||||||| ||| ||||| |||||||
New:    6477 GATCAACATCCTAATTTCTTGTTACTTCGA 6506
Old:    6498 TTATGTTTAAAAAGTGCCTTGATTTGAGAGAAAATGTTTTCCTCATCTGGCAAGACAACC 6557
             |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||
New:    6507 TTATGTCTAAAAAGTGCCTTGATTTGAGAGAAAATATTTTCCTCATCTGGCAAGACAACC 6566
Old:    6918 GTAGTCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATAGGAGACCGCTCAAACCC 6977
             |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:    6927 GTAGTCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATAGGAGACCACTCAAACCC 6986
Old:    7398 TTTGAATTGTGCCACTTTTGTGATGTCTCATTAGCCAACGTCAAAGGAACAAGAATACAC 7457
             ||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||
New:    7407 TTTGAATTGTGCCACTTCTGTGATGTCTCATTAGCCAACGTCAAAGGGACAAGGATACAC 7466
Old:    7758 TACTGGTAAAACATTCTCCATTTCAAGGAGGAGAAATCAGAAAGTATTAATGTCAGGAGC 7817
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
New:    7767 TACTGGTAAAACATTCTCCACTTCAAGGAGGAGAAATCAGAAAGTATTAATGTCAGGAGC 7826
Old:    7938 AGCCTCAGTCTTCCGAAGTGGTCAGAGAGTCTGGAGTAGACAACTTGGGATCCGACACTC 7997
             ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:    7947 AGCCTTAGTCTTCCGAAGTGGTCAGAGAGTCTGGAGTAGACAACTTGGGATCCGACACTT 8006
2000-09-13 YCL069W, YCL073C 8764 8764 Substitution C T
8733 8733 Substitution T C
8686 8686 Substitution A G
8675 8675 Substitution T C
8585 8585 Insertion AAA
8577 8577 Substitution T A
8535 8535 Substitution C T
8521 8521 Substitution C T
8365 8366 Deletion TT
8344 8344 Substitution T C
Several sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL073C and YCL069W. Note that coordinates listed are chromosomal coordinates.
Old:    8298 CCAACAACACTAGAACTCATCCGATAATTTATTTACTTGATTATTCTTTTTTTTTTTTTT 8357
             |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:    8307 CCAACAACACTAGAACTCATCCGATAATTTATTTACTTGATTATTCCTTTTTTTTTTTTT 8366
Old:    8358 TTTCTCTTTCCAGTCCATAAAACTATTTTACTTTTCTTATTTATGTAAATAGTATTTAAGA 8418
             |||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:    8367 TCTCTTT--CCAGTCCATAAAACTATTTTACTTTTCTTATTTATGTAAATAGTATTTAAGA 8425
Old:    8476 ATATATACTTTTACTGACACCTTTCGTCACTATTTTTTGTTTAACCTTTTTTTTGGAAG 8534
             ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:    8483 ATATATACTTTTACTGACACCTTTCGTCACTATTTTTTGTTTAACTTTTTTTTTGGAAG 8541
Old:    8535 CACTAAAATTATATGCTCGTAATTATTGAGCATCAAAAAAAATAAAAAAAA--- 8585
              ||||||||||||||||||||||||||||||||||||||||| ||||||||
New:    8542 TACTAAAATTATATGCTCGTAATTATTGAGTATCAAAAAAAAAAAAAAAAAAAA 8595
Old:    8640 ACTTTGACCTGTCGTCGTACAATCAACTTAGTTTCTGAAAATCCACAACGAACCAGTTAT 8699
             ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||
New:    8650 ACTTTGACCTGTCGTCGTACAATCAACTTAGTTTCCGAAAATCCACGACGAACCAGTTAT 8709
Old:    8700 ACCGAAGACTTTTGTACGACAAGAATACTGTACTGTCGAAACTATCTCTTTTCAAACTGA 8759
             ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
New:    8710 ACCGAAGACTTTTGTACGACAAGAATACTGTACCGTCGAAACTATCTCTTTTCAAACTGA 8769
Old:    8760 TGAGCGAAGCTTGTGTTTATGTCTGTTGAAACAAGGAAAAAAATGCGGTGCCTGTCGACA 8819
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:    8770 TGAGTGAAGCTTGTGTTTATGTCTGTTGAAACAAGGAAAAAAATGCGGTGCCTGTCGACA 8829
2000-09-13 YCL073C, YCLWomega2 6231 6231 Substitution T G
6226 6226 Substitution A G
6195 6195 Substitution T C
6164 6164 Substitution T A
6090 6090 Substitution T C
6055 6055 Substitution C G
6014 6014 Substitution T C
6006 6006 Substitution C T
5990 5990 Substitution G A
5980 5980 Substitution G A
6098 6098 Substitution C T
Several sequence changes were made in the systematic sequence in the intergenic region between features YCLWomega2 and YCL073C. Note that coordinates listed are chromosomal coordinates.
Old:    5949 ACGGAACACATCAACTTGTAACGACAACAATGCAAAATACCGGGAGACATATCACTTCTT 6008
             ||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||
New:    5944 ACGGAACACATCAACTTGTAACGACAACAATACAAAATACCAGGAGACATATCACTTTTT 6003
Old:    6009 TTCGCTTAGAATGATTTACAATGGCATACACTTAGAAAAGTGCTATCACATGACGCCCTT 6068
             ||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:    6004 TTCGCCTAGAATGATTTACAATGGCATACACTTAGAAAAGTGCTATGACATGACGCCCTT 6063
Old:    6069 ACTAGAAGTTACATGATTCTCTTTTTTTTCCTTTCTTTCTTTCTTTTTCGGTACAACATA 6128
             ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||
New:    6064 ACTAGAAGTTACATGATTCTCCTTTTTTTTCTTTCTTTCTTTCTTTTTCGGTACAACATA 6123
Old:    6129 ATTAATGCATTCATACAGAGCGCATTTCCAGCATCTTTTATTGGATAGTAACTCCTCCCG 6188
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
New:    6124 ATTAATGCATTCATACAGAGCGCATTTCCAGCATCATTTATTGGATAGTAACTCCTCCCG 6183
Old:    6189 CACTTTTAATATCAATGACGCTGACTCTTTTACTGACACTGATTCTTTACCGACGCTGAG 6248
             |||||| |||||||||||||||||||||||||||||| |||| |||||||||||||||||
New:    6184 CACTTTCAATATCAATGACGCTGACTCTTTTACTGACGCTGAGTCTTTACCGACGCTGAG 6243
2000-09-13 YCL073C, YCLWomega2 6466 6466 Substitution A G
6444 6446 Deletion TTT
6443 6443 Substitution T G
6433 6433 Substitution T A
6398 6398 Substitution C T
6391 6391 Substitution A G
6377 6377 Substitution A G
6325 6325 Substitution A G
6315 6315 Substitution A C
6281 6281 Substitution T G
6279 6279 Substitution C T
6267 6267 Substitution T C
6255 6256 Substitution GT CC
6248 6248 Insertion TCTTTACCGACGCTGAG
6389 6389 Substitution A G
6261 6261 Substitution T C
Several sequence changes were made in the systematic sequence in the intergenic region between features YCLWomega2 and YCL073C. Note that coordinates listed are chromosomal coordinates.
Old:    6249 -----------------TCTTTAGTG 6257
                              ||||||  |
New:    6244 TCTTTACCGACGCTGAGTCTTTACCG 6269
Old:    6258 ACGTTGAGTTTTTACCGACGCCTTTGAAAATAAAAAGTACGACACAGCTATATGCGTAGC 6317
             ||| ||||| ||||||||||| | ||||||||||||||||||||||||||||||||| ||
New:    6270 ACGCTGAGTCTTTACCGACGCTTGTGAAAATAAAAAGTACGACACAGCTATATGCGTCGC 6329
Old:    6318 AAGTTCAAATGTGGGTCTATCGAGCATGTTTATCCTATCCTGTTATGTCATTTTTATCGA 6377
             ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
New:    6330 AAGTTCAGATGTGGGTCTATCGAGCATGTTTATCCTATCCTGTTATGTCATTTTTATCGG 6389
Old:    6378 AAGTAATAAAAATATAGAAACCACTTGTTTTTGCCTTTTTTGTGATTTTGCTTTCTTTTT 6437
             ||||||||||| | |||||| |||||||||||||||||||||||||||||||||| ||||
New:    6390 AAGTAATAAAAGTGTAGAAATCACTTGTTTTTGCCTTTTTTGTGATTTTGCTTTCATTTT 6449
Old:    6438 TTTTTTTTTCCCTTTTTTCACCAGCTTGAGGATCAACATCCTGATTCCTTGTCACTTCGA 6497
             |||||    ||||||||||||||||||| ||||||||||||| ||| ||||| |||||||
New:    6450 TTTTTG---CCCTTTTTTCACCAGCTTGGGGATCAACATCCTAATTTCTTGTTACTTCGA 6506
2000-09-13 YCL068C 12268 12268 Deletion T
12049 12049 Substitution G C
Two sequence changes were made in the systematic sequence in the region encompassing ORF YCL068C. The G at 12049 was changed to C, and the T at 12268 was deleted. These changes resulted in the N-terminal elongation of the predicted protein sequence by 70 amino acids. Note that coordinates listed are chromosomal coordinates.
Old:   12000 GACGAGGGGGCATTCTCTAGAGACACAGGCAGTTGCTTCCAGCAACTGCGGTACGGCCGT 12059
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   12010 GACGAGGGGGCATTCTCTAGAGACACAGGCAGTTGCTTCCAGCAACTGCCGTACGGCCGT 12069
Old:   12240 AAGGTAGGCGAGGACATTATCTATCAGTTACAAACATCTTAGTAGTGTCTGAGGAGAGGG 12299
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
New:   12250 AAGGTAGGCGAGGACATTATCTATCAGT-ACAAACATCTTAGTAGTGTCTGAGGAGAGGG 12308
2000-09-13 YCL067C, YCL068C 12340 12340 Insertion AT
A dinucleotide insertion was made in the systematic sequence in the intergenic region between ORFs YCL068C and YCL067C. An AT was inserted after the T at 12340. Note that coordinates listed are chromosomal coordinates.
Old:   12300 TTGATTGTTTATGTATTTTTGCGAAATATATATATATATAT--TCTACACAGATATATAC 12357
             |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||
New:   12309 TTGATTGTTTATGTATTTTTGCGAAATATATATATATATATATTCTACACAGATATATAC 12368
2000-09-13 YCL064C 16068 16068 Substitution G T
15921 15921 Insertion C
15918 15918 Deletion T
Three sequence changes were made in the systematic sequence within ORF YCL064C. The T at 15918 was deleted, a single C was inserted after the C at 15921, and the G at 16068 was changed to T. Note that coordinates listed are chromosomal coordinates.
Old:   15898 CTTTATAGTATTAGAGGAGCTCGC-ACAAGCAATAATTATCACAATGTCATCCGCAGCTA 15956
             |||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||
New:   15909 CTTTATAGTATTAGAGGAGC-CGCCACAAGCAATAATTATCACAATGTCATCCGCAGCTA 15967
Old:   16017 CACATGCCGGTTCAATCACCATATTGAATTGATGTGTATATTTAAGACAGGGTTCAATAA 16076
             ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
New:   16028 CACATGCCGGTTCAATCACCATATTGAATTGATGTGTATATTTAAGACAGGTTTCAATAA 16087
2000-09-13 YCL063W, YCL064C 17185 17185 Insertion T
17079 17079 Insertion C
17067 17067 Substitution A G
17045 17045 Insertion G
17035 17035 Insertion TA
17026 17026 Insertion T
16992 16992 Substitution A T
16970 16970 Substitution A T
Several sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL064C and YCL063W. Note that coordinates listed are chromosomal coordinates.
Old:   16917 GAGAAAACTGTATAAACATTTTCCTTTTATTTGGCGATATTTATATACCTGTGATCCTCC 16976
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
New:   16928 GAGAAAACTGTATAAACATTTTCCTTTTATTTGGCGATATTTATATACCTGTGTTCCTCC 16987
Old:   16977 TCATATTGTCCCTTTAATCTTATCTCATCGCAAACAATTTGATAAAGCTT-GGCACTATT 17035
             ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||
New:   16988 TCATATTGTCCCTTTTATCTTATCTCATCGCAAACAATTTGATAAAGCTTTGGCACTATT 17047
Old:   17036 --ATGACACTCA-TGGAATTACATTTCCGCTGGGACTTAACAGGAGC-GCCCATGCGGAA 17091
               |||||||||| ||||||||||||||||||||| |||||||||||| ||||||||||||
New:   17048 TAATGACACTCAGTGGAATTACATTTCCGCTGGGGCTTAACAGGAGCCGCCCATGCGGAA 17107
Old:   17152 GAGAAAAAGAAAAATAGTAGGAACATTTCGCAAT-GATCAAAATGTAAACAGTGCAGTAA 17210
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
New:   17168 GAGAAAAAGAAAAATAGTAGGAACATTTCGCAATTGATCAAAATGTAAACAGTGCAGTAA 17227
2000-09-13 YCL061C 21923 21923 Substitution T G
21911 21911 Insertion T
21801 21801 Deletion C
Three sequence changes were made in the systematic sequence in the region encompassing ORF YCL061C. The C at 21801 was deleted, a T was inserted after the T at 21911, and the T at 21923 was changed to G, resulting in the N-terminal extension of the predicted protein sequence by 243 amino acids. Note that coordinates listed are chromosomal coordinates.
Old:   21771 CGGATTTCTCCAGCTCTTCACCACCATCGTCAAAGATTAGAGATTAATTGAGTTGGTAAC 21830
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New:   21788 CGGATTTCTCCAGCTCTTCACCACCATCGT-AAAGATTAGAGATTAATTGAGTTGGTAAC 21846
Old:   21891 AATCTGTTCTTAACACGATT-AATGTGGCATTTGCAAATAAAAACCCGTTCCCAGTCAAC 21949
             |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||
New:   21907 AATCTGTTCTTAACACGATTTAATGTGGCATTGGCAAATAAAAACCCGTTCCCAGTCAAC 21966
2000-09-13 YCL051W, YCL052C 35577 35577 Insertion T
35570 35570 Insertion T
35568 35568 Insertion A
35506 35506 Insertion A
Four single nucleotide insertions were made in the systematic sequence in the intergenic region between ORFs YCL052C and YCL051W. Note that coordinates listed are chromosomal coordinates.
Old:   35450 TGATCTTTTTTATCAGGGGGATCTTCAAAGAAAGGAACTTTTTTTAGGAAAAAAAAA-TA 35508
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   35467 TGATCTTTTTTATCAGGGGGATCTTCAAAGAAAGGAACTTTTTTTAGGAAAAAAAAAATA 35526
Old:   35569 -GT-CTGCTGT-AGTGTGTCCTCCAATACTCTTGCACGACAAAGTTTTAGTTATCCCCTT 35625
              || ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   35587 AGTTCTGCTGTTAGTGTGTCCTCCAATACTCTTGCACGACAAAGTTTTAGTTATCCCCTT 35646
2000-09-13 YCL051W 37579 37579 Insertion TT
37553 37553 Insertion C
37551 37551 Insertion A
37547 37547 Insertion A
37504 37504 Substitution G A
37463 37463 Substitution T C
37374 37374 Substitution A G
Several sequence changes were made in the systematic sequence within ORF YCL051W, resulting in a number of amino acid changes in the predicted protein sequence. In addition, the stop site was moved upstream 9 nucleotides, shortening the coding sequence from 1761 nt to 1752 nt. Note that coordinates listed are chromosomal coordinates.
Old:   37366 TTGTCAACACGCAGAGAAAAGCCTCAAATGAAACTGGTGACTTAGTCTTTAGTTTATCCC 37425
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
New:   37387 TTGTCAACGCGCAGAGAAAAGCCTCAAATGAAACTGGTGACTTAGTCTTTAGTTTATCCC 37446
Old:   37426 AGGATGATGACGCACTGAAAACGTTCCATGCGAGCAATAGCGCAGCAACAAGCAATGAAA 37485
             ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
New:   37447 AGGATGATGACGCACTGAAAACGTTCCATGCGAGCAACAGCGCAGCAACAAGCAATGAAA 37506
Old:   37486 GCTGGTGTATTAGCGATGGTGCGTTAGGAAAGCAGGCGCAGGACAGTGAAGTTAGGAGGA 37545
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   37507 GCTGGTGTATTAGCGATGATGCGTTAGGAAAGCAGGCGCAGGACAGTGAAGTTAGGAGGA 37566
Old:   37546 AA-GAAA-TC-AAATTAGGACTCTTTAGACATATTTT--CAAGGAAGTAATACAACAATAT 37601
             || |||| || ||||||||||||||||||||||||||  ||||||||||||||||||||||
New:   37567 AAAGAAAATCCAAATTAGGACTCTTTAGACATATTTTTTCAAGGAAGTAATACAACAATAT 37627
2000-09-13 YCL050C, YCL051W 37772 37773 Deletion TA
37705 37705 Substitution T C
37638 37638 Substitution G A
Three sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL051W and YCL050C. The G at 37638 was changed to A, the T at 37705 was changed to C, and the TA dinucleotide at 37772-3 was deleted. Note that coordinates listed are chromosomal coordinates.
Old:   37602 TAATAATAAGTAATAAAAAGGTGAATCGTAACCTTAGCGGCATTGATTGCATGTAGT 37658
             |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   37628 TAATAATAAGTAATAAAAAGGTGAATCGTAACCTTAACGGCATTGATTGCATGTAGT 37684
Old:   37659 TTTAATAATAAAGTGTAGAATAATAAATATAAAATTTCAAAGTCATTAGAAATAAAAA 37716
             |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
New:   37685 TTTAATAATAAAGTGTAGAATAATAAATATAAAATTTCAAAGTCATCAGAAATAAAAA 37742
Old:   37770 TATACATACATGTATACGTGTATACTTGTACTTGTGAAGGACTCAATAGTTGTATTCGTT 37829
             ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   37796 TA--CATACATGTATACGTGTATACTTGTACTTGTGAAGGACTCAATAGTTGTATTCGTT 37853
2000-09-13 YCL050C 38790 38790 Substitution G T
38640 38640 Substitution G A
38479 38479 Substitution C T
38294 38294 Substitution A G
38154 38154 Substitution G A
37998 37998 Substitution A G
Six separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL050C. Note that coordinates listed are chromosomal coordinates.
Old:   37950 ACCTGTGGAGTTGAAACCTATCTTCATTTCATCAGAAAAGGCCTTCGAACGTGGAACGAC 38009
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
New:   37974 ACCTGTGGAGTTGAAACCTATCTTCATTTCATCAGAAAAGGCCTTCGAGCGTGGAACGAC 38033
Old:   38130 TAGGTCTTCATCAACAGTTTCTTCGGACTCCGGCATTGGCAAGACAAAATGAGCGAACGA 38189
             |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
New:   38154 TAGGTCTTCATCAACAGTTTCTTCAGACTCCGGCATTGGCAAGACAAAATGAGCGAACGA 38213
Old:   38250 ACATAGTCTATCTTGGAAAGTGACGAACTTTTCAGGCATTTGCAAAATTTGCAAATGTTT 38309
             |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
New:   38274 ACATAGTCTATCTTGGAAAGTGACGAACTTTTCAGGCATTTGCAGAATTTGCAAATGTTT 38333
Old:   38430 CAAGGCATCAGTTTGATGTTGGTATTCGTTAGTTACCAATAAAGTGTGTCCAGGGATTAC 38489
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   38454 CAAGGCATCAGTTTGATGTTGGTATTCGTTAGTTACCAATAAAGTGTGTTCAGGGATTAC 38513
Old:   38610 CTCTGGCTTTTCGATCAGACTTGGCATGTGGCTAATCAAGTATGGCATGCTGGTTTTTGG 38669
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New:   38634 CTCTGGCTTTTCGATCAGACTTGGCATGTGACTAATCAAGTATGGCATGCTGGTTTTTGG 38693
Old:   38790 GTTTACTTTTCTGTTTGTTCTAAAATCTATCTAAACTGGCTTTCAAGATCAATCTATTGT 38849
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   38814 TTTTACTTTTCTGTTTGTTCTAAAATCTATCTAAACTGGCTTTCAAGATCAATCTATTGT 38873
2000-09-13 ARS305, YCL050C 39099 39099 Substitution T A
One sequence substitution was made in the systematic sequence in the intergenic region between features YCL050C and ARS305. The T at 39099 was changed to A. Note that coordinates listed are chromosomal coordinates.
Old:   39090 GTTATGGGATTATCGTGTAAGCTGGGGTGACTTTTGAGCTATTCGCGACGCCCGACGCCG 39149
             ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
New:   39114 GTTATGGGAATATCGTGTAAGCTGGGGTGACTTTTGAGCTATTCGCGACGCCCGACGCCG 39173
2000-09-13 YCL049C 40174 40174 Substitution A T
40121 40121 Substitution T C
40086 40086 Substitution A C
40066 40066 Substitution A G
39985 39985 Substitution A G
39944 39944 Substitution G A
Six separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL049C, resulting in 4 amino acid substitutions in the predicted protein sequence. Note that coordinates listed are chromosomal coordinates.
Old:   39930 GAACCTCATTTTCCGACATTTTGGTCATGTAAGAGGCGACAGGCTCATCGCAGGTAGGTG 39989
             |||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||
New:   39953 GAACCTCATTTTCCAACATTTTGGTCATGTAAGAGGCGACAGGCTCATCGCAGGTGGGTG 40012
Old:   40050 TACAATATTGTCTTTGAACGTTTGCCCAAACCATATATTTTGAATACCAAAGCTGGACCA 40109
             |||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||
New:   40073 TACAATATTGTCTTTGGACGTTTGCCCAAACCATATCTTTTGAATACCAAAGCTGGACCA 40132
Old:   40110 CATTGTATGGCTTAATCATTGGTGCTACCATAATACTGGATTGGGAAACAGTCTGGTTAA 40169
             ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   40133 CATTGTATGGCCTAATCATTGGTGCTACCATAATACTGGATTGGGAAACAGTCTGGTTAA 40192
Old:   40170 TTTTATTCAACCAATTTTTCTTATCTAGCAATGATTTAATAAACCTGAAATCTAAATTGT 40229
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   40193 TTTTTTTCAACCAATTTTTCTTATCTAGCAATGATTTAATAAACCTGAAATCTAAATTGT 40252
2000-09-13 YCL042W 50702 50702 Substitution G C
50700 50700 Substitution G C
50657 50657 Insertion GG
50635 50635 Insertion C
One single nucleotide insertion, one dinucleotide insertion, and two single nucleotide substitutions were made in the systematic sequence within ORF YCL042W, resulting in several amino acid changes in the predicted protein sequence, and increasing the size of the coding sequence from 357 nucleotides to 360 nt. Note that coordinates listed are chromosomal coordinates.
Old:   50610 GTGGTGTGCCGACGGACGGTCAACCC-TTTCAGGGGGCCCCCTATCTTG 50657
             |||||||||||||||||||||||||| ||||||||||||||||||||||
New:   50633 GTGGTGTGCCGACGGACGGTCAACCCCTTTCAGGGGGCCCCCTATCTTG 50681
Old:   50658 --CGTGGTGTCACACCACGCTCAAACGGTGGGCACTAATGAAAAGGGGCCCATATAAATA 50715
               |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||
New:   50682 GGCGTGGTGTCACACCACGCTCAAACGGTGGGCACTAATGAAAACGCGCCCATATAAATA 50741
2000-09-13 YCL037C, YCL038C 57211 57211 Insertion A
57043 57043 Deletion A
56612 56612 Insertion A
Three sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL038C and YCL037C. Note that coordinates listed are chromosomal coordinates.
Old:   56596 ACACTACGCATCTTTCA-TAGCTGAGGTATTTTCGTTTAGGAAAATACCGTTTTAAGGAA 56654
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   56622 ACACTACGCATCTTTCAATAGCTGAGGTATTTTCGTTTAGGAAAATACCGTTTTAAGGAA 56681
Old:   57015 TATTTTTATATCTTAAAAAAAAAAAAAAAACAAAAAAAAAAAAACATAAATATTTGTATC 57074
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New:   57042 TATTTTTATATCTTAAAAAAAAAAAAAAA-CAAAAAAAAAAAAACATAAATATTTGTATC 57100
Old:   57195 CAAAAAAAAAAAAAAAA-CAAAAAAAAAACAGCTTTGCTGGAGGATGATTAACTTTTAAT 57253
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   57221 CAAAAAAAAAAAAAAAAACAAAAAAAAAACAGCTTTGCTGGAGGATGATTAACTTTTAAT 57280
2000-09-13 YCL034W 61789 61789 Insertion G
A single nucleotide insertion was made in the systematic sequence in the region encompassing ORF YCL034W, extending the predicted protein sequence N-terminally by 89 amino acids. Note that coordinates listed are chromosomal coordinates.
Old:   61754 CACAACGATTATAACTATACCGTGAACCAAGAAGAA-CTGCGCGAGCACTTAGAAAGAAA 61812
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   61781 CACAACGATTATAACTATACCGTGAACCAAGAAGAAGCTGCGCGAGCACTTAGAAAGAAA 61840
2000-09-13 YCL030C 67181 67181 Substitution C G
One sequence change was made in the systematic sequence in the region encompassing ORF YCL030C, resulting in one amino acid substitution. Note that coordinates listed are chromosomal coordinates.
Old:   67153 TAATTTCAGAAGTCTTTTGGATTGGTCTCCTCAAAGCCTTCTGCACACCAACTTTGTCGG 67212
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
New:   67181 TAATTTCAGAAGTCTTTTGGATTGGTCTGCTCAAAGCCTTCTGCACACCAACTTTGTCGG 67240
2000-09-13 YCL029C 69717 69717 Substitution T C
69690 69690 Substitution G A
69624 69624 Substitution C T
Three sequence changes were made in the systematic sequence in the region encompassing ORF YCL029C. Note that coordinates listed are chromosomal coordinates.
Old:   69613 AGCGGTTCCATCGTCGTTCTTCTCGAGGTTTGCGATATCGATGCCTTCTCGATCAATGAT 69672
             ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   69641 AGCGGTTCCATTGTCGTTCTTCTCGAGGTTTGCGATATCGATGCCTTCTCGATCAATGAT 69700
Old:   69673 GCGACTTTTTGCAACTGGATAAATAGTCCACTTTGAGGATACTCTGTTTGAAAATACTTC 69732
             ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||
New:   69701 GCGACTTTTTGCAACTGAATAAATAGTCCACTTTGAGGATACTCCGTTTGAAAATACTTC 69760
2000-09-13 YCL028W 71366 71366 Deletion C
71282 71282 Substitution T C
71219 71219 Substitution T C
71213 71213 Substitution A G
71201 71201 Substitution C G
71195 71195 Substitution A G
71051 71051 Substitution C T
70808 70808 Substitution T C
70757 70757 Substitution T C
70742 70742 Substitution A G
Several sequence changes were made in the systematic sequence in the region encompassing ORF YCL028W. Note that coordinates listed are chromosomal coordinates.
Old:   70693 ATCAGCAAGGTCAAAATCAAAGCTCCGGTGGTTCCTCCTTTGGAGCACTAGCTTCTATGG 70752
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   70721 ATCAGCAAGGTCAAAATCAAAGCTCCGGTGGTTCCTCCTTTGGAGCACTGGCTTCTATGG 70780
Old:   70753 CAAGTTCTTTTATGCATTCCAATAATAATCAGAACTCCAACAATAGTCAACAGGGTTATA 70812
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||
New:   70781 CAAGCTCTTTTATGCATTCCAATAATAATCAGAACTCCAACAATAGTCAACAGGGCTATA 70840
Old:   70993 ATCAACAAGGCCAAAACAACCAGCAGCAATACCAGCAACAAGGCCAAAACTATCAGCACC 71052
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
New:   71021 ATCAACAAGGCCAAAACAACCAGCAGCAATACCAGCAACAAGGCCAAAACTATCAGCATC 71080
Old:   71173 AGGCTAATGAGTATGGTAGACCACAACACAATGGTCAACAACAATCTAATGAGTACGGAA 71232
             |||||||||||||||||||||| ||||| ||||||||||| ||||| |||||||||||||
New:   71201 AGGCTAATGAGTATGGTAGACCGCAACAGAATGGTCAACAGCAATCCAATGAGTACGGAA 71260
Old:   71233 GACCGCAATACGGCGGAAACCAGAACTCCAATGGACAGCACGAATCCTTTAATTTTTCTG 71292
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   71261 GACCGCAATACGGCGGAAACCAGAACTCCAATGGACAGCACGAATCCTTCAATTTTTCTG 71320
Old:   71353 TCGCCTTCTATCCCTTTGTTTACGTATTTGTTTATATATATAACTTTAT 71401
             ||||||||||||| |||||||||||||||||||||||||||||||||||
New:   71381 TCGCCTTCTATCC-TTTGTTTACGTATTTGTTTATATATATAACTTTAT 71428
2000-09-13 YCL027W, YCL028W 71729 71729 Insertion T
71608 71608 Substitution A T
71408 71408 Insertion T
Three sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL028W and YCL027W. Note that coordinates listed are chromosomal coordinates.
Old:   71368 TTGTTTACGTATTTGTTTATATATATAACTTTATTTTTTTT-ATT 71411
             ||||||||||||||||||||||||||||||||||||||||| |||
New:   71396 TTGTTTACGTATTTGTTTATATATATAACTTTATTTTTTTTTATT 71439
Old:   71592 ACAAACATGAAACGTCAGTAATTTGAAACAAATAACGTAATTCTCGGGATTGGTTTTATT 71651
             |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
New:   71620 ACAAACATGAAACGTCTGTAATTTGAAACAAATAACGTAATTCTCGGGATTGGTTTTATT 71679
Old:   71712 GACATCCTTTATCTTTTT-CCTTTAAGAGCAGGATATAAGCCATCAAGTTTCTGAAAATC 71770
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   71740 GACATCCTTTATCTTTTTTCCTTTAAGAGCAGGATATAAGCCATCAAGTTTCTGAAAATC 71799
2000-09-13 YCL027W 73226 73226 Substitution A T
73218 73218 Substitution G A
73204 73204 Substitution G A
73066 73066 Substitution A G
72757 72757 Substitution C T
72161 72161 Substitution C T
Several sequence changes were made in the systematic sequence in the region encompassing ORF YCL027W. Note that coordinates listed are chromosomal coordinates.
Old:   72131 CGCCGCACTAATTGGTTCTCACGGTTATTTCGGCAGAGTAAGTGTGAGGATCAGAATTCA 72190
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New:   72160 CGCCGCACTAATTGGTTCTCACGGTTATTTTGGCAGAGTAAGTGTGAGGATCAGAATTCA 72219
Old:   72731 AACACGCCTCTGGATGCAAATGACAGCGTGAATAACTTGGGTAATACCACGCCAGATTCA 72790
             |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New:   72760 AACACGCCTCTGGATGCAAATGACAGTGTGAATAACTTGGGTAATACCACGCCAGATTCA 72819
Old:   73031 CCATTGCCGCTTACTCCAAACTCCAAATATAATGGAGAGGCTAGCGTCCAATTAGGGAAG 73090
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
New:   73060 CCATTGCCGCTTACTCCAAACTCCAAATATAATGGGGAGGCTAGCGTCCAATTAGGGAAG 73119
Old:   73151 GGTGAAAAAGTTAAAATTCTGGCCACTCATACCGATGGATGGTGTCTGGTAGAGAAGTGT 73210
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
New:   73180 GGTGAAAAAGTTAAAATTCTGGCCACTCATACCGATGGATGGTGTCTGGTAGAAAAGTGT 73239
| 
Old:   73211 AATACACGAAAGGGTACTATTCACGTCAGTGTTGACGATAAAAGATACCTCAATGAAGAT 73270
             ||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||
New:   73240 AATACACAAAAGGGTTCTATTCACGTCAGTGTTGACGATAAAAGATACCTCAATGAAGAT 73299
2000-09-13 YCL026C-A 74943 74943 Insertion T
74813 74813 Insertion C
74935 74935 Insertion T
Three sequence changes were made in the systematic sequence in the region encompassing ORF YCL026C-A. Note that coordinates listed are chromosomal coordinates.
Old:   74890 GAGCGGCGCATGTTGGGAAAGCGG-TGCCAAGGCTGGAAAATCTCTT-GCAGTTTT-CAG 74946
             |||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |||
New:   74919 GAGCGGCGCATGTTGGGAAAGCGGCTGCCAAGGCTGGAAAATCTCTTTGCAGTTTTTCAG 74978
2000-09-13 YCL025C, YCL026C-A 76114 76115 Substitution GG T
75986 75986 Insertion T
75831 75831 Substitution T C
75514 75514 Substitution A G
Several sequence changes were made in the systematic sequence in the intergenic region between features YCL026C-A and YCL025C. Note that coordinates listed are chromosomal coordinates.
Old:   75487 AATTGAAAAATTATTCGGAAGAGCATTAACAAATATTGATTAATAATCAAGTAACACTCG 75546
             ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
New:   75519 AATTGAAAAATTATTCGGAAGAGCATTGACAAATATTGATTAATAATCAAGTAACACTCG 75578
Old:   75787 TTTTTCTCTCACTTCATATTATTTCACTTATATTTTCCTCTCCATTTCCATCACGCAATC 75846
             |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
New:   75819 TTTTTCTCTCACTTCATATTATTTCACTTATATTTTCCTCTCCACTTCCATCACGCAATC 75878
Old:   75967 GAAGTAAATGCTTTTTTTTT-AACACCAGAAGGCAACGACCCTTTTCCAATAAGGTCCGT 76025
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
New:   75999 GAAGTAAATGCTTTTTTTTTTAACACCAGAAGGCAACGACCCTTTTCCAATAAGGTCCGT 76058
Old:   76086 GTCTATGAGAATCTAGGTCGATCTTGTCGGCCCTGATGAACAGTTTCCAATCCTTGTGCC 76145
             ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||
New:   76119 GTCTATGAGAATCTAGGTCGATCTTGTCT-CCCTGATGAACAGTTTCCAATCCTTGTGCC 76177
2000-09-13 YCL025C 77472 77472 Substitution G A
77320 77320 Insertion G
77297 77297 Deletion A
76165 76165 Substitution T A
76940 76940 Substitution A G
Five sequence changes were made in the systematic sequence in the region encompassing ORF YCL025C. Note that coordinates listed are chromosomal coordinates.
Old:   76146 AGACCTTGTAGCCGACATATAGTGCAATCAAGATTGGCATAGCCAAGTAGTTTTCGAAAA 76205
             ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
New:   76178 AGACCTTGTAGCCGACATAAAGTGCAATCAAGATTGGCATAGCCAAGTAGTTTTCGAAAA 76237
Old:   76926 TCACTAATGTTGCAACAACACCTTTAAATCTGTCAATGGCATGTTTACCATTGAAAGCGC 76985
             |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   76958 TCACTAATGTTGCAGCAACACCTTTAAATCTGTCAATGGCATGTTTACCATTGAAAGCGC 77017
Old:   77286 CAAACCCAAAAACCATCATCCACAAGGAAACTGGG-TATGCATTGTAGCCACCAGTCAAG 77344
             ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||
New:   77318 CAAACCCAAAA-CCATCATCCACAAGGAAACTGGGGTATGCATTGTAGCCACCAGTCAAG 77376
Old:   77465 CCGACCAGTAACCCAGTACCGATACCCGTACCCAACGCAATCATCAGAACATGTCTAGGC 77524
             ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   77497 CCGACCAATAACCCAGTACCGATACCCGTACCCAACGCAATCATCAGAACATGTCTAGGC 77556
2000-09-13 tQ(UUG)C 168331 168335 Deletion AGGTG
The systematic sequence was updated in the region encompassing feature tQ(UUG)C. Note that coordinates listed are chromosomal coordinates.
Old:   168303 TGCTACTAGCATTTTATCACATGAGGTGAGGTGTAAGAAGATGACATAAAGATTGAGATA 168362
              ||||||||||||||||||||||||||||     |||||||||||||||||||||||||||
New:   169609 TGCTACTAGCATTTTATCACATGAGGTG-----TAAGAAGATGACATAAAGATTGAGATA 169663
2000-09-13 YCRWdelta11, tQ(UUG)C 168881 168881 Substitution C T
168787 168787 Substitution A G
168685 168685 Substitution T C
168682 168682 Substitution T C
168541 168541 Substitution C G
168465 168465 Substitution C G
168442 168442 Substitution T G
168368 168368 Substitution C A
The systematic sequence was updated in the region encompassing features tQ(UUG)C and YCRWdelta11. Note that coordinates listed are chromosomal coordinates.
Old:   168363 CAGTCCTCAAACCTAATGGAAGCGAAATGCAGGGATTGATAATGTAATAAGATAATGAAA 168422
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   169664 CAGTCATCAAACCTAATGGAAGCGAAATGCAGGGATTGATAATGTAATAAGATAATGAAA 169723
Old:   168423 CATAAGAAACAGAAGGTAGTAGTATTATTATGTAGAAATACCCATTCCATTTTAAGGATT 168482
              ||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||
New:   169724 CATAAGAAACAGAAGGTAGGAGTATTATTATGTAGAAATACCGATTCCATTTTAAGGATT 169783
Old:   168483 CCTATGTCCTCGAGTAGAACGTCTAGTATATACGAAATATTATACCCTTTAAAAAACACT 168542
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
New:   169784 CCTATGTCCTCGAGTAGAACGTCTAGTATATACGAAATATTATACCCTTTAAAAAACAGT 169843
Old:   168663 CTGATCTCCCAATGAAGAATTGTGTCAGGTCATCTCGTCCTCAATTTCTAACCAAAATTG 168722
              ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||
New:   169964 CTGATCTCCCAATGAAGAACTGCGTCAGGTCATCTCGTCCTCAATTTCTAACCAAAATTG 170023
Old:   168783 CACAACACGGTAAACCAACTTGTGTCATATTTAAGAGAAATATTAAAACGCTAAGAAGAT 168842
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   170084 CACAGCACGGTAAACCAACTTGTGTCATATTTAAGAGAAATATTAAAACGCTAAGAAGAT 170143
Old:   168843 AGCTCCCATAATAGAAGTACAAGTTATATTTATCGTTGCCCAACTGCAGAAGTTAAATAA 168902
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:   170144 AGCTCCCATAATAGAAGTACAAGTTATATTTATCGTTGTCCAACTGCAGAAGTTAAATAA 170203
2000-09-13 YCRWdelta11, tQ(UUG)C 169454 169454 Substitution G A
169337 169337 Substitution G C
169259 169259 Substitution T C
169250 169250 Substitution G A
169110 169110 Insertion A
169071 169071 Substitution G A
168967 168967 Substitution C T
168933 168933 Insertion A
The systematic sequence was updated in the region encompassing features tQ(UUG)C and YCRWdelta11. Note that coordinates listed are chromosomal coordinates.
Old:   168903 AGGTAAATAAATCGAGCTAAGAGAAAAAAAA-GTATAGGCAAAATTCCGACCGGAGCTAG 168961
              ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
New:   170204 AGGTAAATAAATCGAGCTAAGAGAAAAAAAAAGTATAGGCAAAATTCCGACCGGAGCTAG 170263
Old:   168962 CTTTACCTTGCTCCTCCACCTAAGTCACCTGCTCAGGTCACTCAAGTTCACAATCTTCTG 169021
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   170264 CTTTATCTTGCTCCTCCACCTAAGTCACCTGCTCAGGTCACTCAAGTTCACAATCTTCTG 170323
Old:   169022 AGAGGATAGATAAAGGAAAAATTGGAACAGATCTTTTCATGGCCTGGCAGTTGTCTGTGG 169081
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   170324 AGAGGATAGATAAAGGAAAAATTGGAACAGATCTTTTCATGGCCTGGCAATTGTCTGTGG 170383
Old:   169082 ATTGGTAAAGCTCTGTCAGTGAAAAAAAA-GTTCTCGCTCCTTCTTGGTCTCTTCTATTT 169140
              ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New:   170384 ATTGGTAAAGCTCTGTCAGTGAAAAAAAAAGTTCTCGCTCCTTCTTGGTCTCTTCTATTG 170443
Old:   169201 ATAATCTTGAAATTTGAAGTTTCTAAAATGCATCAGACATGGTGTCGTAGTTAGTTGATT 169260
              ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
New:   170504 ATAATCTTGAAATTTGAAGTTTCTAAAATGCATCAGACATGGTGTCGTAATTAGTTGACT 170563
Old:   169321 AAAATACTTACTAAACGTTTTCGAATAAGTTAGCAAGAAGCTTTTAAAAACATAGACTTA 169380
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
New:   170624 AAAATACTTACTAAACCTTTTCGAATAAGTTAGCAAGAAGCTTTTAAAAACATAGACTTA 170683
Old:   169441 TGCATGATGAAAAGCTAAGTAGACCTCTTTAGAAGTGTCTTAGCGGCTATTGTTCATGAT 169500
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
New:   170744 TGCATGATGAAAAACTAAGTAGACCTCTTTAGAAGTGTCTTAGCGGCTATTGTTCATGAT 170803
2000-09-13 tN(GUU)C 127750 127750 Insertion C
The systematic sequence was updated in the region encompassing feature tN(GUU)C. Note that coordinates listed are chromosomal coordinates.
Old:   127693 CTTTACTTGGAGTTTCGATTTTAAGAATTTTTTATCATTTTTTTTTTTTGACGATTTC-T 127751
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
New:   128086 CTTTACTTGGAGTTTCGATTTTAAGAATTTTTTATCATTTTTTTTTTTTGACGATTTCCT 128145
2000-09-13 YCR016W, tG(GCC)C 143330 143330 Substitution T C
143280 143281 Substitution GG CA
143021 143021 Substitution A G
The systematic sequence was updated in the intergenic region between features tG(GCC)C and YCR016W. Note that coordinates listed are chromosomal coordinates.
Old:   143002 GCAAACGCTTTTGTTATTGAGAACAGGAATACCAACCGTTCTCATGGAAAATAGCAAAGT 143061
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
New:   143291 GCAAACGCTTTTGTTATTGGGAACAGGAATACCAACCGTTCTCATGGAAAATAGCAAAGT 143350
Old:   143242 GAAAAGAGATGAGCTAAATTCAAATATCAAAGTACTGTGGTAAGTGCTTTCTTTATCGAC 143301
              ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||
New:   143531 GAAAAGAGATGAGCTAAATTCAAATATCAAAGTACTGTCATAAGTGCTTTCTTTATCGAC 143590
Old:   143302 AAATTACAAGCAGAAGAAACATTCACTTTACAATTAAATGTCCGAAAATCACGTTCCTGC 143361
              |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
New:   143591 AAATTACAAGCAGAAGAAACATTCACTTCACAATTAAATGTCCGAAAATCACGTTCCTGC 143650
2000-09-13 YCLCdelta1, tE(UUC)C 82662 82662 Insertion GTTGGAATAGAAATCAACTATCATC TACTAACTAGTATTTACATTACTAG TATATTATCATATACGGTGTTAGAA GATGACGCAAATGATGAGAAATAGT CATCTAAATTAGTGGAAGCTGAAAC GCAAGGATTGATAATGTAATAGGAT CAATGAATATAAACATATAAAACGG AATGAGGAATAATCGTAATATTAGT ATGTAGAAATATAGATTCCATTTTG AGGATTCCTATATCCTCGAGGAGAA CTTCTAGTATATTCTGTATACCTAA TATTATAGCCTTTATCAACAATGGA ATCCCAACAATTATCTCAACATTCA CCCATTTCTCAAGTACT
A large insertion was made in the systematic sequence in the intergenic region between tRNA-Glu and YCLCdelta1. The following sequence was inserted after the TAAAATATTTCCTCTTTAGTACT ending at 82662:

GTTGGAATAGAAATCAACTATCATCTACTAACTAGTATTTACATTACTAG TATATTATCATATACGGTGTTAGAAGATGACGCAAATGATGAGAAATAGT CATCTAAATTAGTGGAAGCTGAAACGCAAGGATTGATAATGTAATAGGAT CAATGAATATAAACATATAAAACGGAATGAGGAATAATCGTAATATTAGT ATGTAGAAATATAGATTCCATTTTGAGGATTCCTATATCCTCGAGGAGAA CTTCTAGTATATTCTGTATACCTAATATTATAGCCTTTATCAACAATGGA ATCCCAACAATTATCTCAACATTCACCCATTTCTCAAGTACT

2000-09-13 snR43 107612 107612 Insertion G
107595 107595 Deletion T
107522 107522 Insertion A
The systematic sequence was updated in the region encompassing feature snR43. Note that coordinates listed are chromosomal coordinates.
Old:   107467 TTTAAAGTAATTTCTTCTTTTTTTATAGTGAGAAATCTCAAAAGAAAAAAAAAAAA-TAA 107525
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
New:   107852 TTTAAAGTAATTTCTTCTTTTTTTATAGTGAGAAATCTCAAAAGAAAAAAAAAAAAATAA 107911
Old:   107586 TCAGCAACTTGTAGGAGGAGAAAGCAG-TATATAACTAGCCGCAATATGTTTGTGGTGGA 107644
              ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||
New:   107972 TCAGCAACT-GTAGGAGGAGAAAGCAGGTATATAACTAGCCGCAATATGTTTGTGGTGGA 108030
2000-09-13 YCRWdelta11 169686 169686 Substitution C T
169575 169575 Substitution T C
The systematic sequence was updated in the region encompassing feature YCRWdelta11. Note that coordinates listed are chromosomal coordinates.
Old:   169561 AGAATCGAATGTATTTATCGGAAAGGATTTGAAATTTCGGCCATTTCCTCATTATGAAGT 169620
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   170864 AGAATCGAATGTATCTATCGGAAAGGATTTGAAATTTCGGCCATTTCCTCATTATGAAGT 170923
Old:   169681 TCTTCCCCGGGCATGTCATTAGCATCTATATAAGGAACCTGTTTCTTAGACAAATTCTCT 169740
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   170984 TCTTCTCCGGGCATGTCATTAGCATCTATATAAGGAACCTGTTTCTTAGACAAATTCTCT 171043
2000-09-13 YCL022C, YCL024W 81861 81861 Insertion C
One sequence change was made in the systematic sequence in the region encompassing overlapping features YCL024W and YCL022C. Note that coordinates listed are chromosomal coordinates.
Old:   81841 ATAACGACACAGTGAATGCCC-TACTACAGTAAAAAAGCCACCTAACAGCGTACTCTT 81897
             ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   81877 ATAACGACACAGTGAATGCCCCTACTACAGTAAAAAAGCCACCTAACAGCGTACTCTT 81934
2000-09-13 YCL019W, YCL020W 86316 86316 Substitution A T
86092 86093 Substitution CG GC
85235 85235 Substitution T A
Several sequence changes were made in the systematic sequence in the region encompassing overlapping features YCL019W and YCL020W. Note that coordinates listed are chromosomal coordinates.
Old:   85213 CACCACACACTTTAACATCAGATGAAAACTTTTCTACATGGGTTAAATTTTACATCAGAT 85272
             |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
New:   85600 CACCACACACTTTAACATCAGAAGAAAACTTTTCTACATGGGTTAAATTTTACATCAGAT 85659
Old:   86053 AATGACGAACTACCTGATCACCTTCTTATTGATTCAGGACGTTCGCAAACGCTTGTCAGA 86112
             |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||
New:   86440 AATGACGAACTACCTGATCACCTTCTTATTGATTCAGGAGCTTCGCAAACGCTTGTCAGA 86499
Old:   86293 GAGCTGGCTAATCAAAATATTACAGCCTGCTTTACCAGAAACACTTTAGAAAGATCGGAT 86352
             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   86680 GAGCTGGCTAATCAAAATATTACTGCCTGCTTTACCAGAAACACTTTAGAAAGATCGGAT 86739
2000-09-13 YCL019W 89727 89727 Substitution G A
89452 89452 Deletion C
89442 89442 Insertion C
87159 87161 Deletion CGC
86598 86599 Substitution AT TA
Several sequence changes were made in the systematic sequence in the region encompassing feature YCL019W. Note that coordinates listed are chromosomal coordinates.
Old:   86593 AACGCATGCACATATCAATGTCCTGACTGTCTAATCGGCAAAAGCACGAAACATAGACAT 86652
             |||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   86980 AACGCTAGCACATATCAATGTCCTGACTGTCTAATCGGCAAAAGCACGAAACATAGACAT 87039
Old:   87133 GTCTCACCAAAAAACGATAAATCCGCCGCAAGACAACATGCAGGTTTAGCTGGACTGGAC 87192
             ||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||
New:   87520 GTCTCACCAAAAAACGATAAATCCGC---AAGACAACATGCAGGTTTAGCTGGACTGGAC 87576
Old:   89413 AGATTTGACTTACTATACTACATCAACACA-TTGCTCAACCATATACTATTCCCCTCTAG 89471
             |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||
New:   89797 AGATTTGACTTACTATACTACATCAACACACTTGCTCAAC-ATATACTATTCCCCTCTAG 89855
Old:   89712 AGCAGAAATACACGCGGTCAGTGAAGCTATTCCGCTATTGAATAACCTCAGTCACCTTGT 89771
             ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
New:   90096 AGCAGAAATACACGCAGTCAGTGAAGCTATTCCGCTATTGAATAACCTCAGTCACCTTGT 90155
2000-09-13 YCL018W 91985 91985 Substitution G C
91144 91144 Substitution T C
91106 91106 Substitution C T
Three single nucleotide sequence changes were made in the systematic sequence within ORF YCL018W. Note that coordinates listed are chromosomal coordinates.
Old:   91092 GATGCTACAGGTGTCCCACTTCCAGATGAGGCGCTGGAAGCCTCCAAGAAGGTTGATGCC 91151
             |||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||
New:   91476 GATGCTACAGGTGTTCCACTTCCAGATGAGGCGCTGGAAGCCTCCAAGAAGGCTGATGCC 91535
Old:   91932 GTTTTGGATGCAGGTATCAGAACTGGTGATTTAGGTGGTTCCAACAGTACCACGGAAGTC 91991
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
New:   92316 GTTTTGGATGCAGGTATCAGAACTGGTGATTTAGGTGGTTCCAACAGTACCACCGAAGTC 92375
2000-09-13 YCL017C 94143 94143 Deletion A
94140 94141 Substitution AT TA
94104 94104 Deletion C
93964 93964 Insertion C
93438 93438 Substitution A G
A single nucleotide substitution was made in the systematic sequence within the ORF YCL017C. Several sequence changes were also made in the region upstream of YCL017C. Note that coordinates listed are chromosomal coordinates.

Within YCL017C

Old:   93432 CTACGTAAGCTCTAGCATTTTCCACAGCAGTATTTGTTTCCCAACCGTAAGAGTGAGTGT 93491
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   93816 CTACGTGAGCTCTAGCATTTTCCACAGCAGTATTTGTTTCCCAACCGTAAGAGTGAGTGT 93875
Upstream of YCL017C
Old:   93912 TATGCGATATATTTTAATGAAAATGATGTATCTGAAATAGAAAATATAACACA-TAATGA 93970
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
New:   94296 TATGCGATATATTTTAATGAAAATGATGTATCTGAAATAGAAAATATAACACACTAATGA 94355
Old:   94091 GGTAATAGGGTGCCATAATAGTATTGTAATATATATAAATATATAAAGCATCATATGATA 94150
             ||||||||||||| |||||||||||||||||||||||||||||||||||  | |||||||
New:   94476 GGTAATAGGGTGC-ATAATAGTATTGTAATATATATAAATATATAAAGCTAC-TATGATA 94533
2000-09-13 YCL016C 95200 95200 Deletion G
A sequence change was made in the systematic sequence in the region encompassing feature YCL016C, and the start of YCL016C was moved 213 nt upstream, extending the protein N-terminally by 71 amino acids. Note that coordinates listed are chromosomal coordinates.
Old:   95171 AGAACTGTGTTTGAATGTTTGCGCTGCTTGCAGCACCCAAGTCTTGTCGTGCGAACACAG 95230
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New:   95554 AGAACTGTGTTTGAATGTTTGCGCTGCTT-CAGCACCCAAGTCTTGTCGTGCGAACACAG 95612
2000-09-13 YCL012W, YCL014W 100016 100016 Deletion C
99907 99907 Insertion C
97118 97118 Substitution C G
96751 96751 Substitution C A
Several sequence changes were made in the systematic sequence in the region encompassing feature YCL014W, resulting in the merge of ORF YCL012W into YCL014W. Note that coordinates listed are chromosomal coordinates.
Old:   96731 CAATTTGGTAGAATTTTTGCCAAAATTCCTGATCGCCTTGAGAGTCAGAGTACTCAATGA 96790
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
New:   97113 CAATTTGGTAGAATTTTTGCAAAAATTCCTGATCGCCTTGAGAGTCAGAGTACTCAATGA 97172
Old:   97091 ACCTCAGGAAAAACTACTGAAGCTAAACTTAATTATAGAGAGATTGTGGAAGTCGAAAAA 97150
             ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
New:   97473 ACCTCAGGAAAAACTACTGAAGCTAAAGTTAATTATAGAGAGATTGTGGAAGTCGAAAAA 97532
Old:    99851 TGACAAATTCTTCGAAATTGAAGAAGAACTTAAGGAAGAATTGAAGGGCAGCAAAAC-GG 99909
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   100233 TGACAAATTCTTCGAAATTGAAGAAGAACTTAAGGAAGAATTGAAGGGCAGCAAAACCGG 100292
Old:    99970 AGCATTCAAAGTTATTAGAACATCGCCTGTGAGAATTATCGGAAGGCACTTTTGAAGACA 100029
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:   100353 AGCATTCAAAGTTATTAGAACATCGCCTGTGAGAATTATCGGAAGG-ACTTTTGAAGACA 100411
2000-09-13 YCL011C 101542 101542 Substitution A T
101506 101506 Insertion T
101485 101485 Insertion A
Several sequence changes were made in the systematic sequence in the region downstream of feature YCL011C. Note that coordinates listed are chromosomal coordinates.
Old:   101470 ATATTCAGTTTAGAAT-CCCTTTTTTTTTTTTTTTTTT-CTTCGCTTTTCGCATCTCATC 101527
              |||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||
New:   101852 ATATTCAGTTTAGAATACCCTTTTTTTTTTTTTTTTTTTCTTCGCTTTTCGCATCTCATC 101911
Old:   101528 GCTGGAAGTGGTGCACTTTTACAGGGATTAAATAAGGTTATTCTTTTTGGTCAAAATGAT 101587
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   101912 GCTGGAAGTGGTGCTCTTTTACAGGGATTAAATAAGGTTATTCTTTTTGGTCAAAATGAT 101971
2000-09-13 YCL009C, YCL010C 104419 104419 Substitution T C
The systematic sequence was updated within ORF YCL009C. Note that coordinates listed are chromosomal coordinates.
Old:   104408 TTTGCAGACAATTCCACAATACAGCTTGTTTCGCTGATGTCGACGACACGACCTCCAAAG 104467
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   104792 TTTGCAGACAACTCCACAATACAGCTTGTTTCGCTGATGTCGACGACACGACCTCCAAAG 104851
2000-09-13 YCL008C, YCL009C 105585 105585 Insertion T
The systematic sequence was updated in the intergenic region between features YCL009C and YCL008C. Note that coordinates listed are chromosomal coordinates. This change is the exact reciprocal of the sequence change made on 1998-02-26.
Old:   105548 GTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGT-CAGGACGTCTATCTGTGCGTT 105606
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:   105932 GTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGTTCAGGACGTCTATCTGTGCGTT 105991
2000-09-13 YCL005W 108457 108457 Substitution G C
108385 108385 Deletion A
107780 107780 Insertion G
107769 107769 Insertion G
107767 107767 Insertion G
107745 107745 Insertion G
107739 107739 Deletion A
The systematic sequence was updated in the region encompassing feature YCL005W, and at the same time the stop site for YCL005W was moved 6 nucleotides downstream, increasing the length of the coding region from 765 to 771 nt. Note that coordinates listed are chromosomal coordinates.
Old:   107705 GCCTTTATCAATTTTCGTATGGAATGGGTTTCAGACTTGTG-CATTGCCTATCAACATCC 107763
              |||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||
New:   108091 GCCTTTATCAATTTTCGTATGGAATGGGTTTCAG-CTTGTGGCATTGCCTATCAACATCC 108149
Old:   107764 CATT-AG-TTGTTCCTGGG-ACGTCGCTGAGCCGTTTAGTTGCACAAACAAGCACATTAG 107820
              |||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||
New:   108150 CATTGAGGTTGTTCCTGGGGACGTCGCTGAGCCGTTTAGTTGCACAAACAAGCACATTAG 108209
Old:   108361 TCGTTAATATAAAGATTTTACGAAAGGAATTCTAGGTGATATTGCAATTACTTCTTCTCA 108420
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
New:   108750 TCGTTAATATAAAGATTTTACGAA-GGAATTCTAGGTGATATTGCAATTACTTCTTCTCA 108808
Old:   108421 TGCACTAACAAGTGAATGATAGAAATATGTTGAGTTGCTAACTGCCTGATTTTAAATAAG 108480
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   108809 TGCACTAACAAGTGAATGATAGAAATATGTTGAGTTCCTAACTGCCTGATTTTAAATAAG 108868
2000-09-13 YCL004W 110557 110557 Deletion A
110330 110331 Substitution GA AG
110286 110286 Insertion TCTAT
110100 110100 Insertion G
109996 109996 Deletion C
109930 109930 Deletion C
The systematic sequence was updated in the region encompassing feature YCL004W. Note that coordinates listed are chromosomal coordinates.
Old:   109921 TGCTATTACCATTAAGAGAATGGCAAAGAGGCGTAGTAAATAAGCCGAATGGTTGGTCAT 109980
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
New:   110309 TGCTATTAC-ATTAAGAGAATGGCAAAGAGGCGTAGTAAATAAGCCGAATGGTTGGTCAT 110367
Old:   109981 ATCACGCAAAAGGTACTTTGGCTTTCCGCTCGTGATAAAAATGATGCTAACAATTGGAAA 110040
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
New:   110368 ATCACGCAAAAGGTA-TTTGGCTTTCCGCTCGTGATAAAAATGATGCTAACAATTGGAAA 110426
Old:   110101 -AATCGAATGCTCTCATTATTACAAGAGATGAAGAGCTAAGAAAAAAAATGAAAGCAGAG 110159
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   110487 GAATCGAATGCTCTCATTATTACAAGAGATGAAGAGCTAAGAAAAAAAATGAAAGCAGAG 110546
Old:   110280 ATTCTAT-----CATAGTATGTCGCCTGTAAATATGGAAAAATAAAAGAAAAAATGATAA 110334
              |||||||     |||||||||||||||||||||||||||||||||||||||||||  |||
New:   110667 ATTCTATTCTATCATAGTATGTCGCCTGTAAATATGGAAAAATAAAAGAAAAAATAGTAA 110726
Old:   110515 AGGGCGTTGAATTAAATGGTATCTCGTAAAACAATGCATTGGATCGGTATTACCAGTCTA 110574
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
New:   110907 AGGGCGTTGAATTAAATGGTATCTCGTAAAACAATGCATTGG-TCGGTATTACCAGTCTA 110965
2000-09-13 YCL002C 111325 111325 Deletion C
The systematic sequence was updated in the region encompassing feature YCL002C. Note that coordinates listed are chromosomal coordinates.
Old:   111295 TAATTGCTTCGCAGGGCTCCTCAACCTCTCCTCTGGAAAACCTTACCTCAATGAGGTTAA 111354
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New:   111686 TAATTGCTTCGCAGGGCTCCTCAACCTCTC-TCTGGAAAACCTTACCTCAATGAGGTTAA 111744
2000-09-13 YCL001W-A, YCL001W-B 113232 113232 Insertion AG
The systematic sequence was updated in the region between YCL001W-A and YCL001W-B. Note that coordinates listed are chromosomal coordinates.
Old:   113215 AGAAGGAGCAAATAAGCC--TTTTAAGGAACCGAGATAAGCTGTTTTCGCCCATTGTTCT 113272
              ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||
New:   113605 AGAAGGAGCAAATAAGCCAGTTTTAAGGAACCGAGATAAGCTGTTTTCGCCCATTGTTCT 113664
2000-09-13 YCR061W 225653 225673 Substitution AAATTCTCACCGGCCCCAAGG CGCGTTTATGTTCATAGGAACCGGA T
The systematic sequence was updated in the region encompassing ORF YCR061W. Note that coordinates listed below are chromosomal coordinates.
Old:   225625 CTGCCAAGGATTTACAGCATGTGTCGATAAA-TTC-T---CACCGGCCCCAAGGTGTGTG 225679
              ||||||||||||||||||||||||||||    ||  |   ||  ||  ||    ||||||
New:   226888 CTGCCAAGGATTTACAGCATGTGTCGATCGCGTTTATGTTCATAGGAACCGGATTGTGTG 226947
2000-09-13 YCR060W 223942 223942 Substitution C T
The systematic sequence was updated downstream of ORF YCR060W. Note that coordinates listed below are chromosomal coordinates.
Old:   223885 TGTATTGGCAACTAACGGAACTAAGGCAACATATCTTGCATATTGCAATGTTCACTACAT 223944
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   225148 TGTATTGGCAACTAACGGAACTAAGGCAACATATCTTGCATATTGCAATGTTCACTATAT 225207
2000-09-13 YCR057C, YCR059C 222085 222085 Insertion T
The systematic sequence was updated in the region between features YCR057C and YCR059C. Note that coordinates listed are chromosomal coordinates.
Old:   222026 TATTGATATTATACTAGTTATTGTACATACCTAGAACTATACTCGAAACTTTTTTTTTTT 222085
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   223288 TATTGATATTATACTAGTTATTGTACATACCTAGAACTATACTCGAAACTTTTTTTTTTT 223347
Old:   222086 -CATCTTTCAGCTCATCGCAAAATTTTTCCAAAAAATTTCAAAAAGAACTCCCGTCGCAT 222144
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   223348 TCATCTTTCAGCTCATCGCAAAATTTTTCCAAAAAATTTCAAAAAGAACTCCCGTCGCAT 223407
2000-09-13 YCR054C, YCR057C 219173 219173 Substitution G A
The systematic sequence was updated in the region betweeen ORFs YCR054C and YCR057C. Note that coordinates listed below are chromosomal coordinates. Note also that this same change was made on 1997-07-27, but changed back to its original state on 1998-02-26, so that this current change restores one originally made on 1997-07-27.
Old:   219146 CATGATGTGAATGTGCATAAATAGAGGGCAGTGAATATTTTTCAAGGAAGCTCTTTCTCA 219205
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
New:   220408 CATGATGTGAATGTGCATAAATAGAGGACAGTGAATATTTTTCAAGGAAGCTCTTTCTCA 220467
2000-09-13 YCR079W 252912 252912 Insertion G
252844 252844 Insertion C
252813 252813 Insertion G
The systematic sequence was updated within ORF YCR079W, causing frameshifts leading to a C-terminally altered and extended protein from amino acid 415 onward. The annotated coding region has been extended from 1308 nt to 1329 nt. Note that coordinates listed below are chromosomal coordinates.
Old:   252792 GTGGTTAGGCTTTCCAATTGGG-CAACTGGCCCAATGTTGACAGAACTGGCCCC-AAAGA 252849
              |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||
New:   254059 GTGGTTAGGCTTTCCAATTGGGGCAACTGGCCCAATGTTGACAGAACTGGCCCCCAAAGA 254118
A single nucleotide insertion has also been made immediately downstream of the newly-extended YCR079W coding region.
Old:   252910 GTG-AAACAAGTCCTAGATAATCATCTTTTGTATTTTTTTTCTTCCTTTTATTAGTATGT 252968
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   254179 GTGGAAACAAGTCCTAGATAATCATCTTTTGTATTTTTTTTCTTCCTTTTATTAGTATGT 254238
2000-09-13 YCR077C 250109 250111 Deletion AAG
249242 249242 Insertion T
249237 249237 Deletion G
The systematic sequence was updated within ORF YCR077C. As a result, the annotated stop site was moved 1 codon upstream, reducing the length of the coding region from 2394 nt to 2391 nt. Note that coordinates listed are chromosomal coordinates.
Old:   249193 TGGTGGTTTAGCTTTCCACTTAGTGCTAAACTAGCTAGGAACTGGCCAAA-GTATGCTTC 249251
              |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||
New:   250463 TGGTGGTTTAGCTTTCCACTTAGTGCTAAACTAGCTAGGAACTG-CCAAATGTATGCTTC 250521
Old:   250092 CGCATCGGGGTCAGAAGAAGGCTGTTGTCTGGGGATCTGCAGTTGTCTTCTTGGATTCTT 250151
              |||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||
New:   251362 CGCATCGGGGTCAGAAG---GCTGTTGTCTGGGGATCTGCAGTTGTCTTCTTGGATTCTT 251418
2000-09-13 YCR073W-A, YCR075C 246726 246726 Insertion AT
The systematic sequence was updated in the region between ORFs YCR073W-A and YCR075C. Note that coordinates listed are chromosomal coordinates.
Old:   246675 ACATACATACATATATTTATGTATATTTATGTATATATATATATATATATAT--GCGTAA 246732
              ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
New:   247943 ACATACATACATATATTTATGTATATTTATGTATATATATATATATATATATATGCGTAA 248002
2000-09-13 YCR073W-A 246199 246199 Substitution T C
The systematic sequence was updated in the region encompassing ORF YCR073W-A. Note that coordinates listed below are chromosomal coordinates.
Old:   246195 TGCGTTGATAACTATGAAAAGGTGCTAATCCGCGGGTTTGCCGGTAGAGATTCCGTCAAA 246254
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   247463 TGCGCTGATAACTATGAAAAGGTGCTAATCCGCGGGTTTGCCGGTAGAGATTCCGTCAAA 247522
2000-09-13 YCR073C 241455 241455 Deletion G
The systematic sequence was updated within ORF YCR073C. As a result, YCR073C was extended at the 3' end, so that the coding region increased in length from 3945 nt to 3996 nt. Note that coordinates listed below are chromosomal coordinates.
Old:   241395 GTAGTTCCACAGCAGTAGCCCTCATAGTGGGGTCTTGAACCAAACACCTTTCCAAGAAGG 241454
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   242664 GTAGTTCCACAGCAGTAGCCCTCATAGTGGGGTCTTGAACCAAACACCTTTCCAAGAAGG 242723
Old:   241455 GCTCTTCCCGCTGCAGTCATTTCGTCTCTATTGGGTAGTTGCGGTATTCGACCTGCAGCA 241514
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   242724 -CTCTTCCCGCTGCAGTCATTTCGTCTCTATTGGGTAGTTGCGGTATTCGACCTGCAGCA 242782
2000-09-13 YCR071C, YCR072C 239746 239746 Substitution T C
239394 239394 Insertion C
The systematic sequence was updated in the region between ORFs YCR071C and YCR072C. Note that coordinates listed below are chromosomal coordinates.
Old:   239356 TGCTTATAGTACCATATTTTAAATTCATACCAAGCCATT-GTACGCGATGACCATTATAG 239414
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   240624 TGCTTATAGTACCATATTTTAAATTCATACCAAGCCATTCGTACGCGATGACCATTATAG 240683
The systematic sequence was updated within ORF YCR072C. Note that coordinates listed below are chromosomal coordinates.
Old:   239715 GATGACCACGCAACCTGGTATACGCTGGCTATATGCCCTCTAAATGTGGAGATAAACTTA 239774
              ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
New:   240984 GATGACCACGCAACCTGGTATACGCTGGCTACATGCCCTCTAAATGTGGAGATAAACTTA 241043
2000-09-13 YCR071C 238910 238910 Insertion A
The systematic sequence was updated within ORF YCR071C. One nucleotide was inserted causing a frameshift, leading to a C-terminally altered and elongated protein from amino acid 120 onward. The annotated coding region has been increased in length from 366 nt to 441 nt. Note that coordinates listed are chromosomal coordinates.
Old:   238877 TTGATAATAATTTTTTTCGATTGCATCACCACAG-CCATGATTTTTTGGGTATGAAAGGC 238935
              |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
New:   240144 TTGATAATAATTTTTTTCGATTGCATCACCACAGACCATGATTTTTTGGGTATGAAAGGC 240203
2000-09-13 YCR068W 236904 236904 Insertion C
The systematic sequence was updated within ORF YCR068W. Due to the single nucleotide insertion and resulting frameshift, the annotated stop site of YCR068W was moved downstream, increasing the length of the coding region from 1290 nt to 1563 nt. This annotation change incorporates the area that some had originally referred to as YCR068W-A into YCR068W. ORF YCR068W-A was originally included in the annotation data collected by MIPS on behalf of the European Yeast Chromosome III Sequencing project (see GenBank accession X59720). However, YCR068W-A was never included in SGD as an independent ORF. Note that coordinates listed are chromosomal coordinates.
Old:   236898 AATACCC-GATGCGGCCATATGGGTCACAGGCCACTCACTGGGAGGCGCATTGGCCAGTT 236956
              ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   238164 AATACCCCGATGCGGCCATATGGGTCACAGGCCACTCACTGGGAGGCGCATTGGCCAGTT 238223
2000-09-13 YCR067C, YCR068W 235515 235515 Deletion T
235421 235421 Insertion C
The systematic sequence was updated in the region between ORFs YCR067C and YCR068W. Note that coordinates listed below are chromosomal coordinates.
Old:   235399 AATCGTAAATACATAGGCTGGGC-ATATACACTAACATGTGTCGTGACCAATGTGCAGCA 235457
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   236665 AATCGTAAATACATAGGCTGGGCCATATACACTAACATGTGTCGTGACCAATGTGCAGCA 236724
Old:   235458 GATAGACTTGCTCATTAAATATATTCCAGGTAGGATTCTCTAAGGGTTTTTTTTTTTTCT 235517
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   236725 GATAGACTTGCTCATTAAATATATTCCAGGTAGGATTCTCTAAGGGTTTTTTTTTTT-CT 236783
2000-09-13 YCR065W 230014 230014 Deletion T
229749 229749 Deletion T
The systematic reference sequence of Chromosome III was updated in the region downstream of ORF YCR065W.
Old:   229699 TCCAACGATAGCGGTAATGAAAAGAATTGACTTTTTTTTTTTTTTTTTTTTCATTTTCTT 229758
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:   230967 TCCAACGATAGCGGTAATGAAAAGAATTGACTTTTTTTTTTTTTTTTTTT-CATTTTCTT 231025
Old:   229999 CATATCTTTATTTTTTGATCCTTACGGATTTTTAATACAGTATTTAGCTGAAGTTTCCAT 230058
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
New:   231266 CATATCTTTATTTTT-GATCCTTACGGATTTTTAATACAGTATTTAGCTGAAGTTTCCAT 231324
2000-09-13 YCR063W, YCR065W 227805 227805 Insertion C
The systematic sequence was updated in the region between ORFs YCR063W and YCR065W. Note that coordinates listed are chromosomal coordinates.
Old:   227780 AATCAAAAAATTACTTCTTCTCCTCC-TTACGGTGCCCTTTGATCCTTCTCAAACTTTAA 227838
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New:   229048 AATCAAAAAATTACTTCTTCTCCTCCCTTACGGTGCCCTTTGATCCTTCTCAAACTTTAA 229107
2000-09-13 YCR065W 229501 229501 Deletion A
The systematic sequence was updated within ORF YCR065W. Note that coordinates listed below are chromosomal coordinates. As a result, the annotated stop site of YCR065W has been moved downstream, increasing the size of the coding region from 1599 nt to 1695 nt.
Old:   229459 CTATAGAGACTCCAATCAGGTATATCACGACGCCGGGGGGCAACTTTGGAAACCCAAATT 229518
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
New:   230728 CTATAGAGACTCCAATCAGGTATATCACGACGCCGGGGGGCA-CTTTGGAAACCCAAATT 230786
2000-09-13 TEL03L 838 838 Insertion AC
814 814 Insertion A
786 786 Insertion C
784 784 Insertion C
783 783 Insertion C
770 770 Insertion C
459 459 Substitution G C
Several sequence changes were made in the systematic sequence in the region encompassing TEL03L. Note that coordinates listed below are chromosomal coordinates.
Old:     421 CTCTCCATTACCCTACCTCTCCACTCGTTACCCTGTCTGATTCAACCGTACCACTCCCAA 480
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:     421 CTCTCCATTACCCTACCTCTCCACTCGTTACCCTGTCTCATTCAACCGTACCACTCCCAA 480
Old:     721 ATCGGTCATACGCACACGGATGCTACAGTATATACCATCTCAAACTTACC-TACTTTCAT 779
             |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:     721 ATCGGTCATACGCACACGGATGCTACAGTATATACCATCTCAAACTTACCCTACTTTCAT 780
Old:     780 ATTC-A-TC-ATCACCCATCTCTCACCATCAGTACCAA-TGCACTCGCATCATTATGCAC 835
             |||| | || |||||||||||||||||||||||||||| |||||||||||||||||||||
New:     781 ATTCCACTCCATCACCCATCTCTCACCATCAGTACCAAATGCACTCGCATCATTATGCAC 840
Old:     836 GGC--TTGCCTCAGCGGTCTATACCCTGTGCCATTTACGCATAACGCCCATCATTATCCA 893
             |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:     841 GGCACTTGCCTCAGCGGTCTATACCCTGTGCCATTTACGCATAACGCCCATCATTATCCA 900
2000-09-13 ARS310
166780 166780 Substitution A G
166754 166755 Deletion AG
166730 166730 Deletion A
The systematic sequence was updated in the region encompassing feature ARS310. Note that coordinates listed are chromosomal coordinates.
Old:   166701 CTTAGGTACAAAAAGATTAAGAAAGTCAAATTGTCCTTAGTTTTAAAAGACAGAGTTACT 166760
              ||||||||||||||||||||||||||||| |||||||||||||||||||||||  |||||
New:   166982 CTTAGGTACAAAAAGATTAAGAAAGTCAA-TTGTCCTTAGTTTTAAAAGACAG--TTACT 167038
Old:   166761 TCATGTCTTTAACATCAACAGCAAATTACTTTGAAAAAATGCACTAAAAGTTAACACATG 166820
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
New:   167039 TCATGTCTTTAACATCAACGGCAAATTACTTTGAAAAAATGCACTAAAAGTTAACACATG 167098
2000-09-13 ARS306
74317 74317 Substitution G A
74306 74306 Substitution C G
74298 74298 Substitution A C
74045 74045 Substitution C T
73973 73973 Substitution C T
73948 73948 Deletion C
73729 73729 Insertion G
74173 74173 Substitution T C
Several sequence changes were made in the systematic sequence in the region upstream of ARS306. Note that coordinates listed are chromosomal coordinates.
Old:   73691 CTCATCCCTTGCTGAAGCAGGCCTCTTTTGACCGGCAGG-CTTTCTATAGCCTTAGTCAC 73749
             ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   73720 CTCATCCCTTGCTGAAGCAGGCCTCTTTTGACCGGCAGGGCTTTCTATAGCCTTAGTCAC 73779
Old:   73930 TTTCAAATAAGTTGCAACCAGCAGACATGATATTGGATTGTTTCTTTGTATATATGTTGA 73989
             |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||
New:   73960 TTTCAAATAAGTTGCAAC-AGCAGACATGATATTGGATTGTTTTTTTGTATATATGTTGA 74018
Old:   73990 TATAGGATACTTCAGTCTACGAAAAAAGTACAAATTATGTAGTCAGTTCCTTCAGCATGG 74049
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
New:   74019 TATAGGATACTTCAGTCTACGAAAAAAGTACAAATTATGTAGTCAGTTCCTTCAGTATGG 74078
Old:   74170 TTTTTCGAATAATCATTAGTAAAAGCGGTATACTGGATTATTGTACGATAACAAGGTAGA 74229
             ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   74199 TTTCTCGAATAATCATTAGTAAAAGCGGTATACTGGATTATTGTACGATAACAAGGTAGA 74258
Old:   74290 AGAAGGAGAGGGTCTGCTGAATAGTGTGAGCAGTGTTTCTGAACTTTTTCTTCGTCTAAG 74349
             |||||||| ||||||| |||||||||| ||||||||||||||||||||||||||||||||
New:   74319 AGAAGGAGCGGGTCTGGTGAATAGTGTAAGCAGTGTTTCTGAACTTTTTCTTCGTCTAAG 74378
2000-09-13 ARS306
74548 74548 Substitution C T
74476 74476 Substitution T C
Two sequence changes were made in the systematic sequence in the region encompassing feature ARS306. Note that coordinates listed are chromosomal coordinates.
Old:   74470 TTTTTTTAAATTTTCGAATTGTATTTATATTTATTTAGTACTTCTTGAGTTTACATATCC 74529
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   74499 TTTTTTCAAATTTTCGAATTGTATTTATATTTATTTAGTACTTCTTGAGTTTACATATCC 74558
Old:   74530 TTCGTAAAAATGCAACTTCTGTCGAAAAACACTTCCAAAAAAAAATAATAATGAATTTAT 74589
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   74559 TTCGTAAAAATGCAACTTTTGTCGAAAAACACTTCCAAAAAAAAATAATAATGAATTTAT 74618
2000-09-13 ARS305
39622 39622 Deletion G
39583 39583 Substitution G A
39528 39528 Substitution C T
39515 39516 Substitution AA TC
39500 39501 Substitution CC GA
39488 39488 Substitution G A
39302 39302 Substitution G T
39241 39241 Substitution C T
Several sequence changes were made in the systematic sequence in the region encompassing feature ARS305. Note that coordinates listed are chromosomal coordinates.
Old:   39210 ATGTTAACAAACAGTTCTGATTATTCGCCTTCTGACAGGACGATAATGTAAATAGTTGTG 39269
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
New:   39234 ATGTTAACAAACAGTTCTGATTATTCGCCTTTTGACAGGACGATAATGTAAATAGTTGTG 39293
Old:   39270 GTAGTATCATTCAGGTATGTAACTGTTTACTTGGTATCGCTTGAAAAAAATAAGCATTTC 39329
             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
New:   39294 GTAGTATCATTCAGGTATGTAACTGTTTACTTTGTATCGCTTGAAAAAAATAAGCATTTC 39353
Old:   39450 TATTATTTTTTATTTACTTTGTAGTTCTTAAAGCTAAGGTTTTTTTCTTTCCTAAATTCT 39509
             |||||||||||||||||||||||||||||||||||||| |||||||||||  ||||||||
New:   39474 TATTATTTTTTATTTACTTTGTAGTTCTTAAAGCTAAGATTTTTTTCTTTGATAAATTCT 39533
Old:   39510 TGTTTAAATATCCTAAAACTAAAGGGAAAATAAACAATACATAACAAAACATATAAAAAC 39569
             |||||  ||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   39534 TGTTTTCATATCCTAAAATTAAAGGGAAAATAAACAATACATAACAAAACATATAAAAAC 39593
Old:   39570 CAACACAATAAAAGAAAGGATCAAATACTCATTAAAGTAACTTACACGGGGGGCTAAAAA 39629
             ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||
New:   39594 CAACACAATAAAAAAAAGGATCAAATACTCATTAAAGTAACTTACACGGGGG-CTAAAAA 39652
2000-09-13 ARS304 30504 30505 Substitution GT TG
A dinucleotide substitution was made in the systematic sequence in the region encompassing feature ARS304. The GT at 30504-5 was changed to TG. Note that coordinates listed are chromosomal coordinates.
Old:   30470 AAATCTCAAAGTCGAAGAAACACAGAACACAGAAGTAAACTGGACTAAATGATTTTCAAT 30529
             ||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||
New:   30487 AAATCTCAAAGTCGAAGAAACACAGAACACAGAATGAAACTGGACTAAATGATTTTCAAT 30546
2000-09-13 ARS300, YCL076W, YCLWTy5-1 1435 1435 Insertion C
A single nucleotide insertion was made in the systematic sequence in the region encompassing overlapping features ARS300, YCLWTy5-1, and YCL076W. A single C was inserted after the T at 1435. This change resulted in the predicted protein encoded by YCL076W being elongated at the N-terminal end by 51 amino acids. Note that coordinates listed are chromosomal coordinates.
Old:    1434 CT-AGAGCAATGCTTCTGAGAACATAATCAATCTATCTAGCCCCAACAATTATAAACAGT 1492
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:    1441 CTCAGAGCAATGCTTCTGAGAACATAATCAATCTATCTAGCCCCAACAATTATAAACAGT 1500
2000-09-13 YCR037C, YCR038C 196266 196266 Substitution C T
196035 196035 Substitution C T
The systematic sequence was updated in the region between ORFs YCR037C and YCR038C. Coordinates listed are chromosomal coordinates.
Old:   195987 GTGTGAAACACTGTTTTCTGGTAATAATTTTTCAATGCATCGGATTACCTTTCCCACGTG 196046
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
New:   197250 GTGTGAAACACTGTTTTCTGGTAATAATTTTTCAATGCATCGGATTACTTTTCCCACGTG 197309
Old:   196227 AAAAAATATTATCTACTGTAGTTATGCAAGTATTCTTAACTTTCAGTACTAAACATGAAT 196286
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   197490 AAAAAATATTATCTACTGTAGTTATGCAAGTATTCTTAATTTTCAGTACTAAACATGAAT 197549
2000-09-13 YCR038C 198169 198169 Deletion T
197950 197950 Substitution G C
197810 197810 Substitution A G
197077 197077 Substitution G A
196838 196839 Substitution CA AC
The systematic sequence was updated within ORF YCR038C. In addition, the start codon has been shifted forward 312 nt, leading to an N-terminal extension of the protein by 104 aa. Note that coordinates listed below are chromosomal coordinates.
Old:   196827 GTATAGACAAGCAAGTGCAACTTGTAACCAGTAGGAAATGGTGTGCGTTTGCTGCAAAGT 196886
              |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
New:   198090 GTATAGACAAGACAGTGCAACTTGTAACCAGTAGGAAATGGTGTGCGTTTGCTGCAAAGT 198149
Old:   197067 GACTTCTAGAGGTTCACCCTGTTTCCATTGGAAAAGTAAATCACTGAGGTCAGTTGCACC 197126
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
New:   198330 GACTTCTAGAAGTTCACCCTGTTTCCATTGGAAAAGTAAATCACTGAGGTCAGTTGCACC 198389
Old:   197787 CCTCCAGGCGGAGTTAACAACTAATAATACGGCATCCATGTTTGCATCAGCGCCGAGCCT 197846
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   199050 CCTCCAGGCGGAGTTAACAACTAGTAATACGGCATCCATGTTTGCATCAGCGCCGAGCCT 199109
Old:   197907 GGGGCATTCTCTAGAGACACAGGCAGTTGCTTCCAGCAACTGCGGTACGGCCGTTCTCAT 197966
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
New:   199170 GGGGCATTCTCTAGAGACACAGGCAGTTGCTTCCAGCAACTGCCGTACGGCCGTTCTCAT 199229
Old:   198147 GGCGAGGACATTATCTATCAGTTACAAACATCTTAGTAGTGTCTGAGGAGAGGGTTGATT 198206
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
New:   199410 GGCGAGGACATTATCTATCAGT-ACAAACATCTTAGTAGTGTCTGAGGAGAGGGTTGATT 199468
2000-09-13 YCR037C 195701 195701 Substitution G A
195060 195060 Substitution T C
The systematic sequence was updated within ORF YCR037C. Note that coordinates listed are chromosomal coordinates.
Old:   195027 GTAAAGATTTATTATTGTCTGTTTTAATAATGATTTTTTCTGAGATTTAATGTTAAATTG 195086
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
New:   196290 GTAAAGATTTATTATTGTCTGTTTTAATAATGACTTTTTCTGAGATTTAATGTTAAATTG 196349
Old:   195687 TCTTCTTTTCGATGGAGATGGTTCTCCTGCAGCTATGTTGCTTTCTATATCAGCGATTGG 195746
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   196950 TCTTCTTTTCGATGAAGATGGTTCTCCTGCAGCTATGTTGCTTTCTATATCAGCGATTGG 197009
2000-09-13 YCR036W 192927 192927 Substitution T C
192557 192557 Substitution A G
192329 192329 Substitution T C
The systematic sequence was updated within ORF YCR036W. Coordinates listed are chromosomal coordinates.
Old:   192327 TATTAATTGAAGAGAAAGCTGGTGGCCAAAATAGGATATTGATTGTAGAAGGTGCTAACA 192386
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   193590 TACTAATTGAAGAGAAAGCTGGTGGCCAAAATAGGATATTGATTGTAGAAGGTGCTAACA 193649
Old:   192507 ATGCGAACAGGCCGAATTTTCAGATCGTATATAACCCCTCACCTTTCAAGACCATGCCTA 192566
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:   193770 ATGCGAACAGGCCGAATTTTCAGATCGTATATAACCCCTCACCTTTCAAGGCCATGCCTA 193829
Old:   192927 TGGCTATAAAGTTCTCTACATTAGCTAGTTCATTGACCATTCAAAGAAAAGGTGCTGCTG 192986
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   194190 CGGCTATAAAGTTCTCTACATTAGCTAGTTCATTGACCATTCAAAGAAAAGGTGCTGCTG 194249
2000-09-13 YCR035C, YCR036W 191836 191836 Substitution A C
191795 191795 Substitution G A
The systematic sequence was updated in the region between ORFs YCR035C and YCR036W. Note that coordinates listed are chromosomal coordinates.
Old:   191787 TTTGTGTAGCAATACTCATCGTCTAATTTGTCCATTATTGTTATATACTATGTCATAAAA 191846
              |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   193050 TTTGTGTAACAATACTCATCGTCTAATTTGTCCATTATTGTTATATACTCTGTCATAAAA 193109
2000-09-13 YCR035C 191444 191444 Substitution A C
190661 190661 Substitution T C
The systematic sequence was updated within ORF YCR035C. Note that coordinates listed are chromosomal coordinates.
Old:   190647 AGCGCCTCCTCCCATTAATGTTAATTGCTTATAGTTACCTGAAGGAGCAGCGAGGATGGA 190706
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   191910 AGCGCCTCCTCCCACTAATGTTAATTGCTTATAGTTACCTGAAGGAGCAGCGAGGATGGA 191969
Old:   191427 ATCCAAATCTTTAATCGAGGCGCTAGTTTCTTCTATTATTCCACCCGTAATAGAAGTTAT 191486
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   192690 ATCCAAATCTTTAATCGCGGCGCTAGTTTCTTCTATTATTCCACCCGTAATAGAAGTTAT 192749
2000-09-13 YCR033W 186465 186465 Substitution T C
186429 186429 Substitution T A
186384 186384 Substitution A G
186341 186341 Substitution A G
186130 186130 Substitution A G
The systematic sequence was updated within ORF YCR033W. Note that coordinates listed are chromosomal coordinates.
Old:   186087 GGCTTCAGTTAAAGTTGAAACACCCAGTAAAGATGAGACAAAAACCATATCGTACCATGA 186146
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
New:   187350 GGCTTCAGTTAAAGTTGAAACACCCAGTAAAGATGAGACAAAAGCCATATCGTACCATGA 187409
Old:   186327 CGCTAAAAAAGTAAATAAAATCAATATTGATGGAAAGCAGGACGAAATTTGGACGACAGC 186386
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||
New:   187590 CGCTAAAAAAGTAAGTAAAATCAATATTGATGGAAAGCAGGACGAAATTTGGACGACGGC 187649
Old:   186387 AAAAACAGTGGCCAGTGCAGTCGAAGTTTCCAAAGAAAGTCATAAGGAACTAACACGCTC 186446
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
New:   187650 AAAAACAGTGGCCAGTGCAGTCGAAGTTTCCAAAGAAAGTCAAAAGGAACTAACACGCTC 187709
Old:   186447 TGTTGAAAGGAAGGAAAGTCCAGAAATTAGAGATTATGAAAGAGCATACGATCCGAAAGC 186506
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   187710 TGTTGAAAGGAAGGAAAGCCCAGAAATTAGAGATTATGAAAGAGCATACGATCCGAAAGC 187769
2000-09-13 YCR033W 187293 187293 Substitution C T
187147 187147 Substitution T C
186975 186975 Substitution A G
186931 186931 Substitution T C
186792 186792 Substitution G A
186661 186661 Substitution A G
186582 186582 Substitution A G
186541 186541 Substitution G A
186521 186521 Substitution C T
The systematic sequence was updated within ORF YCR033W. Note that coordinates listed are chromosomal coordinates.
Old:   186507 CCTGAAAACAGACGCAACAAAGTTGACAGTAGACGATGATAATAAAAGTTACGAAGAACC 186566
              |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||
New:   187770 CCTGAAAACAGACGTAACAAAGTTGACAGTAGACAATGATAATAAAAGTTACGAAGAACC 187829
Old:   186567 TCTTGAAAAAGTGGAAGGGTGTATTTTCCCATTACCAAAAGCAGAAACGAGATTATGGGA 186626
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
New:   187830 TCTTGAAAAAGTGGAGGGGTGTATTTTCCCATTACCAAAAGCAGAAACGAGATTATGGGA 187889
Old:   186627 ATTGAAAAACCAGAAAAGAAACAAAATAATAAGTAAACAAAAGTACTTACTGAAAAAGGC 186686
              |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
New:   187890 ATTGAAAAACCAGAAAAGAAACAAAATAATAAGTGAACAAAAGTACTTACTGAAAAAGGC 187949
Old:   186747 TACCGGACTTATCTTGACGAAAATTATATCAAAGATAAAAAAGGAGGAACATTTGAAAAA 186806
              ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
New:   188010 TACCGGACTTATCTTGACGAAAATTATATCAAAGATAAAAAAGGAAGAACATTTGAAAAA 188069
Old:   186927 CGAATTAATGGAGCAGAAAAGACGTGAAGAAGGTATCGAAACAGAAAAAGAAAAAAGCTT 186986
              |||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||
New:   188190 CGAACTAATGGAGCAGAAAAGACGTGAAGAAGGTATCGAAACAGAAAAGGAAAAAAGCTT 188249
Old:   187107 TGCAACAATTCCTCCGCTAATTTTAGATCCAATCCGCAAATACTCTTACAAATTCTGTGA 187166
              |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
New:   188370 TGCAACAATTCCTCCGCTAATTTTAGATCCAATCCGCAAACACTCTTACAAATTCTGTGA 188429
Old:   187287 AAAATTCGGTAAAATTTCTCACTACATGGGCGGCTTAAGAAGTCCTGAAGAGTGTGTCCT 187346
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   188550 AAAATTTGGTAAAATTTCTCACTACATGGGCGGCTTAAGAAGTCCTGAAGAGTGTGTCCT 188609
2000-09-13 YCR033W 187787 187787 Substitution G A
187781 187781 Substitution G C
187769 187769 Substitution C A
187754 187754 Substitution A G
187708 187708 Substitution A G
187683 187683 Substitution T C
187633 187633 Substitution A C
187515 187515 Substitution T G
187431 187431 Substitution G C
The systematic sequence was updated in the region encompassing ORF YCR033W. Note that coordinates listed are chromosomal coordinates.
Old:   187407 GAAAAGAAAAATGTCAGCCGCTGCGAAGCGCCGCAAGAGGAAGGAAAGAAGTAATGACGA 187466
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
New:   188670 GAAAAGAAAAATGTCAGCCGCTGCCAAGCGCCGCAAGAGGAAGGAAAGAAGTAATGACGA 188729
Old:   187467 GGAAGTCGAAGTTGATGAGAGTAAAGAAGAGTCAACGAACACGATAGATAAGGAAGAAAA 187526
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
New:   188730 GGAAGTCGAAGTTGATGAGAGTAAAGAAGAGTCAACGAACACGATAGAGAAGGAAGAAAA 188789
Old:   187587 AGGTGATCCATTAGGTACACCGGAAAAAGTTGAAAATATGATTGAAAAGAGAGGCGAAGA 187646
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:   188850 AGGTGATCCATTAGGTACACCGGAAAAAGTTGAAAATATGATTGAACAGAGAGGCGAAGA 188909
Old:   187647 GTTTGCAGGTGAATTGGAAAATGCTGAGAGGGTAAATGACTTAAAAAGGGCGCATGATGA 187706
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   188910 GTTTGCAGGTGAATTGGAAAATGCTGAGAGGGTAAACGACTTAAAAAGGGCGCATGATGA 188969
Old:   187707 AATTGGAGAAGAGAGCAATAAGTCCAGTGTAATAGAAACCAACAATGAGGTACAAATAAT 187766
              | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
New:   188970 AGTTGGAGAAGAGAGCAATAAGTCCAGTGTAATAGAAACCAACAATGGGGTACAAATAAT 189029
Old:   187767 GGCTCCAAAAGGAGGTGTTCGGAATGGTTATTATCCAGAGGAGACCAAAGAACTTGACTT 187826
              || ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||
New:   189030 GGATCCAAAAGGAGCTGTTCAGAATGGTTATTATCCAGAGGAGACCAAAGAACTTGACTT 189089
2000-09-13 YCR032W 180194 180194 Substitution A G
179802 179802 Substitution C T
179509 179509 Substitution A G
179446 179446 Substitution G A
179030 179030 Substitution A G
178856 178856 Substitution A G
The systematic sequence was updated within ORF YCR032W. Note that coordinates listed are chromosomal coordinates.
Old:   178827 TCTCCATAAGGAGTTGAAATTCTGTAACGATATCTTGAATTCATTAACACTCCAAGTTTC 178886
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New:   180090 TCTCCATAAGGAGTTGAAATTCTGTAACGGTATCTTGAATTCATTAACACTCCAAGTTTC 180149
Old:   179007 AAATAGGATAATGACCATAGAAAAACACATTTATTTGGAAATTAAGGAAGGCCAGTTTTG 179066
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   180270 AAATAGGATAATGACCATAGAAAGACACATTTATTTGGAAATTAAGGAAGGCCAGTTTTG 180329
Old:   179427 TCATTTAATGGCCAGGCCTGCAACAGAAATATCTTCCACAAAATACATCGATGAGATTGA 179486
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
New:   180690 TCATTTAATGGCCAGGCCTACAACAGAAATATCTTCCACAAAATACATCGATGAGATTGA 180749
Old:   179547 CACCGAATCGTCTAATTTTACGGTAAAATTTGAGGAAAGCACAAACTCGAAAAATATTCC 179606
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
New:   180810 CACCGAATCGTCTAATTTTACGGTAAAATTTGAGGAAAGCACGAACTCGAAAAATATTCC 180869
Old:   179787 AAAAGACTTTGGCTTCCCTTTATTTGCTTATACTTTAAAACAAAAAATAACACAAGATTT 179846
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
New:   181050 AAAAGACTTTGGCTTTCCTTTATTTGCTTATACTTTAAAACAAAAAATAACACAAGATTT 181109
Old:   180147 TGTCACAAAAAGAGAAAATCAGAACAGTAAATTTAATGAGCTATCAAATGATTTAATTTC 180206
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
New:   181410 TGTCACAAAAAGAGAAAATCAGAACAGTAAATTTAATGAGCTATCAAGTGATTTAATTTC 181469
2000-09-13 YCR032W 181660 181660 Substitution G C
181383 181383 Substitution A C
181159 181159 Substitution A G
180414 180414 Substitution G A
180366 180366 Substitution C T
180312 180312 Substitution A G
180249 180249 Substitution C T
The systematic sequence was updated within ORF YCR032W. Note that coordinates listed are chromosomal coordinates.
Old:   180207 TGTATTTGTTACTTTATTGAAAAGCAATACTGATAAACGACACCTGCAGTGGTTTTTACA 180266
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
New:   181470 TGTATTTGTTACTTTATTGAAAAGCAATACTGATAAACGACATCTGCAGTGGTTTTTACA 181529
Old:   180267 TCTCTCATATTACTTTATTAAGAGAAAAGATGTACGTTCTACAGAAATTATACTTCAAGC 180326
              ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
New:   181530 TCTCTCATATTACTTTATTAAGAGAAAAGATGTACGTTCTACAGAGATTATACTTCAAGC 181589
Old:   180327 GGTAGATCAACTTTTTTCGTTTTACTTAGATCAAGGTAGCGACGAAAATGCGAAGATACT 180386
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   181590 GGTAGATCAACTTTTTTCGTTTTACTTAGATCAAGGTAGTGACGAAAATGCGAAGATACT 181649
Old:   180387 TTCAGAGATTATACCACTTAAGCTAATGCTGATGATTATGGATCAAATAGTGGAAAATAA 180446
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
New:   181650 TTCAGAGATTATACCACTTAAGCTAATACTGATGATTATGGATCAAATAGTGGAAAATAA 181709
Old:   181107 CTTAGAGCTATCATTTATAGTGACACTCCTACCCGAAATACTTAATGACCTGATAGATAG 181166
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
New:   182370 CTTAGAGCTATCATTTATAGTGACACTCCTACCCGAAATACTTAATGACCTGGTAGATAG 182429
Old:   181347 TTTCAAAAACGTTTCTAAGTCGCAACTGTTACAGGAATTCAAAATCTGCATAATGAACTT 181406
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   182610 TTTCAAAAACGTTTCTAAGTCGCAACTGTTACAGGACTTCAAAATCTGCATAATGAACTT 182669
Old:   181647 GTGTTTTTTTGACGCAGCGAATAAAAGTGAAGTACTCGAAGGTTTAAGTAATATCCTCTC 181706
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
New:   182910 GTGTTTTTTTGACCCAGCGAATAAAAGTGAAGTACTCGAAGGTTTAAGTAATATCCTCTC 182969
2000-09-13 YCR032W 183669 183669 Substitution T C
183603 183603 Substitution A C
182862 182862 Substitution C T
182364 182364 Substitution T C
182114 182114 Substitution T C
The systematic sequence was updated within ORF YCR032W. Note that coordinates listed are chromosomal coordinates.
Old:   182067 TACACTGGAGATACAATCAAATCCAAATTCGTCCTGCAAGTGGTCATTGGACTTTGCAGA 182126
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
New:   183330 TACACTGGAGATACAATCAAATCCAAATTCGTCCTGCAAGTGGTCATCGGACTTTGCAGA 183389
Old:   182307 AGTTGGAGATTTGAATGAGAATAGAAAAATTCTTAGACTTTTGAAGGATAACGATTCTAT 182366
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   183570 AGTTGGAGATTTGAATGAGAATAGAAAAATTCTTAGACTTTTGAAGGATAACGATTCCAT 183629
Old:   182847 GGCAAGCATTGCTTCCAAATTCACTAGCGTCTTCTCAGCGAACAACAGCCTAATAGATGG 182906
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
New:   184110 GGCAAGCATTGCTTCTAAATTCACTAGCGTCTTCTCAGCGAACAACAGCCTAATAGATGG 184169
Old:   183567 GATTGATTTGATATTTGGTTACAAACAAAAGGGGGAAATTGCTGTGAAATCTGTTAACGT 183626
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   184830 GATTGATTTGATATTTGGTTACAAACAAAAGGGGGACATTGCTGTGAAATCTGTTAACGT 184889
Old:   183627 ATTCAACAGATTGAGTTACCCAGGCGCTGTAAATCTAGATAATATTGACGATGAAAATGA 183686
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
New:   184890 ATTCAACAGATTGAGTTACCCAGGCGCTGTAAATCTAGATAACATTGACGATGAAAATGA 184949
2000-09-13 YCR032W 184616 184616 Substitution G A
184599 184599 Substitution A G
184565 184565 Substitution C A
184290 184290 Substitution A G
184287 184287 Substitution G A
184197 184197 Substitution A G
184086 184086 Substitution T C
183870 183870 Substitution T C
The systematic sequence was updated within ORF YCR032W. Note that coordinates listed are chromosomal coordinates.
Old:   183867 GTCTGTCGATTATGTTATACACGATCCTAGTTACTTCGATTCATTATACTGGAGGGGCTT 183926
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   185130 GTCCGTCGATTATGTTATACACGATCCTAGTTACTTCGATTCATTATACTGGAGGGGCTT 185189
Old:   184047 ATCGTTTGCGTACTGGAAGTTGGGCGAATTCATAACTGGTGATAAAAATGGGCTGATAAA 184106
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   185310 ATCGTTTGCGTACTGGAAGTTGGGCGAATTCATAACTGGCGATAAAAATGGGCTGATAAA 185369
Old:   184167 AATGTTTGGGCACCTATGCGAGCTAAAGGAAATGCGCTGTTATCACGACTACAATACGCT 184226
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New:   185430 AATGTTTGGGCACCTATGCGAGCTAAAGGAGATGCGCTGTTATCACGACTACAATACGCT 185489
Old:   184287 GAGACAAATAACAAATGATGCGCAAAAGGTCGCAATATCTCAACATGCAGGGAGCATTAT 184346
               || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   185550 AAGGCAAATAACAAATGATGCGCAAAAGGTCGCAATATCTCAACATGCAGGGAGCATTAT 185609
Old:   184527 TGAAGATGGAACTATAGAAATTTACGAGCTCTTTTTGACTTTTCATAATGAATGGGCGAT 184586
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:   185790 TGAAGATGGAACTATAGAAATTTACGAGCTCTTTTTGAATTTTCATAATGAATGGGCGAT 185849
Old:   184587 AAAGCTACTGAAACAGCTCTGTACCGAAAGAGGGAAAGCCATAACTAGCATTAAGGGACA 184646
              |||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||
New:   185850 AAAGCTACTGAAGCAGCTCTGTACCGAAAAAGGGAAAGCCATAACTAGCATTAAGGGACA 185909
2000-09-13 YCR032W 178761 178761 Substitution C T
The systematic sequence was updated within ORF BPH1/YCR032W. Note that coordinates listed are chromosomal coordinates.
Old:   178707 CGAAATACTATCAAATAAAAACGATAGTTGGAAATCTACATTACTACAGAAAAACCTTAT 178766
              |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
New:   179970 CGAAATACTATCAAATAAAAACGATAGTTGGAAATCTACATTACTACAGAAAAATCTTAT 180029
2000-09-13 YCR032W 184966 184966 Substitution A T
184926 184926 Substitution A G
184835 184835 Substitution C T
184757 184757 Substitution G C
The systematic sequence was updated in the region between ORFs YCR032W and YCR033W. Note that coordinates listed are chromosomal coordinates.
Old:   184707 AGTGATTGCGGGAACATTAGATGGCAGATTAGCTATTTGGTACTAGGCATGACATCGTAA 184766
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:   185970 AGTGATTGCGGGAACATTAGATGGCAGATTAGCTATTTGGTACTAGGCATCACATCGTAA 186029
Old:   184827 TCATCCCACCTAGTATTGTAATTGCGTACGTATCCAATATCATTACCAACGCCGGGTATT 184886
              |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
New:   186090 TCATCCCATCTAGTATTGTAATTGCGTACGTATCCAATATCATTACCAACGCCGGGTATT 186149
Old:   184887 TTTTTCTAGTATTTCTTCTCCATTTCGCCTATGGAAAACAGCAAAAGGGTAAAAGAAAAA 184946
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   186150 TTTTTCTAGTATTTCTTCTCCATTTCGCCTATGGAAAACGGCAAAAGGGTAAAAGAAAAA 186209
Old:   184947 AACAAACGATTAATTCTTCATTGAATTATGTAAAAATCAAAACGCAACCGCAGATTTAAT 185006
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
New:   186210 AACAAACGATTAATTCTTCTTTGAATTATGTAAAAATCAAAACGCAACCGCAGATTTAAT 186269
2000-09-13 YCR030C, YCR031C 176123 176123 Substitution A G
176049 176049 Substitution G A
176015 176015 Substitution C T
175724 175724 Insertion A
175572 175573 Substitution CG GC
The systematic sequence was updated in the region between features YCR030C and YCR031C. Coordinates listed are chromosomal coordinates.
Old:   175528 CGCTGGTATTCATGTAGAGCACCAACCTGACTGTGAATGCGTAACGTGAAACATGATAGC 175587
              ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||
New:   176795 CGCTGGTATTCATGTAGAGCACCAACCTGACTGTGAATGCGTAAGCTGAAACATGATAGC 176854
Old:   175708 GCCTCCTTCAAAAAAAA-TTTACATATATAACATAGGTGGAAAAACTTCCCTCCGATGTC 175766
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   176975 GCCTCCTTCAAAAAAAAATTTACATATATAACATAGGTGGAAAAACTTCCCTCCGATGTC 177034
Old:   176007 CGATTTTGCAACTCTTGGTAATTGTGTCCTTACATTTCCGTAGTGACGTTAATCAAATCG 176066
              |||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||
New:   177275 CGATTTTGTAACTCTTGGTAATTGTGTCCTTACATTTCCGTAATGACGTTAATCAAATCG 177334
Old:   176067 CAATCTTGAATCTTCTTAACTAAAAGGTTATAAGGGCTTTTTTTTATTACTAAATTAACG 176126
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
New:   177335 CAATCTTGAATCTTCTTAACTAAAAGGTTATAAGGGCTTTTTTTTATTACTAAATTGACG 177394
2000-09-13 YCR031C 176781 176781 Substitution T A
176452 176452 Substitution T C
176423 176423 Substitution C T
The systematic sequence was updated within ORF YCR031C. Note that coordinates listed are chromosomal coordinates.
Old:   176367 TTCTAGTACCACCGGTAGCTCTGATCTTAACGTGAACGGCAGTGATACCGACTTCCCTAC 176426
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
New:   177635 TTCTAGTACCACCGGTAGCTCTGATCTTAACGTGAACGGCAGTGATACCGACTTCCTTAC 177694
Old:   176427 ACTTAGCGGCAACATCTTGGGCAGCTAACATAGCAGCGTATGGAGAAGATTCATCTCTGT 176486
              ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
New:   177695 ACTTAGCGGCAACATCTTGGGCAGCCAACATAGCAGCGTATGGAGAAGATTCATCTCTGT 177754
Old:   176727 TTTTCCATCGAAAAAAAAGTTGACAAAATATACTGCCATTGACACAATAGGCTCTACTAA 176786
| 
              |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
New:   177995 TTTTCCATCGAAAAAAAAGTTGACAAAATATACTGCCATTGACACAATAGGCTCAACTAA 178054
2000-09-13 YCR030C 174294 174294 Substitution C T
174084 174084 Substitution C T
The systematic sequence was updated within ORF YCR030C. Note that coordinates listed are chromosomal coordinates.
Old:   174028 GAATTATTCGGAGTCTCAGTGATGGATGCCTGAATATGAGAGTTTGATGATGATTGCTGT 174087
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
New:   175295 GAATTATTCGGAGTCTCAGTGATGGATGCCTGAATATGAGAGTTTGATGATGATTGTTGT 175354
Old:   174268 AATGCACTCTTACGCTTATCCTTTTGCGGGGATTTCTTTTCTCTTTCCGTATTAGCGGCA 174327
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New:   175535 AATGCACTCTTACGCTTATCCTTTTGTGGGGATTTCTTTTCTCTTTCCGTATTAGCGGCA 175594
2000-09-13 YCR028C-A 171856 171856 Substitution T G
The systematic sequence was updated within ORF YCR028C-A. Note that coordinates listed are chromosomal coordinates.
Old:   171810 TAGCAGCATCTGCTTCAACATATACCAAAGCGCTGAATAAATTATGTAAAGGAAATGTTA 171869
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:   173076 TAGCAGCATCTGCTTCAACATATACCAAAGCGCTGAATAAATTATGGAAAGGAAATGTTA 173135
2000-09-13 YCR028C-A 172693 172693 Substitution G A
172674 172674 Deletion G
172671 172671 Insertion G
172578 172578 Substitution A G
172366 172366 Substitution A T
172290 172290 Substitution C T
172287 172287 Insertion T
172172 172172 Substitution A T
The systematic sequence was updated in the region upstream of feature YCR028C-A. Note that coordinates listed are chromosomal coordinates.
Old:   172170 AAAGGATTAGTGGATTTTTGTTTGTTTTGTATTTGTCAAGGACACACAATTAGCAAATGA 172229
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   173436 AATGGATTAGTGGATTTTTGTTTGTTTTGTATTTGTCAAGGACACACAATTAGCAAATGA 173495
Old:   172230 CTTGTTATCAAATTCGTGGTATTTGTCTTTCTCAACTACTGTGTTAGCTTTTTTTTTT-C 172288
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
New:   173496 CTTGTTATCAAATTCGTGGTATTTGTCTTTCTCAACTACTGTGTTAGCTTTTTTTTTTTC 173555
Old:   172289 GCCTGGGCGCAAACGCCTTTTAAGCACTCCTCCACAAATAATAAGTATTAGATGAAAAGT 172348
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   173556 GTCTGGGCGCAAACGCCTTTTAAGCACTCCTCCACAAATAATAAGTATTAGATGAAAAGT 173615
Old:   172349 CCTAAAAGTCCGAAAAAAGGAATAGAAAAGAACGAAAATACAGAATCTTTACAGAACATT 172408
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   173616 CCTAAAAGTCCGAAAAATGGAATAGAAAAGAACGAAAATACAGAATCTTTACAGAACATT 173675
Old:   172529 AAATAGAAGCATAGCAGAAATATCAAGCGAGACCATGGTAGTTACCAGTAGTCAAAGTTC 172588
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   173796 AAATAGAAGCATAGCAGAAATATCAAGCGAGACCATGGTAGTTACCAGTGGTCAAAGTTC 173855
Old:   172649 AAGTCAAGGTGATTCCACTGCCG-CTGCCGCTATGGGGTAGAGCCGCGTTATCCGTCTCA 172707
              ||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||
New:   173916 AAGTCAAGGTGATTCCACTGCCGGCT-CCGCTATGGGGTAGAGCCACGTTATCCGTCTCA 173974
2000-09-13 YCR028C 171051 171051 Substitution T C
170931 170931 Substitution C G
170814 170814 Substitution T C
170811 170811 Substitution A G
170781 170781 Substitution G A
170309 170309 Substitution G A
170253 170253 Substitution A G
169896 169896 Substitution T G
The systematic sequence was updated within ORF YCR028C. Note that coordinates listed are chromosomal coordinates.
Old:   169861 CACCATGCGTTAACGGCCCCTGAAAACATATTCATTGAAGCAAGAACGATAGCACGTTCT 169920
              ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
New:   171164 CACCATGCGTTAACGGCCCCTGAAAACATATTCATGGAAGCAAGAACGATAGCACGTTCT 171223
Old:   170221 AATGCAAATGTAGAATTAGATGCGAAACCCAAATTCTCACCTCCCAGAACCCAAACAAGA 170280
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
New:   171524 AATGCAAATGTAGAATTAGATGCGAAACCCAAGTTCTCACCTCCCAGAACCCAAACAAGA 171583
Old:   170281 GAGAACATCCACCAGTGCCACCTTTTTAGGACTCTAGGAATAGTCGACCAGTCTAACCGG 170340
              |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
New:   171584 GAGAACATCCACCAGTGCCACCTTTTTAAGACTCTAGGAATAGTCGACCAGTCTAACCGG 171643
Old:   170761 CCCAAGGTCAATAAACCCCAGGCAAACGTACAAAAACTTAGCCATATCCTAGGTGGAACA 170820
              |||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||
New:   172064 CCCAAGGTCAATAAACCCCAAGCAAACGTACAAAAACTTAGCCATATCCTGGGCGGAACA 172123
Old:   170881 TTAGACACGGTCAAATCGTTTCCGACCATCTTAAGATCTTCCTTCATACCCGATATATAT 170940
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:   172184 TTAGACACGGTCAAATCGTTTCCGACCATCTTAAGATCTTCCTTCATACCGGATATATAT 172243
Old:   171001 AGCACAAACAAGTCTATTTTAAACAGAAGTAATCTCTTTTTAATGGCACGTTTGGAAGAA 171060
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:   172304 AGCACAAACAAGTCTATTTTAAACAGAAGTAATCTCTTTTTAATGGCACGCTTGGAAGAA 172363
2000-09-13 YCR028C 171661 171696 Deletion TTCTTGGCCCTCAGCATTTTCTTGG CCCTCAGCATT
171513 171513 Deletion T
171364 171364 Substitution C G
171315 171315 Substitution T C
The systematic sequence was updated in the region between features YCR028C and YCR028C-A. Note that coordinates listed are chromosomal coordinates.
Old:   171301 CCTTTCAAGATCGATTACTCAAAATCTACAATAATCGGACTGCATGGATCAATGGAGGTG 171360
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   172604 CCTTTCAAGATCGACTACTCAAAATCTACAATAATCGGACTGCATGGATCAATGGAGGTG 172663
Old:   171361 TAGCCAATTTTGTAACAATGAAGGATATGTTAAATTCGCTAAAGCTTCCTCCTCTTTTGC 171420
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   172664 TAGGCAATTTTGTAACAATGAAGGATATGTTAAATTCGCTAAAGCTTCCTCCTCTTTTGC 172723
Old:   171481 TATACATTCTATTTGAGAATAAGCATAGTTTTTACATAACTAGTTCGTTATTCCAAATGT 171540
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
New:   172784 TATACATTCTATTTGAGAATAAGCATAGTTTT-ACATAACTAGTTCGTTATTCCAAATGT 172842
Old:   171661 TTCTTGGCCCTCAGCATTTTCTTGGCCCTCAGCATT 171696

New:   172962 ------------------------------------ 172962
2000-09-13 YCR027C 167958 167958 Substitution A G
167813 167813 Substitution G A
The systematic sequence was updated in the region upstream of feature YCR027C. Note that coordinates listed are chromosomal coordinates.
Old:   167781 ACCAGCCCAAAAGAATGAATATGAAAATATCAGTATGCGTCAATGAAAATGGAGGCAAGT 167840
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
New:   168059 ACCAGCCCAAAAGAATGAATATGAAAATATCAATATGCGTCAATGAAAATGGAGGCAAGT 168118
Old:   167901 AGATATTAAACCTGGCAGAAGCGTCTTGTTAATACTTATAGAGAAACCACCAGTAGCATT 167960
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   168179 AGATATTAAACCTGGCAGAAGCGTCTTGTTAATACTTATAGAGAAACCACCAGTAGCGTT 168238
2000-09-13 YCR026C, YCR027C 166449 166449 Substitution C T
166424 166424 Substitution G A
166359 166359 Substitution G A
166292 166292 Substitution G A
166125 166125 Substitution A G
The systematic sequence was updated in the intergenic region between features YCR026C and YCR027C. Note that coordinates listed are chromosomal coordinates.
Old:   166101 GCCTCACTTATTTTGCTTATTTGTAGTTTGTTAGGCAGTTTGCATATCGTACCAATGTTT 166160
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
New:   166382 GCCTCACTTATTTTGCTTATTTGTGGTTTGTTAGGCAGTTTGCATATCGTACCAATGTTT 166441
Old:   166281 GTTCACAATTCGCCTGATTGTTTGACTAGTCCAACCCCTGGTATAATTGTCACTTAATAT 166340
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   166562 GTTCACAATTCACCTGATTGTTTGACTAGTCCAACCCCTGGTATAATTGTCACTTAATAT 166621
Old:   166341 ATTCTTAGCTTCCAGGTGGTGTTTTATTCCATTATTTATGTTATGTATATATAATCGTAA 166400
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   166622 ATTCTTAGCTTCCAGGTGATGTTTTATTCCATTATTTATGTTATGTATATATAATCGTAA 166681
Old:   166401 CTCTTAGAGCAAAAAGTAAAAAAGAAGGTGGTACTTACCGAGGGAGAACATATACAAATT 166460
              ||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||
New:   166682 CTCTTAGAGCAAAAAGTAAAAAAAAAGGTGGTACTTACCGAGGGAGAATATATACAAATT 166741
2000-09-13 YCR027C 167438 167438 Substitution C T
The systematic sequence was updated within ORF YCR027C. Note that coordinates listed are chromosomal coordinates.
Old:   167421 ATTATACTATAGCACAGCATTATGCCTCGTACGCCCGTCAACGATTTAATGTTTAATAGA 167480
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   167699 ATTATACTATAGCACAGTATTATGCCTCGTACGCCCGTCAACGATTTAATGTTTAATAGA 167758
2000-09-13 YCR027C 168120 168120 Substitution A G
168108 168108 Substitution G A
168105 168105 Substitution A T
168100 168100 Substitution G ATATTTTGTATCTCAAAATGAGGTA TGTCAGTATGACAATACGTCATCCT AAACGTTCATAAAACACATATGAAA CAACCTTATAACAAAACGAACAACA TGAGATAAAACCCGGCCTTCCCTAG CTGAACTACCCAAAAGTATAAATGC CTGAACAATTAGTTTAGATCCGAGA TTCCGCGCTTCCACCACTTAGTATG ATTCATATTTTATATGAGAAATGGG TGAATGTTGAGATAATTGTTGGGAT TCCATTGTTGATAAAGGCTATAATA TTAGGTATACAGAATATACTAGAAG TTCTCCTCGAGGATTTAGGAATCCA TAAAAGGGAATCTGCAATTCTACAC AATTCTATAAATATTATTATCATCG TTTTATATGTTAATATTCATTGATC CTATTACATTATCAATCCTTGCGTT TCAGCTTCCACTAATTTAGATGACT ATTTCTCATCATTTGCGTCATCTTC TAACACCGTATATGATAATATACTA GTAACGTAAATACTAGTTAGTAGAT GATAGTTGATTTTTATTCCAACATT ATATAATATATAAGATAAGTAACAT TCCGTGAATTAATCTGATAAACTGT TTTGACAACTGGTTACTTCCCTAAG ACTGTTTATATTAGGATTGTCAAGA CACTCCGGTATTACTCGAGCCCGTA ATACAACATAA
The systematic sequence was updated in the region between features YCR027C and YCR028CC. Note that coordinates listed are chromosomal coordinates.
Old:   168081 AGGACCAGGACTTCTTGTAG--------------------------------------- 168100
              |||||||||||||||||||
New:   168359 AGGACCAGGACTTCTTGTAATATTTTGTATCTCAAAATGAGGTATGTCAGTATGACAAT 168417
New:   168418 ACGTCATCCTAAACGTTCATAAAACACATATGAAACAACCTTATAACAAAACGAACAACATGA 168480
New:   168481 GATAAAACCCGGCCTTCCCTAGCTGAACTACCCAAAAGTATAAATGCCTGAACAATTAGTTTAGATCCGA 168550
New:   168551 GATTCCGCGCTTCCACCACTTAGTATGATTCATATTTTATATGAGAAATGGGTGAATGTTGAGATAATTG 168620
New:   168621 TTGGGATTCCATTGTTGATAAAGGCTATAATATTAGGTATACAGAATATACTAGAAGTTCTCCTCGAGGA 168690
New:   168691 TTTAGGAATCCATAAAAGGGAATCTGCAATTCTACACAATTCTATAAATATTATTATCATCGTTTTATAT 168760
New:   168761 GTTAATATTCATTGATCCTATTACATTATCAATCCTTGCGTTTCAGCTTCCACTAATTTAGATGACTATT 168830
New:   168831 TCTCATCATTTGCGTCATCTTCTAACACCGTATATGATAATATACTAGTAACGTAAATACTAGTTAGTAG 168900
New:   168901 ATGATAGTTGATTTTTATTCCAACATTATATAATATATAAGATAAGTAACATTCCGTGAATTAATCTGAT 168970
New:   168971 AAACTGTTTTGACAACTGGTTACTTCCCTAAGACTGTTTATATTAGGATTGTCAAGACACTCCGGTATTA 169040
Old:   168101 -----------------------TATCAACGTTCTAGATACCAACATATCAATATAAAAAT 168138
                                     |||| || ||||||||||| ||||||||||||||||||
New:   169041 CTCGAGCCCGTAATACAACATAATATCTACATTCTAGATACCGACATATCAATATAAAAAT 169099
2000-09-13 YCR027C 168256 168256 Substitution C T
168230 168230 Insertion CTATTTGTTGGAATAAAAATCCACT ATCGTCTATCAACTAATAGTTATAT TATCAATATATTATCATATACGGTG TTAAGATGATGACATAAGTTATGAG AAGCTGTCATCGATGTTAGAGGAAG CTGAAACGCAAGGATTGATAATGTA ATAGGATCAATGAATATAAACATAT AAAACGGAATGAGGAATAATCGTAA TATTAGTATGTAGAAATATAGATTC CATTTTGAGGATTCCTATATCCTCG AGGAGAACTTCTAGTATATTCTGTA TACCTAATATTATAGCCTTTATCAA CAATGGAATCCCAACAATTATCTAA TTACCCACACATTTCTCA
168225 168225 Substitution G A
168191 168191 Substitution G A
168152 168152 Substitution T A
The systematic sequence was updated in the region between features YCR027C and YCR028C. Note that coordinates listed are chromosomal coordinates.
Old:   168139 ACTGAATATTGAGTCATCTTTTAGATTACGTTTTGGTTGCCGCAAACCAAAAGTGCAATTTA 168200
              ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
New:   169100 ACTGAATATTGAGACATCTTTTAGATTACGTTTTGGTTGCCGCAAACCAAAAATGCAATTTA 169163
Old:   168201 AATGGGTGAATAATTTGAATGGTTGGAAAT------------------------------------- 168230
              |||||||||||||||||||||||| |||||
New:   169164 AATGGGTGAATAATTTGAATGGTTAGAAATCTATTTGTTGGAATAAAAATCCACTATCGTCTATCAA 169230
New:   169231 CTAATAGTTATATTATCAATATATTATCATATACGGTGTTAAGATGATGACATAAGTTATGAGAAGCTGT 169300
New:   169301 CATCGATGTTAGAGGAAGCTGAAACGCAAGGATTGATAATGTAATAGGATCAATGAATATAAACATATAA 169370
New:   169371 AACGGAATGAGGAATAATCGTAATATTAGTATGTAGAAATATAGATTCCATTTTGAGGATTC 169432
New:   169433 CTATATCCTCGAGGAGAACTTCTAGTATATTCTGTATACCTAATATTATAGCCTTTAT 169490
Old:   168231 ----------------------------------------------CTATTCTCGGTA 168242
                                                            ||||||||||||
New:   169491 CAACAATGGAATCCCAACAATTATCTAATTACCCACACATTTCTCACTATTCTCGGTA 169548
Old:   168243 AAGGTTATAATATCAGTGTTGGAATAAAACTCTAAAATACCATCCATTCAGAAGTATTCA 168302
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
New:   169549 AAGGTTATAATATTAGTGTTGGAATAAAACTCTAAAATACCATCCATTCAGAAGTATTCA 169608
2000-09-13 YCR025C, YCR026C 163801 163801 Substitution A G
The systematic sequence was updated in the intergenic region between features YCR025C and YCR026C. Note that coordinates listed are chromosomal coordinates.
Old:   163761 GCGCGGGACTCACAAGGATGCGTCTTTTATTTCATAACGCAGTTGTCCCACCTTAAGCTT 163820
              |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
New:   164045 GCGCGGGACTCACAAGGATGCGTCTTTTATTTCATAACGCGGTTGTCCCACCTTAAGCTT 164104
2000-09-13 YCR026C 165146 165148 Deletion GTC
165115 165115 Substitution C A
164991 164991 Substitution A G
164308 164308 Substitution G A
163985 163985 Substitution G A
163957 163957 Substitution T G
The systematic sequence was updated within ORF YCR026C. Note that coordinates listed are chromosomal coordinates.
Old:   163941 TGCTGCTGCTGCTGCTTCTTCTTGATGATGGTGATGTTTCGCCCGGTAGAGTCTCAGTTG 164000
              |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||
New:   164225 TGCTGCTGCTGCTGCTGCTTCTTGATGATGGTGATGTTTCGCCCAGTAGAGTCTCAGTTG 164284
Old:   164301 AAATATCGCACAAAAGGTTGTAAATTTCGGTATTTTGGAACGGCTCAATGTATCCCTGTG 164360
              ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   164585 AAATATCACACAAAAGGTTGTAAATTTCGGTATTTTGGAACGGCTCAATGTATCCCTGTG 164644
Old:   164961 CATCTACGTTCGGTACATAACCGAGAATTAACTGTGGTCTTTCGTTCAGTGTACTCATAT 165020
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New:   165245 CATCTACGTTCGGTACATAACCGAGAATTAGCTGTGGTCTTTCGTTCAGTGTACTCATAT 165304
Old:   165081 CGAAGTAAAATGGAGTTCTCTCTCTAGCAATAGGCTTTTTATGTTCAGGTTGTAGTTTCT 165140
              |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
New:   165365 CGAAGTAAAATGGAGTTCTCTCTCTAGCAATAGGATTTTTATGTTCAGGTTGTAGTTTCT 165424
Old:   165141 CTTCAGTCTTATACTTGGTATAATTCACATCGCTACCTGGCCACATATGGGTAGCAGCTT 165200
              |||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   165425 CTTCA---TTATACTTGGTATAATTCACATCGCTACCTGGCCACATATGGGTAGCAGCTT 165481
2000-09-13 YCR026C 165958 165958 Substitution G A
165731 165731 Substitution C T
165693 165693 Substitution G A
165417 165417 Substitution T C
165304 165304 Substitution T C
The systematic sequence was updated within ORF YCR026C. Note that coordinates listed are chromosomal coordinates.
Old:   165261 TATTGTTCCATATTCGAGGGTCCAATACACCTGGATGGAATTCTTCATTAAGATCAGGAT 165320
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
New:   165542 TATTGTTCCATATTCGAGGGTCCAATACACCTGGATGGAATTCCTCATTAAGATCAGGAT 165601
Old:   165381 AATGGTTGGGAAAGGTCTCCGTAGGGAAGCTGGGTATCATAAAAGGTGTGGACGTGATAT 165440
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   165662 AATGGTTGGGAAAGGTCTCCGTAGGGAAGCTGGGTACCATAAAAGGTGTGGACGTGATAT 165721
Old:   165681 CCAGCGAGCCAAGCAATGTGCGAAATATTATTTTAAAAGGCACTTTGGAACGAAATCCCG 165740
              |||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||
New:   165962 CCAGCGAGCCAAACAATGTGCGAAATATTATTTTAAAAGGCACTTTGGAATGAAATCCCG 166021
Old:   165921 TCCTGGTCCACGCAGATCGCCACCCCGATCTTACAGCGTCTTCATCCGTTATGAAATCAT 165980
              ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
New:   166202 TCCTGGTCCACGCAGATCGCCACCCCGATCTTACAGCATCTTCATCCGTTATGAAATCAT 166261
2000-09-13 YCR025C 163524 163524 Substitution A G
163465 163465 Substitution G T
163407 163407 Substitution G T
The systematic sequence was updated within ORF YCR025C. Note that coordinates listed are chromosomal coordinates.
Old:   163401 TGGGATGCTAGGGGAAGTGCGCGCGGATACCGAATCGGCCATCGAACCGGCCACCCGGAT 163460
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   163685 TGGGATTCTAGGGGAAGTGCGCGCGGATACCGAATCGGCCATCGAACCGGCCACCCGGAT 163744
Old:   163461 TGAGGTTGGTATGTTGCCTCTTTGCGCAATTTTATTGAATGCAAAGTTTCTCCTTCTAGT 163520
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   163745 TGAGTTTGGTATGTTGCCTCTTTGCGCAATTTTATTGAATGCAAAGTTTCTCCTTCTAGT 163804
Old:   163521 AAAAGACAACAGCTGAAAAATGCTCGATGTCCAAATGACGACATAAACCTCCTCGTTTAG 163580
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   163805 AAAGGACAACAGCTGAAAAATGCTCGATGTCCAAATGACGACATAAACCTCCTCGTTTAG 163864
2000-09-13 YCR024C 161457 161457 Substitution T G
The systematic sequence was updated in the region encompassing feature YCR024C. Note that coordinates listed are chromosomal coordinates.
Old:   161421 TTTCTGGAAATATAGCATGAACTGGAATTCTACAAATGATCTTAACCGTAAAATTGCACT 161480
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   161705 TTTCTGGAAATATAGCATGAACTGGAATTCTACAAAGGATCTTAACCGTAAAATTGCACT 161764
2000-09-13 YCR020W-B, YCR021C 155666 155668 Deletion TGA
155664 155664 Substitution A G
155675 155676 Deletion GT
The systematic sequence was updated in the intergenic region between features YCR020W-B and YCR021C. Note that coordinates listed are chromosomal coordinates.
Old:   155661 ATTATTGAGTTTGTGTATATAATTTATTTTGCATATTTCATAAAGAAATTAAAATTAGAT 155720
              ||| |   ||||||  ||||||||||||||||||||||||||||||||||||||||||||
New:   155950 ATTGT---GTTTGT--ATATAATTTATTTTGCATATTTCATAAAGAAATTAAAATTAGAT 156004
2000-09-13 YCR018C-A, YCR019W 152251 152251 Substitution G A
152172 152172 Substitution A G
151974 151974 Substitution C T
151794 151794 Insertion A
The systematic sequence was updated in the intergenic region between features YCR018C-A and YCR019W. Note that coordinates listed are chromosomal coordinates.
Old:   151762 GTCTTGTTCCCAAGTATAACTTAAGAAAAAAAA-TTACAATCCAAGAAAGGTAATACAGA 151820
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
New:   152050 GTCTTGTTCCCAAGTATAACTTAAGAAAAAAAAATTACAATCCAAGAAAGGTAATACAGA 152109
Old:   151941 GAATATGAAAAGTACAAATCTGTCAAAAGCACACCGTATATTGTCTTGGTTCCGCTTTTA 152000
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
New:   152230 GAATATGAAAAGTACAAATCTGTCAAAAGCACATCGTATATTGTCTTGGTTCCGCTTTTA 152289
Old:   152121 ACTTGACGATGCACGCTACGATTTTTGTGTGTTTAAACTTTTGTTGGTTGGAACTCAAGA 152180
              ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
New:   152410 ACTTGACGATGCACGCTACGATTTTTGTGTGTTTAAACTTTTGTTGGTTGGGACTCAAGA 152469
Old:   152241 CTCTGCAAAAGCTTAATAATGTATTTTAAAACTTGCATGTTGCTCTGTGAATCTGAATGT 152300
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
New:   152530 CTCTGCAAAAACTTAATAATGTATTTTAAAACTTGCATGTTGCTCTGTGAATCTGAATGT 152589
2000-09-13 YCR017C, YCR018C 147840 147840 Substitution A C
147746 147746 Substitution C T
147587 147587 Substitution T C
The systematic sequence was updated in the intergenic region between features YCR017C and YCR018C. Note that coordinates listed are chromosomal coordinates.
Old:   147562 ACTTCTGTATATACCGATGAGCATATTTTGATTGTAAAAAACAACATTAAAAAGAACTGC 147621
              ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
New:   147851 ACTTCTGTATATACCGATGAGCATACTTTGATTGTAAAAAACAACATTAAAAAGAACTGC 147910
Old:   147742 GTCACATAGTAATACTAGCAGGAAGCCATTAATCAAAAAGAAACTCCATATAAAACGTAA 147801
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   148031 GTCATATAGTAATACTAGCAGGAAGCCATTAATCAAAAAGAAACTCCATATAAAACGTAA 148090
Old:   147802 TAAATATTATGAATAATAGTACAATATAAGAACAAAGAAGAAGAAAATACATTATAACTG 147861
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:   148091 TAAATATTATGAATAATAGTACAATATAAGAACAAAGACGAAGAAAATACATTATAACTG 148150
2000-09-13 YCR018C 148295 148295 Substitution A T
148293 148293 Substitution A G
147977 147977 Substitution C T
147959 147959 Deletion A
The systematic sequence was updated within ORF YCR018C. Note that coordinates listed are chromosomal coordinates.
Old:   147922 GGTGAAAGAATTAAATAGATACTATGGATTGTTTCGAATCTATCCTTTTATCTGCCGCTT 147981
              ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||
New:   148211 GGTGAAAGAATTAAATAGATACTATGGATTGTTTCGA-TCTATCCTTTTATCTGCTGCTT 148269
Old:   148282 TGCATGCACTAATAACACGATTCTTTGAGGGTGTAATTTCGTTCAAAGAGCTGGTTTTGT 148341
              ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
New:   148570 TGCATGCACTAGTTACACGATTCTTTGAGGGTGTAATTTCGTTCAAAGAGCTGGTTTTGT 148629
2000-09-13 YCR017C 147292 147292 Substitution G A
146654 146654 Substitution T C
146473 146473 Substitution A C
146354 146354 Substitution A G
146175 146175 Substitution G A
146125 146125 Substitution G A
The systematic sequence was updated within ORF YCR017C. Note that coordinates listed are chromosomal coordinates.
Old:   146122 TGGGTTGTTGGTATAGAACCCCATTTTCAAGATCACAGATGCAACAAGACCTAGCAGCCA 146181
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
New:   146411 TGGATTGTTGGTATAGAACCCCATTTTCAAGATCACAGATGCAACAAGACCTAACAGCCA 146470
Old:   146302 AACAATATAGGCACCAATGGCAATAATACCTCCTAAAAGTACACCATATTGCATGAAGGC 146361
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
New:   146591 AACAATATAGGCACCAATGGCAATAATACCTCCTAAAAGTACACCATATTGCGTGAAGGC 146650
Old:   146422 ATAACCTGAGATTCCCATATACCATAGCGGGAAATGCCAAATACTACATAAAAGGGACGT 146481
              ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
New:   146711 ATAACCTGAGATTCCCATATACCATAGCGGGAAATGCCAAATACTACATAACAGGGACGT 146770
Old:   146602 TTCACCACTTTTCTGCAATTCTGAACTTTTTTCTTCTCCATAATTTATGGGATTAGAGTC 146661
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
New:   146891 TTCACCACTTTTCTGCAATTCTGAACTTTTTTCTTCTCCATAATTTATGGGACTAGAGTC 146950
Old:   147262 GACCAAAGCTGCAAAGAAGGCGGAGAATGCGCAAATAGTATGAGCTATAGGGATGATCTT 147321
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New:   147551 GACCAAAGCTGCAAAGAAGGCGGAGAATGCACAAATAGTATGAGCTATAGGGATGATCTT 147610
2000-09-13 YCR016W, YCR017C 144420 144420 Substitution G A
144253 144253 Substitution G A
The systematic sequence was updated in the intergenic region between features YCR016W and YCR017C. Note that coordinates listed are chromosomal coordinates.
Old:   144202 TGATGTTTAACATAGAGTTCAACAACGTTGTTCAGTTGTAGTATATATTTTGCTGTGAAA 144261
              ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
New:   144491 TGATGTTTAACATAGAGTTCAACAACGTTGTTCAGTTGTAGTATATATTTTACTGTGAAA 144550
Old:   144382 AAAAAATCAGGTGGATACATAACTTACCTTAAGTTATCGAGATTTTCAGTACACACAATG 144441
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:   144671 AAAAAATCAGGTGGATACATAACTTACCTTAAGTTATCAAGATTTTCAGTACACACAATG 144730
2000-09-13 YCR017C 145975 145975 Substitution G A
145693 145693 Substitution A G
145440 145440 Substitution C T
145378 145378 Substitution T C
144760 144760 Substitution G A
144722 144722 Substitution T C
The systematic sequence was updated within ORF YCR017C. Note that coordinates listed are chromosomal coordinates.
Old:   144682 TCCTCTTGCAACTCTAGCATATCCTGTTCTTCTCAAGCCCTTATACAAGATATACTCACA 144741
              |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
New:   144971 TCCTCTTGCAACTCTAGCATATCCTGTTCTTCTCAAGCCCCTATACAAGATATACTCACA 145030
Old:   144742 CCATCTATCATCGTCAGAGGGATCAATGTCGTGCATTCCGGATGTTTCACTAACGTACGT 144801
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   145031 CCATCTATCATCGTCAGAAGGATCAATGTCGTGCATTCCGGATGTTTCACTAACGTACGT 145090
Old:   145342 TCTAATATCATACACGAACCTAGCTGTTAGTGATAGTAGGGCCACGGCAAAGAAGAAAAC 145401
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   145631 TCTAATATCATACACGAACCTAGCTGTTAGTGATAGCAGGGCCACGGCAAAGAAGAAAAC 145690
Old:   145402 ATAAATGAAGAATTTTTTGCCCATAGTCACCAGTTGAACGTTAAGGTTTTTGCATGTTAA 145461
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:   145691 ATAAATGAAGAATTTTTTGCCCATAGTCACCAGTTGAATGTTAAGGTTTTTGCATGTTAA 145750
Old:   145642 AAAATACGAAGGAACTAACCAAAGCATAGCGATAGCGTACAATAAACCACCAAAAATATA 145701
              ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
New:   145931 AAAATACGAAGGAACTAACCAAAGCATAGCGATAGCGTACAATAAACCACCGAAAATATA 145990
Old:   145942 CGAGCCAAAACCAACAGCCAAAAATAATTTGCCGATCAACGAAGCAGATTTTGCTTGAGC 146001
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
New:   146231 CGAGCCAAAACCAACAGCCAAAAATAATTTGCCAATCAACGAAGCAGATTTTGCTTGAGC 146290
2000-09-13 YCR016W 144137 144137 Substitution T C
143973 143973 Substitution G A
143830 143830 Substitution T C
143548 143548 Substitution A G
The systematic sequence was updated within ORF YCR016W. Note that coordinates listed are chromosomal coordinates.
Old:   143542 AAAAGGAAAGCGTGTGTCGAAACCAGGGACGAAGAAGAAGGAAAAATTGTCAAAGGATGA 143601
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   143831 AAAAGGGAAGCGTGTGTCGAAACCAGGGACGAAGAAGAAGGAAAAATTGTCAAAGGATGA 143890
Old:   143782 GAAATTTTCCAAGCAAAAGCAAAATTGGCTTATTAAGCATTTTTTCAATTTGGACGAAAT 143841
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
New:   144071 GAAATTTTCCAAGCAAAAGCAAAATTGGCTTATTAAGCATTTTTTCAACTTGGACGAAAT 144130
Old:   143962 TCAAGAAACAAGAATAAAAGCGTTAATTGCAGAGGATAAGGCTAGCGAACCAATTAATGG 144021
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   144251 TCAAGAAACAAAAATAAAAGCGTTAATTGCAGAGGATAAGGCTAGCGAACCAATTAATGG 144310
Old:   144082 ACAAGACGAGCAAGAGGAAGTACAAATGCCGAATAAAGAGCTTGTTCAAAGAAGTTTGAA 144141
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
New:   144371 ACAAGACGAGCAAGAGGAAGTACAAATGCCGAATAAAGAGCTTGTTCAAAGAAGTCTGAA 144430
2000-09-13 YCR014C, YCR015C 140692 140692 Substitution C T
140577 140577 Substitution C T
The systematic sequence was updated in the intergenic region between features YCR014C and YCR015C. Note that coordinates listed are chromosomal coordinates.
Old:   140531 ATGTGCGATTTGTCTAACAGGTCGCATGTTTATCCTTTACTTATTACCACTGTGACATAT 140590
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:   140926 ATGTGCGATTTGTCTAACAGGTCGCATGTTTATCCTTTACTTATTATCACTGTGACATAT 140985
Old:   140651 TTAGACCGAGACCGATTACGGAGATAGAAGAATAGTGCAAGCGAAATACTATTTTATCTT 140710
              ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
New:   141046 TTAGACCGAGACCGATTACGGAGATAGAAGAATAGTGCAAGTGAAATACTATTTTATCTT 141105
2000-09-13 YCR015C 141398 141398 Substitution A T
141089 141089 Substitution G A
The systematic sequence was updated in the region encompassing feature YCR015C. Note that coordinates listed are chromosomal coordinates.
Old:   141071 ACTATCCCCTATATACCAGTAGCTGCAAGAATTTCCTTCTTTATTGCAACCTGAGTCGAT 141130
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   141466 ACTATCCCCTATATACCAATAGCTGCAAGAATTTCCTTCTTTATTGCAACCTGAGTCGAT 141525
Old:   141371 TTTGAAACCATCTCTTAGTAAACAATCATCGTGATTCTGATCTCTGGCGAACGTTTTCAT 141430
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
New:   141766 TTTGAAACCATCTCTTAGTAAACAATCTTCGTGATTCTGATCTCTGGCGAACGTTTTCAT 141825
2000-09-13 YCR014C 140388 140389 Substitution TA CC
140065 140065 Substitution C T
140029 140029 Substitution A G
140021 140021 Substitution T C
139720 139720 Substitution T C
139624 139624 Substitution A G
139180 139180 Substitution G C
139087 139087 Substitution G T
The systematic sequence was updated in the region encompassing feature YCR014C. Note that coordinates listed are chromosomal coordinates.
Old:   139031 AATCTTCTGCAATAATTTCCATCCTTGGCATTCAGAGACATATATTGGTCAATCGGGTTT 139090
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
New:   139426 AATCTTCTGCAATAATTTCCATCCTTGGCATTCAGAGACATATATTGGTCAATCGGTTTT 139485
Old:   139151 TCTTTCAGTTCTTCTAATTCTCTTGGAGAGAATTTGACTCCCATGAAAAATTTCTTGATT 139210
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New:   139546 TCTTTCAGTTCTTCTAATTCTCTTGGAGACAATTTGACTCCCATGAAAAATTTCTTGATT 139605
Old:   139571 TCGTAATATGACCAACCAAATAAAATTGTCCAATCTGATACAAACTCCTCTGGATCCTTC 139630
              ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
New:   139966 TCGTAATATGACCAACCAAATAAAATTGTCCAATCTGATACAAACTCCTCTGGGTCCTTC 140025
Old:   139691 CCAATGCCGTAACAATTTTTGAAGTATTTTAACTTGTCTTCTAATCCCACTGAATCATTT 139750
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New:   140086 CCAATGCCGTAACAATTTTTGAAGTATTTCAACTTGTCTTCTAATCCCACTGAATCATTT 140145
Old:   139991 TCAGTAACAAGGGAAGCTCTTCCTTTATCCTCCTGTAAAAGTCGCTTAAGAGGTTTTGAA 140050
              |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||
New:   140386 TCAGTAACAAGGGAAGCTCTTCCTTTATCCCCCTGTAAGAGTCGCTTAAGAGGTTTTGAA 140445
Old:   140051 GCTTGTATCATATCCTTATTGTTGCTGTCATCATTCCTTTCACTTTCTACGTCAGTTGAA 140110
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   140446 GCTTGTATCATATCTTTATTGTTGCTGTCATCATTCCTTTCACTTTCTACGTCAGTTGAA 140505
Old:   140351 ATATCAGAATCAACAAAGGAGTCCTCAATCAAAATGATAACTTCCTTACGGCTAGATTGA 140410
              |||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||
New:   140746 ATATCAGAATCAACAAAGGAGTCCTCAATCAAAATGACCACTTCCTTACGGCTAGATTGA 140805
2000-09-13 YCR012W 137641 137642 Substitution GC CG
The systematic sequence was updated within ORF YCR012W. Note that coordinates listed are chromosomal coordinates.
Old:   137591 GAATTGCAATCATTGTTGGGTAAGGATGTCACCTTCTTGAACGACTGTGTGCGTCCAGAA 137650
              ||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||
New:   137986 GAATTGCAATCATTGTTGGGTAAGGATGTCACCTTCTTGAACGACTGTGTCGGTCCAGAA 138045
2000-09-13 YCR011C, YCR012W 136620 136620 Substitution C T
The systematic sequence was updated in the intergenic region between features YCR011C and YCR012W. Note that coordinates listed are chromosomal coordinates.
Old:   136571 TTAGATTCCTGACTTCAACTCAAGACGCACAGATATTATAACATCTGCACAATAGGCATT 136630
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   136966 TTAGATTCCTGACTTCAACTCAAGACGCACAGATATTATAACATCTGCATAATAGGCATT 137025
2000-09-13 YCR011C 136388 136388 Substitution C T
136317 136317 Substitution C T
The systematic sequence was updated within ORF YCR011C. Note that coordinates listed are chromosomal coordinates.
Old:   136271 GTTTGCATTCAAAAATAGGTAGCATACAATTAAAACATGGCGGGCACGTATCATTGCCCT 136330
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:   136666 GTTTGCATTCAAAAATAGGTAGCATACAATTAAAACATGGCGGGCATGTATCATTGCCCT 136725
Old:   136331 TATCTTGTGCAGTTAGACGCGAATTTTTCGAAGAAGTACCTTCAAAGAATGGGGTCTCAT 136390
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   136726 TATCTTGTGCAGTTAGACGCGAATTTTTCGAAGAAGTACCTTCAAAGAATGGGGTCTTAT 136785
2000-09-13 YCR010C 132954 132954 Insertion G
The systematic sequence was updated in the region upstream of ORF YCR010C. Note that coordinates listed are chromosomal coordinates.
Old:   132912 ATACAGCTTGGTGTCTCTGACAGGTTGGAGTACAGAGGAGAAG-CGCCATAGCCGCCCAA 132970
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
New:   133306 ATACAGCTTGGTGTCTCTGACAGGTTGGAGTACAGAGGAGAAGGCGCCATAGCCGCCCAA 133365
2000-09-13 YCR005C 120772 120772 Substitution A G
The systematic sequence was updated within ORF YCR005C. The T at coding coordinate 1158 was changed to a C, resulting in a silent substitution within codon 386, which codes for threonine. Note that coordinates listed below are chromosomal coordinates, and the Watson strand is shown (YCR005C is a Crick strand ORF).
Old:   120733 GACACCAGAGTGAGCATCTACATTTGGCCATGGATTTTTAGTTTTACCATGTTCAGTCAA 120792
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   121126 GACACCAGAGTGAGCATCTACATTTGGCCATGGATTTTTGGTTTTACCATGTTCAGTCAA 121185
2000-09-13 YCLWdelta5 90740 90741 Substitution CG GC
A sequence change was made in the systematic sequence in the region encompassing feature YCLWdelta5. Note that coordinates listed are chromosomal coordinates.
Old:   90732 GTGAGAGCCGCGGAACCGGCTTTTCATATAGAATAGAGAAGCGTTCATGACTAAATGCTT 90791
             ||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||
New:   91116 GTGAGAGCGCCGGAACCGGCTTTTCATATAGAATAGAGAAGCGTTCATGACTAAATGCTT 91175
2000-09-13 YCLWdelta3 84337 84337 Insertion T
One sequence change was made in the systematic sequence in the region encompassing feature YCLWdelta3. Note that coordinates listed are chromosomal coordinates.
Old:   84314 GGAATTCTAACAATTATCAAATTG-CCGCCAGTTCCTCAAAAAGATCCATGTATAATCTT 84372
             |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
New:   84700 GGAATTCTAACAATTATCAAATTGTCCGCCAGTTCCTCAAAAAGATCCATGTATAATCTT 84759
2000-09-13 YCLWdelta2a 84108 84108 Substitution G A
One sequence change was made in the systematic sequence in the region encompassing feature YCLWdelta2a. Note that coordinates listed are chromosomal coordinates.
Old:   84074 TATAAAATGATGATAATAATATTTATAGAATTGTGTAGAATTGCAGATTCCCTTTTATGG 84133
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
New:   84460 TATAAAATGATGATAATAATATTTATAGAATTGTATAGAATTGCAGATTCCCTTTTATGG 84519
2000-09-13 YCLCdelta1 83955 83955 Deletion C
83361 83361 Insertion GC
83354 83354 Insertion C
83352 83352 Substitution T A
83348 83348 Substitution T AA
83341 83341 Insertion T
83337 83337 Insertion T
83333 83333 Insertion T
83323 83323 Insertion A
83270 83271 Substitution GA AG
Several sequence changes were made in the systematic sequence in the region downstream of YCLCdelta1. Note that coordinates listed are chromosomal coordinates.
Old:   83242 GGTTCTAACCGATGCCGAAGAACTGCGCGATCCGGTTATAACGTCTGACATGTCCTTTTT 83301
             ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||
New:   83621 GGTTCTAACCGATGCCGAAGAACTGCGCAGTCCGGTTATAACGTCTGACATGTCCTTTTT 83680
Old:   83302 TGATTTGGAATCCAACCACTCA-GTGACTCTGT-CATT-ACTT-GCGAAAT-TATTCC-A 83355
             |||||||||||||||||||||| |||||||||| |||| |||| ||||||  ||| || |
New:   83681 TGATTTGGAATCCAACCACTCAAGTGACTCTGTTCATTTACTTTGCGAAAAATATACCCA 83740
Old:   83356 CAAATT--CCATCGAAAGTGAATCGCAAACCACCTTCAGACTGGCACCGACAAAGCAAAG 83413
             ||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   83741 CAAATTGCCCATCGAAAGTGAATCGCAAACCACCTTCAGACTGGCACCGACAAAGCAAAG 83800
Old:   83954 CCTAGTATATTATCATATACGGTGTTAGAAGATGACGCAAATGATGAGAAATAGTCATCT 84013
             | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   84341 C-TAGTATATTATCATATACGGTGTTAGAAGATGACGCAAATGATGAGAAATAGTCATCT 84399
1998-02-26 YCL001W 112875 112875 Insertion C
112536 112536 Insertion CA
112535 112535 Insertion T
112504 112504 Insertion C
112498 112498 Insertion C
Five separate insertions were made in the systematic sequence in the region downstream of ORF YCL001W. Single C nucleotides were inserted after the Cs at chromosomal coordinates 112498, 112504, and 112875, a T was inserted after the T at 112535, and a CA was inserted after the C at 112536. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   112482 CACACGTTTATAATGTC-ATACTC-GTGGCGTGCATGTGTTTTAGTGTATTAGTTT-C-- 112536
              ||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
New:   112473 CACACGTTTATAATGTCCATACTCCGTGGCGTGCATGTGTTTTAGTGTATTAGTTTTCCA 112532
Old:   112837 TGATGTAATAGAGAATTATCTGCGCTATATAGCTAGCAC-AGTGAACATCTATTTACTGC 112895
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   112833 TGATGTAATAGAGAATTATCTGCGCTATATAGCTAGCACCAGTGAACATCTATTTACTGC 112892
1998-02-26 YCL001W, YCL002C 111893 111893 Deletion T
111859 111859 Deletion C
111841 111842 Substitution TT G
Three separate sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL002C and YCL001W. The TT at chromosomal coordinate 111841 was changed to G, and the C at 111859 and the T at 111893 were removed. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   111822 GAAAAATCAGAAGAATTCCTTTCCATTCATCAGAAGACTTACCAGAGTTCAAATTCTGGT 111881
              |||||||||||||||||||  |||||||||||||||| ||||||||||||||||||||||
New:   111826 GAAAAATCAGAAGAATTCCG-TCCATTCATCAGAAGA-TTACCAGAGTTCAAATTCTGGT 111883
Old:   111882 ATAACAGCATTTAGAGCCACTGTCATTTCCCTCTTGTTGT 111921
              ||||||||||| ||||||||||||||||||||||||||||
New:   111884 ATAACAGCATT-AGAGCCACTGTCATTTCCCTCTTGTTGT 111922
1998-02-26 YCR057C 221416 221416 Insertion G
220246 220246 Insertion T
The systematic reference sequence of Chromosome III was updated within ORF YCR057C: A single T was inserted after the T at chromosomal coordinate 220246, and a single G was inserted after the G at chromosomal coordinate 221416. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   220235 GTTCAGAATTTT-GGCAGTGAACCTATCTTGATTAAACCTACCAGATATTATATCCTTTC 220293
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
New:   220233 GTTCAGAATTTTTGGCAGTGAACCTATCTTGATTAAACCTACCAGATATTATATCCTTTC 220292
Old:   221374 CCATAACGTAGTCTCTGTGCCCATTAAATGTTGTCGCCGCAAG-TTCTTTTCCTCTGAAT 221432
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
New:   221373 CCATAACGTAGTCTCTGTGCCCATTAAATGTTGTCGCCGCAAGGTTCTTTTCCTCTGAAT 221432
1998-02-26 YCR057C 221662 221662 Insertion C
The systematic reference sequence of Chromosome III was updated in the region upstream of ORF YCR057C: A single C was inserted after the G at 221662. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   221613 CTGAGGCTAATGCAAAGAGTCTCCCATCAGGGCTGAACTTCACAGCGGAG-ATTTTTCTT 221671
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:   221613 CTGAGGCTAATGCAAAGAGTCTCCCATCAGGGCTGAACTTCACAGCGGAGCATTTTTCTT 221672
1998-02-26 YCR054C, YCR055C 219175 219175 Substitution A G
A single nucleotide substitution was made in the systematic sequence in the region between ORFs YCR054C and YCR055C. The A at chromosomal coordinate 219175 was changed to G. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   219155 TGAATGTGCATAAATAGAGGACAGTGAATATTTTTCAAGGAAGCTCTTTCTCATTTTCTT 219214
              |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
New:   219153 TGAATGTGCATAAATAGAGGGCAGTGAATATTTTTCAAGGAAGCTCTTTCTCATTTTCTT 219212
1998-02-26 YCR080W, YCR081W 253653 253653 Substitution G C
253512 253512 Deletion A
253495 253495 Deletion A
Two single nucleotide deletions were made in the systematic sequence within ORF YCR080W: The A at chromosomal coordinate 253495 was removed, as was the A at 253512.
Old:   253472 GAAACGTGGTTGCATGAATTGAGATTCGTCTCACACTTCGACTGGTCAAAATTGGCAAGT 253531
              ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||
New:   253472 GAAACGTGGTTGCATGAATTGAG-TTCGTCTCACACTTCG-CTGGTCAAAATTGGCAAGT 253529

One single nucleotide substitution was made in the region between ORFs YCR080W and YCR081W: The G at 253653 was changed to C.

Old:   253652 AGAAAAAGAAGAGGTCAAATGCTGCTGGGGCAGATGATGCCATTTCCATGCACCTGCTAA 253711
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   253650 ACAAAAAGAAGAGGTCAAATGCTGCTGGGGCAGATGATGCCATTTCCATGCACCTGCTAA 253709

Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.

1998-02-26 YCR068W 237282 237282 Deletion C
One single nucleotide deletion was made in the systematic sequence in the region downstream of ORF YCR068W. The C at chromosomal coordinate 237282 was removed. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   237272 CCTTGGATACCGAGCAGGCTGCCAAGTGCGTTGAACCAGAGCCCTGCGTAGATTGCTACA 237331
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
New:   237273 CCTTGGATAC-GAGCAGGCTGCCAAGTGCGTTGAACCAGAGCCCTGCGTAGATTGCTACA 237331
1998-02-26 ARS307
109254 109254 Insertion A
108840 108840 Substitution C G
108792 108792 Deletion G
Three single nucleotide changes were made to the systematic sequence in the region encompassing ARS307. The G at chromosomal coordinate 108792 was deleted, the C at 108840 was changed to G, and an A was inserted after the T at 109254. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   108763 CTCTCCAGAAACCCTTCAATATAAAAAGGGCAGATGTCCGCTGCGAACCCTTCTCCATTT 108822
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New:   108768 CTCTCCAGAAACCCTTCAATATAAAAAGG-CAGATGTCCGCTGCGAACCCTTCTCCATTT 108826
Old:   108823 GGCAATTATTTGAACACCATCACTAAGTCCCTACAACAGAATTTACAAACATGCTTTCAT 108882
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   108827 GGCAATTATTTGAACACGATCACTAAGTCCCTACAACAGAATTTACAAACATGCTTTCAT 108886
Old:   109243 GGCTTACAACAT-TGAAAATATATGGGTTTGATAACGAGGTCATTCTTTCGGGAGCCAAC 109301
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
New:   109247 GGCTTACAACATATGAAAATATATGGGTTTGATAACGAGGTCATTCTTTCGGGAGCCAAC 109306
1998-02-26 YCR028C-A 173209 173209 Insertion G
A single nucleotide insertion was made in the systematic sequence in the region encompassing ORF YCR028C-A. A single G was inserted after the G at chromosomal coordinate 173209. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   173196 ATTAATACCGATAG-TAAAGGCGAATTCATGACAGAATTGGGTAAATAGTTGAGGGCAAT 173254
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   173193 ATTAATACCGATAGGTAAAGGCGAATTCATGACAGAATTGGGTAAATAGTTGAGGGCAAT 173252
1998-02-26 YCR024C-A, YCR025C 163259 163259 Substitution G A
A single nucleotide substitution was made in the systematic sequence in the intergenic region between ORFs YCR024C-A and YCR025C. The G at chromosomal coordinate 163259 was changed to A. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   163236 ATTTTACTCTGTTGGAAATGCGAGAATTGTTTTGATTTTACCCGATTGCGACCTATTCCC 163295
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   163233 ATTTTACTCTGTTGGAAATGCGAAAATTGTTTTGATTTTACCCGATTGCGACCTATTCCC 163292
1998-02-26 YCR024C-A 163030 163030 Substitution A G
A single nucleotide substitution was made in the systematic sequence in the region encompassing ORF YCR024C-A. The A at chromosomal coordinate 163030 was changed to G. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   162996 TAAAGGAAGATAAGACGCAATAAGAGAAAAAAAGAGAAGTTAAGATTACAAGAGAAACAA 163055
              |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
New:   162993 TAAAGGAAGATAAGACGCAATAAGAGAAAAAAAGGGAAGTTAAGATTACAAGAGAAACAA 163052
1998-02-26 YCL022C, YCL024W 81746 81746 Deletion C
81527 81527 Deletion C
Two separate single nucleotide deletions were made in the systematic sequence in the region encompassing overlapping ORFs YCL024W and YCL022C. A single C was deleted at chromosomal coordinate 81527, and another C was deleted at 81746. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   81470 GGATGATAGTAAGGATGGTGATAATGTGAATAATGATAATATATTGAGCGACTTTCCCTC 81529
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   81476 GGATGATAGTAAGGATGGTGATAATGTGAATAATGATAATATATTGAGCGACTTTCC-TC 81534
Old:   81710 GCCTTACAAGTAATAACAGCAGCGTCGGAGAAAACACTAGAGGATGGGGCGGAAAAAGGG 81769
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   81715 GCCTTACAAGTAATAACAGCAGCGTCGGAGAAAACA-TAGAGGATGGGGCGGAAAAAGGG 81773
1998-02-26 YCL014W 100535 100535 Insertion G
100475 100475 Deletion G
100471 100471 Insertion G
98839 98839 Deletion A
Four separate single nucleotide sequence changes were made in the systematic sequence in the region encompassing ORF YCL014W. A single A was deleted at chromosomal coordinate 98839, as was the G at 100475, and a single G was inserted after the A at 100471, and also after the G at 100535. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   98810 GTGACAGAAAATACCAGTAACGAAAAAAAATGTCGAACCAAAAGCGGATCAATCCACAAA 98869
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New:   98814 GTGACAGAAAATACCAGTAACGAAAAAAA-TGTCGAACCAAAAGCGGATCAATCCACAAA 98872
Old:   100430 TCAAGAGTCTCCTAGTGGACCATTAATCTATGTTTTGCCTCA-AGTGAGCACAAAGCATG 100488
              |||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||
New:   100433 TCAAGAGTCTCCTAGTGGACCATTAATCTATGTTTTGCCTCAGAGT-AGCACAAAGCATG 100491
Old:   100489 AGAAAGAGGGGTTCCTTCGAAAGAAACAAAAAGACGAGCCCATTTGG-TTTCCCCTAGCA 100547
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
New:   100492 AGAAAGAGGGGTTCCTTCGAAAGAAACAAAAAGACGAGCCCATTTGGGTTTCCCCTAGCA 100551
1998-02-26 YCL010C, YCL011C 103537 103537 Insertion G
103526 103526 Insertion C
103515 103515 Insertion T
103071 103071 Deletion T
Four single nucleotide changes were made in the systematic sequence in the intergenic region between ORFs YCL011C and YCL010C. A single T was deleted at chromosomal coordinate 103071, a single T was inserted after the T at chromosomal coordinate 103515, a C was inserted after the C at 103526, and a G was inserted after the G at 103537. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of some made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   103068 TTTTCAATTTTTTTCACCTTCAAGTGAATACATCACTTCCGACGATACCAAAATAATGAC 103127
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   103072 TTT-CAATTTTTTTCACCTTCAAGTGAATACATCACTTCCGACGATACCAAAATAATGAC 103130
Old:   103488 TGTACCATCTGCTACGACTTTGAGTACT-CACACTGTATC-ATTCGCCGTCG-CACTGCC 103544
              |||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||
New:   103491 TGTACCATCTGCTACGACTTTGAGTACTTCACACTGTATCCATTCGCCGTCGGCACTGCC 103550
1998-02-26 YCL010C 104254 104254 Substitution C G
One single nucleotide substitution was made in the systematic sequence in the region encompassing ORF YCL010C. The C at chromosomal coordinate 104254 was changed to G. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   104205 GCAAGGCCGAGAGACTAACCTAACCAGGTGGTAGTTGGGAAATGTCGACCATTTCGCTGA 104264
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   104211 GCAAGGCCGAGAGACTAACCTAACCAGGTGGTAGTTGGGAAATGTCGACGATTTCGCTGA 104270
1998-02-26 YCL008C, YCL009C 105580 105580 Deletion T
One single nucleotide was deleted in Chromosome III in the intergenic region between ORFs YCL009C and YCL008C to correct the systematic sequence. The T at chromosomal coordinate 105580 was removed.
Old:   105525 CGTCATCCACATGCGAAGTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGTTCAGG 105584
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
New:   105531 CGTCATCCACATGCGAAGTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGT-CAGG 105589
1998-02-26 YCL008C 106429 106429 Insertion C
106402 106402 Deletion A
106343 106343 Insertion C
105981 105981 Substitution G C
105937 105938 Substitution CC G
Several sequence changes were made to the systematic sequence in the region encompassing ORF YCL008C. The CC at chromosomal coordinate 105937 was changed to a G, the G at 105981 was changed to C, a C was inserted after the C at 106343, the A at 106402 was deleted, and a C was inserted after the T at 106429. Note that while the coordinates may appear to be different, the first four of these five changes are exact reciprocals of changes made on 1997-07-27, returning the systematic sequence to its original state in these areas. The insertion of the C after the T at 106429 is a novel change.
Old:   105885 GGCGGTTTTAGGTGTGGAGACTTGGGCTTTGGGGGCAGTGGGGGAGTATTCTCCCTCCTG 105944
              ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
New:   105890 GGCGGTTTTAGGTGTGGAGACTTGGGCTTTGGGGGCAGTGGGGGAGTATTCTG-CTCCTG 105948
Old:   105945 CTGGAGCTGCGTATTGGGCTTAGGGGGTAGACTGGGGGCCTGATCTTGTGGCGGCTCGTG 106004
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   105949 CTGGAGCTGCGTATTGGGCTTAGGGGGTAGACTGGGCGCCTGATCTTGTGGCGGCTCGTG 106008
Old:   106305 AAATACCCTTGTTCTTGGCCTTAAACTGTGAAAATTGTC-AGCAGCGCTAAAGAATCGTG 106363
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   106309 AAATACCCTTGTTCTTGGCCTTAAACTGTGAAAATTGTCCAGCAGCGCTAAAGAATCGTG 106368
Old:   106364 GAAAGTTGTTCTTCCGTCGTTATAAATGGGTTGAATGAACTTTGAACAGCCAATTGACCA 106423
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:   106369 GAAAGTTGTTCTTCCGTCGTTATAAATGGGTTGAATGA-CTTTGAACAGCCAATTGACCA 106427
Old:   106424 CCGCCT-GGGAACAGAGATCTTGCCGTTTGCAGACATCGTTGCTCTTCACTCTCTCTCTT 106482
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   106428 CCGCCTCGGGAACAGAGATCTTGCCGTTTGCAGACATCGTTGCTCTTCACTCTCTCTCTT 106487
1998-02-26 YCL005W 108615 108615 Substitution T C
One single nucleotide substitution was made to the systematic sequence in the region encompassing ORF YCL005W. The T at chromosomal coordinate 108615 was changed to C. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   108583 GTAGCACATGGACACATTCACGCCCGAACACTTCTAAAAAGCAGCCCACACAAGAAAGTA 108642
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
New:   108588 GTAGCACATGGACACATTCACGCCCGAACACTCCTAAAAAGCAGCCCACACAAGAAAGTA 108647
1998-02-26 YCL002C 111511 111511 Deletion T
A single nucleotide deletion was made in the systematic sequence in the region encompassing ORF YCL002C. The T at chromosomal coordinate 111511 was removed. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   111462 TTTGGGACTAAGTGTTACACGAAAGGCATAGAGTATCAAAAAAAGGAAGTCAAGATGGAT 111521
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   111467 TTTGGGACTAAGTGTTACACGAAAGGCATAGAGTATCAAAAAAAGGAAG-CAAGATGGAT 111525
1998-02-26 YCL001W 112074 112074 Deletion C
112025 112025 Deletion G
111987 111987 Deletion T
111983 111983 Deletion T
111978 111978 Deletion T
111975 111975 Deletion T
111971 111971 Deletion T
111967 111967 Deletion T
111963 111963 Deletion T
111956 111956 Substitution T G
111950 111950 Deletion T
111939 111940 Substitution AG GA
111924 111924 Substitution G C
Thirteen separate sequence changes were made in the systematic sequence in the region encompassing ORF YCL001W. The G at chromosomal coordinate 111924 was changed to C, the AG at 111939 was changed to GA, the T at 111956 was changed to G, and the following single nucleotides were deleted: the Ts at 111950, 111963, 111967, 111971, 111975, 111978, 111983, and 111987, the G at 112025, and the C at 112074. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   111894 AGAGCCACTGTCATTTCCCTCTTGTTGTCGGTATTTTCAATCTTCAGT 111941
              |||||||||||||||||||||||||||||| ||||||||||||||  |
New:   111895 AGAGCCACTGTCATTTCCCTCTTGTTGTCGCTATTTTCAATCTTCGAT 111942
Old:   111942 ATTCCAGTTATTTTTGCCCATTCTTTATTTGATTGTTATTTTCATTATTATTGTTTTTTT 112001
              |||||||| ||||| |||||| ||| ||| ||| || |||| ||| ||||||||||||||
New:   111943 ATTCCAGT-ATTTTGGCCCAT-CTT-ATT-GAT-GT-ATTT-CAT-ATTATTGTTTTTTT 111994
Old:   112002 TAACTATGAGAAGGCAGATTCAAGCATATGATAAAATATAGATATATACCCTTAGATATC 112061
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   111995 TAACTATGAGAAGGCAGATTCAA-CATATGATAAAATATAGATATATACCCTTAGATATC 112053
Old:   112062 GGTAAGAAGAAACTATTCTCATTCTTCTAACTGATATACCCTGACTCCACATACCTATTC 112121
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
New:   112054 GGTAAGAAGAAA-TATTCTCATTCTTCTAACTGATATACCCTGACTCCACATACCTATTC 112112
1998-02-26 YCL073C 6718 6718 Substitution A G
6608 6608 Substitution A G
7100 7100 Substitution C T
7016 7016 Substitution G A
6921 6921 Substitution A G
6884 6884 Substitution T C
6872 6872 Substitution C T
6738 6738 Substitution T C
Eight separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL073C. Note that these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:  6601 GTTCCGGATCTCTCATGAACATTGTAAACGCAAAGAACGGTACCGTACATGCCAAGCCAA 6660
           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:  6601 GTTCCGGGTCTCTCATGAACATTGTAAACGCAAAGAACGGTACCGTACATGCCAAGCCAA 6660
Old:  6661 CCGTCATTATTATTCGTTGAACATATCTGTAAGATTCAACCACAGCATCTCTTTCGGATG 6720
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:  6661 CCGTCATTATTATTCGTTGAACATATCTGTAAGATTCAACCACAGCATCTCTTTCGGGTG 6720
Old:  6721 AGCCCCAAGGATAATCATTAATGAATGTATAAGGTGATGCATATGCTATTTCTGCCAATG 6780
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:  6721 AGCCCCAAGGATAATCACTAATGAATGTATAAGGTGATGCATATGCTATTTCTGCCAATG 6780
Old:  6841 AAACGGAGGCACCGATAGCAGCGCCTAGCTTCGAAAAGGTATATTGGATGCCGGTTATTA 6900
           ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||
New:  6841 AAACGGAGGCACCGATAGCAGCGCCTAGCTTTGAAAAGGTATACTGGATGCCGGTTATTA 6900
Old:  6901 CAGCCATCCTACTATGCGTAATCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATA 6960
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
New:  6901 CAGCCATCCTACTATGCGTAGTCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATA 6960
Old:  6961 GGAGACCGCTCAAACCCATGATAACAGATGCAGCGATAACACCTTCATGAGACCCGGATC 7020
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
New:  6961 GGAGACCGCTCAAACCCATGATAACAGATGCAGCGATAACACCTTCATGAGACCCAGATC 7020
Old:  7081 CAGAAAGTTTCAGTTTCCTCGTCTTTGCCACCAACAAACTGTAGAATGGAGATGCAGTAG 7140
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
New:  7081 CAGAAAGTTTCAGTTTCCTTGTCTTTGCCACCAACAAACTGTAGAATGGAGATGCAGTAG 7140
1998-02-26 YCL063W 17831 17831 Insertion C
17606 17606 Insertion C
Two separate single nucleotide insertions were made in the systematic sequence in the region encompassing ORF YCL063W. Note that these sequence changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old: 17581 GAGGTTGAACGAGCTGGCCACCGTCC-AAATGAAGCGCCTAATGATTCTCCACAATCGCA 17639
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New: 17581 GAGGTTGAACGAGCTGGCCACCGTCCCAAATGAAGCGCCTAATGATTCTCCACAATCGCA 17640
Old: 17820 TGCAAGAAATCG-ACTTTACGTGCAGCCAAATCACATGATACTGGCTTGAACAAAAGTAA 17878
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
New: 17821 TGCAAGAAATCGCACTTTACGTGCAGCCAAATCACATGATACTGGCTTGAACAAAAGTAA 17880
1998-02-26 YCL061C 21562 21562 Insertion C
20421 20421 Deletion T
20326 20326 Deletion T
19507 19507 Deletion G
19500 19500 Deletion G
19494 19494 Deletion G
19443 19443 Insertion T
Seven separate single nucleotide sequence changes were made in the systematic sequence in the region encompassing ORF YCL061C. A single T was inserted after the G at chromosomal coordinate 19443, single G nucleotides were deleted at 19494, 19500, and 19507, single T nucleotides were deleted at 20326 and 20421, and a C was inserted after the C at 21562. Note that while some coordinates appear to be slightly different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   19439 CTGAG-ATCTAGGTCAGTAGCCGTACTTGTAATGTCTAGGTTATATTCCTCTTCAGGCCC 19497
             ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||
New:   19441 CTGAGTATCTAGGTCAGTAGCCGTACTTGTAATGTCTAGGTTATATTCCTCTTCAG-CCC 19499
Old:   19498 CGGAAGGGGGTTTTTATATTCGATAATATCTTCCACCATACTTTCAAAAAATGCGCTCGA 19557
             || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
New:   19500 CG-AAGGGG-TTTTTATATTCGATAATATCTTCCACCATACTTTCAAAAAATGCGCTCGA 19557
Old:   20278 TTCGTTAATGATATGTTTCACGTGGTGGGATTTTTTTTGCTTTAGAATTAATTTCATCAT 20337
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
New:   20278 TTCGTTAATGATATGTTTCACGTGGTGGGATTTTTTTTGCTTTAGAAT-AATTTCATCAT 20336
Old:   20398 CGGCAATTTCATTACCACTCAATTGCAAATCCAGAAGACTCTGACCCTGAGTCAGAACCG 20457
             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   20397 CGGCAATTTCATTACCACTCAAT-GCAAATCCAGAAGACTCTGACCCTGAGTCAGAACCG 20455
Old:   21538 CTGCTATCTATACGCTGTGTAGCCC-TGGCCGTCCTGTCGTGAGAGGTGTTTTCAGCGCT 21596
             ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
New:   21536 CTGCTATCTATACGCTGTGTAGCCCCTGGCCGTCCTGTCGTGAGAGGTGTTTTCAGCGCT 21595
1998-02-26 YCL054W 33687 33687 Insertion A
33665 33665 Insertion G
33604 33604 Insertion A
Three separate single nucleotide insertions were made in the systematic sequence in the region encompassing ORF YCL054W. A single A was inserted after the A at chromosomal coordinate 33604, a single G was inserted after the T at 33665, and an A was inserted after the A at 33687. Note that while some coordinates may appear to be slightly different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   33597 AAGAAAAA-TAAAGGCAATGAACGCCCGTCCTATTAAGAAGGTTGCTGAAGCTAAGGCAA 33655
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
New:   33596 AAGAAAAAATAAAGGCAATGAACGCCCGTCCTATTAAGAAGGTTGCTGAAGCTAAGGCAA 33655
Old:   33656 GAAAGAGGAT-CGTGCCGTAGCTCGGTTAGAAA-GATCAAGAAGAAGGCGGGCTTGATTA 33713
             |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||
New:   33656 GAAAGAGGATGCGTGCCGTAGCTCGGTTAGAAAAGATCAAGAAGAAGGCGGGCTTGATTA 33715
1998-02-26 YCL039W, YCL040W 52593 52593 Insertion G
52583 52584 Substitution GC CT
52580 52580 Substitution G A
52566 52566 Substitution C G
52562 52563 Substitution CC TGG
52435 52435 Substitution T C
Five separate substitutions and one single nucleotide insertion were made in the systematic sequence in the intergenic region between ORFs YCL040W and YCL039W. The T at chromosomal coordinate 52435 was changed to C, the CC at 52562 was changed to TGG, the C at 52566 was changed to G, the G at 52580 was changed to A, the GC at 52583 was changed to CT, and a G was inserted after the G at 52593. Note that these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   52494 CGGGCCTTTGGTTTTTAAGGGAAAATGAAGAACAATAAATGTCTTGCTAGGTCTTCCTTT 52553
             ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
New:   52496 CGGGCCTTTGGTTTTTAAGGGAAAATGAAGAACAATAAATGCCTTGCTAGGTCTTCCTTT 52555
Old:   52554 ATCATTTTCC-AACTCAAATATGAAAAGCAGCTCCAAGGGG-CGTACTACTTCAACTAAT 52611
             ||||||||   || ||||||||||||| ||  ||||||||| ||||||||||||||||||
New:   52556 ATCATTTTTGGAAGTCAAATATGAAAAACACTTCCAAGGGGGCGTACTACTTCAACTAAT 52615
1998-02-26 YCL034W 62135 62135 Insertion G
62133 62133 Insertion G
Two separate single nucleotide insertions were made in the systematic sequence in the region encompassing ORF YCL034W. A single G nucleotide was inserted after the G at chromosomal coordinate 62133, and another G was inserted after the G at 62135. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   62092 TCAAACAGAGGTACTCGAAGAGCAGCCGTTCCCGCCGTAGCG-CG-AGGCTCTGGCGGAC 62149
             |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
New:   62096 TCAAACAGAGGTACTCGAAGAGCAGCCGTTCCCGCCGTAGCGGCGGAGGCTCTGGCGGAC 62155
1997-07-27 ARS307
108844 108844 Substitution G C
108796 108796 Insertion G
109259 109259 Deletion A
Three sequence changes were made to Chromosome III within ARS307 to correct the systematic reference sequence: A single G was inserted after chromosomal coordinate 108796, the G at 108844 was changed to a C, and the A at 109259 was deleted.
New:   108769 TCTCCAGAAACCCTTCAATATAAAAAGGGCAGATGTCCGCTGCGAACCCTTCTCCATTTG 108828
              |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Old:   108769 TCTCCAGAAACCCTTCAATATAAAAAGG-CAGATGTCCGCTGCGAACCCTTCTCCATTTG 108827
New:   108829 GCAATTATTTGAACACCATCACTAAGTCCCTACAACAGAATTTACAAACATGCTTTCATT 108888
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old:   108828 GCAATTATTTGAACACGATCACTAAGTCCCTACAACAGAATTTACAAACATGCTTTCATT 108887
New:   109249 GCTTACAACAT-TGAAAATATATGGGTTTGATAACGAGGTCATTCTTTCGGGAGCCAACC 109307
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old:   109248 GCTTACAACATATGAAAATATATGGGTTTGATAACGAGGTCATTCTTTCGGGAGCCAACC 109307
1997-07-27 YCR028C-A 173207 173207 Deletion G
A single nucleotide deletion was made in Chromosome III within the ORF YCR028C-A to correct the systematic reference sequence: The G at chromosomal coordinate 173207 was removed.
New:   173194 TTAATACCGATAG-TAAAGGCGAATTCATGACAGAATTGGGTAAATAGTTGAGGGCAATT 173252
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old:   173194 TTAATACCGATAGGTAAAGGCGAATTCATGACAGAATTGGGTAAATAGTTGAGGGCAATT 173253
1997-07-27 YCR024C-A, YCR025C 163256 163256 Substitution A G
A single nucleotide substitution was made in Chromosome III within the intergenic region between ORFs YCR024C-A and YCR025C to correct the systematic reference sequence: The A at chromosomal coordinate 163256 was changed to G.
New:   163234 TTTTACTCTGTTGGAAATGCGAGAATTGTTTTGATTTTACCCGATTGCGACCTATTCCCG 163293
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old:   163234 TTTTACTCTGTTGGAAATGCGAAAATTGTTTTGATTTTACCCGATTGCGACCTATTCCCG 163293
1997-07-27 YCR024C-A 163027 163027 Substitution G A
A single nucleotide substitution was made in Chromosome III within the ORF YCR024C-A to correct the systematic reference sequence: The G at chromosomal coordinate 163027 was changed to A.
New:   162994 AAAGGAAGATAAGACGCAATAAGAGAAAAAAAGAGAAGTTAAGATTACAAGAGAAACAAT 163053
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old:   162994 AAAGGAAGATAAGACGCAATAAGAGAAAAAAAGGGAAGTTAAGATTACAAGAGAAACAAT 163053
1997-07-27 YCL022C, YCL024W 81750 81750 Insertion C
81532 81532 Insertion C
Two single nucleotide insertions were made within the ORF YCL024W to correct the systematic reference sequence: A C was inserted after chromosomal coordinate 81532, and also after 81750. Note that the change at 81750 is also within overlapping ORF YCL022C.
New:   81476 GGATGATAGTAAGGATGGTGATAATGTGAATAATGATAATATATTGAGCGACTTTCCCTC 81535
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Old:   81476 GGATGATAGTAAGGATGGTGATAATGTGAATAATGATAATATATTGAGCGACTTTCC-TC 81534
New:   81715 GCCTTACAAGTAATAACAGCAGCGTCGGAGAAAACACTAGAGGATGGGGCGGAAAAAGGG 81774
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old:   81715 GCCTTACAAGTAATAACAGCAGCGTCGGAGAAAACA-TAGAGGATGGGGCGGAAAAAGGG 81773
1997-07-27 YCL014W 100539 100539 Deletion G
100478 100478 Insertion G
100475 100475 Deletion G
98842 98842 Insertion A
Two single nucleotide deletions and two single nucleotide insertions were made within the ORF YCL014W to correct the systematic reference sequence: The G at chromosomal coordinate 100475 was removed, as was the G at 100539, a single A was inserted after chromosomal coordinate 98842, and a single G was inserted after chromosomal coordinate 100478.
New:   98814 GTGACAGAAAATACCAGTAACGAAAAAAAATGTCGAACCAAAAGCGGATCAATCCACAAA 98873
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Old:   98814 GTGACAGAAAATACCAGTAACGAAAAAAA-TGTCGAACCAAAAGCGGATCAATCCACAAA 98872
New:   100434 TCAAGAGTCTCCTAGTGGACCATTAATCTATGTTTTGCCTCA-AGTGAGCACAAAGCATG 100492
              |||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||
Old:   100433 TCAAGAGTCTCCTAGTGGACCATTAATCTATGTTTTGCCTCAGAGT-AGCACAAAGCATG 100491
New:   100493 AGAAAGAGGGGTTCCTTCGAAAGAAACAAAAAGACGAGCCCATTTGG-TTTCCCCTAGCA 100551
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old:   100492 AGAAAGAGGGGTTCCTTCGAAAGAAACAAAAAGACGAGCCCATTTGGGTTTCCCCTAGCA 100551
1997-07-27 YCL010C, YCL011C 103543 103543 Deletion G
103531 103531 Deletion C
103519 103519 Deletion T
103074 103074 Insertion T
Four single nucleotide changes were made within the intergenic region between ORFs YCL011C and YCL010C to correct the systematic reference sequence: A T was inserted after chromosomal coordinate 103074, the T at chromosomal coordinate 103519 was removed, as was the C at 103531, and the G at 103543.
New:   103072 TTTTCAATTTTTTTCACCTTCAAGTGAATACATCACTTCCGACGATACCAAAATAATGAC 103131
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old:   103072 TTT-CAATTTTTTTCACCTTCAAGTGAATACATCACTTCCGACGATACCAAAATAATGAC 103130
New:   103492 TGTACCATCTGCTACGACTTTGAGTACT-CACACTGTATC-ATTCGCCGTCG-CACTGCC 103548
              |||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||
Old:   103491 TGTACCATCTGCTACGACTTTGAGTACTTCACACTGTATCCATTCGCCGTCGGCACTGCC 103550
1997-07-27 YCL009C 104260 104260 Substitution G C
A single nucleotide substitution was made in Chromosome III within the ORF YCL009C to correct the systematic reference sequence: The G at 104260 was changed to a C.
New:   104205 GCAAGGCCGAGAGACTAACCTAACCAGGTGGTAGTTGGGAAATGTCGACCATTTCGCTGA 104264
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old:   104211 GCAAGGCCGAGAGACTAACCTAACCAGGTGGTAGTTGGGAAATGTCGACGATTTCGCTGA 104270
1997-07-27 YCL008C 106435 106435 Substitution C G
106407 106407 Insertion A
106349 106349 Deletion C
105986 105986 Substitution C G
105943 105943 Substitution G CC
Three nucleotide substitutions, one single nucleotide deletion, and one single nucleotide insertion were made in Chromosome III within the ORF YCL008C to correct the systematic reference sequence: The G at 105943 was changed to CC, the Cs at 105986 and 106435 were changed to Gs, the C at 106349 was deleted, and an A was inserted after chromosomal coordinate 106407.
New:   105891 GGCGGTTTTAGGTGTGGAGACTTGGGCTTTGGGGGCAGTGGGGGAGTATTCTCCCTCCTG 105950
              ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
Old:   105891 GGCGGTTTTAGGTGTGGAGACTTGGGCTTTGGGGGCAGTGGGGGAGTATTCTG-CTCCTG 105949
New:   105951 CTGGAGCTGCGTATTGGGCTTAGGGGGTAGACTGGGGGCCTGATCTTGTGGCGGCTCGTG 106010
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old:   105950 CTGGAGCTGCGTATTGGGCTTAGGGGGTAGACTGGGCGCCTGATCTTGTGGCGGCTCGTG 106009
New:   106311 AAATACCCTTGTTCTTGGCCTTAAACTGTGAAAATTGTC-AGCAGCGCTAAAGAATCGTG 106369
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old:   106310 AAATACCCTTGTTCTTGGCCTTAAACTGTGAAAATTGTCCAGCAGCGCTAAAGAATCGTG 106369
New:   106370 GAAAGTTGTTCTTCCGTCGTTATAAATGGGTTGAATGAACTTTGAACAGCCAATTGACCA 106429
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Old:   106370 GAAAGTTGTTCTTCCGTCGTTATAAATGGGTTGAATGA-CTTTGAACAGCCAATTGACCA 106428
New:   106430 CCGCCTGGGAACAGAGATCTTGCCGTTTGCAGACATCGTTGCTCTTCACTCTCTCTCTTT 106489
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Old:   106429 CCGCCTCGGAACAGAGATCTTGCCGTTTGCAGACATCGTTGCTCTTCACTCTCTCTCTTT 106488
1997-07-27 YCL005W 108620 108620 Substitution C T
A single nucleotide substitution was made in Chromosome III within the ORF YCL005W to correct the systematic reference sequence: The C at 108620 was changed to a T.
New:   108589 TAGCACATGGACACATTCACGCCCGAACACTTCTAAAAAGCAGCCCACACAAGAAAGTAG 108648
              ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old:   108589 TAGCACATGGACACATTCACGCCCGAACACTCCTAAAAAGCAGCCCACACAAGAAAGTAG 108648
1997-07-27 YCL002C 111515 111515 Insertion T
A single sequence change was made in Chromosome III within the ORF YCL002C to correct the systematic reference sequence: A single T was inserted after chromosomal coordinate 111515.
New:   111468 TTGGGACTAAGTGTTACACGAAAGGCATAGAGTATCAAAAAAAGGAAGTCAAGATGGATT 111527
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old:   111468 TTGGGACTAAGTGTTACACGAAAGGCATAGAGTATCAAAAAAAGGAAG-CAAGATGGATT 111526
1997-07-27 YCL073C 7100 7100 Substitution T C
7016 7016 Substitution A G
6921 6921 Substitution G A
6884 6884 Substitution C T
6872 6872 Substitution T C
6738 6738 Substitution C T
6718 6718 Substitution G A
6608 6608 Substitution G A
The following nucleotide substitutions were made within the ORF YCL073C to correct the systematic reference sequence: G to A at chromosomal coordinate 6608, G to A at 6718, C to T at 6738, T to C at 6872, C to T at 6884, G to A at 6921, A to G at 7016, T to C at 7100.
New:    6601 GTTCCGGATCTCTCATGAACATTGTAAACGCAAAGAACGGTACCGTACATGCCAAGCCAA 6660
             ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Old:    6601 GTTCCGGGTCTCTCATGAACATTGTAAACGCAAAGAACGGTACCGTACATGCCAAGCCAA 6660
New:    6661 CCGTCATTATTATTCGTTGAACATATCTGTAAGATTCAACCACAGCATCTCTTTCGGATG 6720
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Old:    6661 CCGTCATTATTATTCGTTGAACATATCTGTAAGATTCAACCACAGCATCTCTTTCGGGTG 6720
New:    6721 AGCCCCAAGGATAATCATTAATGAATGTATAAGGTGATGCATATGCTATTTCTGCCAATG 6780
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old:    6721 AGCCCCAAGGATAATCACTAATGAATGTATAAGGTGATGCATATGCTATTTCTGCCAATG 6780
New:    6841 AAACGGAGGCACCGATAGCAGCGCCTAGCTTCGAAAAGGTATATTGGATGCCGGTTATTA 6900
             ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||
Old:    6841 AAACGGAGGCACCGATAGCAGCGCCTAGCTTTGAAAAGGTATACTGGATGCCGGTTATTA 6900
New:    6901 CAGCCATCCTACTATGCGTAATCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATA 6960
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Old:    6901 CAGCCATCCTACTATGCGTAGTCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATA 6960
New:    6961 GGAGACCGCTCAAACCCATGATAACAGATGCAGCGATAACACCTTCATGAGACCCGGATC 7020
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Old:    6961 GGAGACCGCTCAAACCCATGATAACAGATGCAGCGATAACACCTTCATGAGACCCAGATC 7020
New:    7081 CAGAAAGTTTCAGTTTCCTCGTCTTTGCCACCAACAAACTGTAGAATGGAGATGCAGTAG 7140
             ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Old:    7081 CAGAAAGTTTCAGTTTCCTTGTCTTTGCCACCAACAAACTGTAGAATGGAGATGCAGTAG 7140
1997-07-27 YCL063W 17833 17833 Deletion C
17607 17607 Deletion C
Two single nucleotide deletions were made within the ORF YCL063W to correct the systematic reference sequence: The C at chromosomal coordinate 17607 was removed, as was the C at 17833.
New:   17581 GAGGTTGAACGAGCTGGCCACCGTCC-AAATGAAGCGCCTAATGATTCTCCACAATCGCA 17639
             |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Old:   17581 GAGGTTGAACGAGCTGGCCACCGTCCCAAATGAAGCGCCTAATGATTCTCCACAATCGCA 17640
New:   17820 TGCAAGAAATCG-ACTTTACGTGCAGCCAAATCACATGATACTGGCTTGAACAAAAGTAA 17878
             |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Old:   17821 TGCAAGAAATCGCACTTTACGTGCAGCCAAATCACATGATACTGGCTTGAACAAAAGTAA 17880
1997-07-27 YCL061C 21561 21561 Deletion C
20419 20419 Insertion T
20325 20325 Insertion T
19507 19507 Insertion G
19501 19501 Insertion G
19496 19496 Insertion G
19446 19446 Deletion T
Two single nucleotide deletions and five single nucleotide insertions were made within the ORF YCL061C to correct the systematic reference sequence: The T at chromosomal coordinate 19446 was removed, as was the C at 21561, single Gs were inserted after chromosomal coordinates 19496, 19501, and 19507, and single Ts were inserted after chromosomal coordinates 20325 and 20419.
New:   19439 CTGAG-ATCTAGGTCAGTAGCCGTACTTGTAATGTCTAGGTTATATTCCTCTTCAGGCCC 19497
             ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||
Old:   19441 CTGAGTATCTAGGTCAGTAGCCGTACTTGTAATGTCTAGGTTATATTCCTCTTCAG-CCC 19499
New:   19498 CGGAAGGGGGTTTTTATATTCGATAATATCTTCCACCATACTTTCAAAAAATGCGCTCGA 19557
             || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Old:   19500 CG-AAGGGG-TTTTTATATTCGATAATATCTTCCACCATACTTTCAAAAAATGCGCTCGA 19557
New:   20278 TTCGTTAATGATATGTTTCACGTGGTGGGATTTTTTTTGCTTTAGAATTAATTTCATCAT 20337
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old:   20278 TTCGTTAATGATATGTTTCACGTGGTGGGATTTTTTTTGCTTTAGAAT-AATTTCATCAT 20336
New:   20398 CGGCAATTTCATTACCACTCAATTGCAAATCCAGAAGACTCTGACCCTGAGTCAGAACCG 20457
             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old:   20397 CGGCAATTTCATTACCACTCAAT-GCAAATCCAGAAGACTCTGACCCTGAGTCAGAACCG 20455
New:   21538 CTGCTATCTATACGCTGTGTAGCCC-TGGCCGTCCTGTCGTGAGAGGTGTTTTCAGCGCT 21596
             ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Old:   21536 CTGCTATCTATACGCTGTGTAGCCCCTGGCCGTCCTGTCGTGAGAGGTGTTTTCAGCGCT 21595
1997-07-27 YCL054W 33689 33689 Deletion A
33666 33666 Deletion G
33604 33604 Deletion A
Three single nucleotide deletions were made within the ORF YCL054W to correct the systematic reference sequence: The A at chromosomal coordinate 33604 was removed, as was the G at 33666, and the A at 33689.
New:   33597 AAGAAAAA-TAAAGGCAATGAACGCCCGTCCTATTAAGAAGGTTGCTGAAGCTAAGGCAA 33655
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Old:   33596 AAGAAAAAATAAAGGCAATGAACGCCCGTCCTATTAAGAAGGTTGCTGAAGCTAAGGCAA 33655
New:   33656 GAAAGAGGAT-CGTGCCGTAGCTCGGTTAGAAA-GATCAAGAAGAAGGCGGGCTTGATTA 33713
             |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||
Old:   33656 GAAAGAGGATGCGTGCCGTAGCTCGGTTAGAAAAGATCAAGAAGAAGGCGGGCTTGATTA 33715
1997-07-27 YCL039W, YCL040W 52597 52597 Deletion G
52586 52587 Substitution CT GC
52583 52583 Substitution A G
52569 52569 Substitution G C
52564 52566 Substitution TGG CC
52537 52537 Substitution C T
Several changes were made within the intergenic region between ORFs YCL040W and YCL039W to correct the systematic reference sequence:
New:   52494 CGGGCCTTTGGTTTTTAAGGGAAAATGAAGAACAATAAATGTCTTGCTAGGTCTTCCTTT 52553
             ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old:   52496 CGGGCCTTTGGTTTTTAAGGGAAAATGAAGAACAATAAATGCCTTGCTAGGTCTTCCTTT 52555
New:   52554 ATCATTTTCC-AACTCAAATATGAAAAGCAGCTCCAAGGGG-CGTACTACTTCAACTAAT 52611
             ||||||||   || ||||||||||||| ||  ||||||||| ||||||||||||||||||
Old:   52556 ATCATTTTTGGAAGTCAAATATGAAAAACACTTCCAAGGGGGCGTACTACTTCAACTAAT 52615
1997-07-27 YCL034W 62141 62141 Deletion G
62138 62138 Deletion G
Two single nucleotide deletions were made within the ORF YCL034W to correct the systematic reference sequence: the G at chromosomal coordinate 62138 and the G at 62141 were removed.
New:   62096 TCAAACAGAGGTACTCGAAGAGCAGCCGTTCCCGCCGTAGCG-CG-AGGCTCTGGCGGAC 62153
             |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
Old:   62096 TCAAACAGAGGTACTCGAAGAGCAGCCGTTCCCGCCGTAGCGGCGGAGGCTCTGGCGGAC 62155
1997-07-27 YCL001W 112065 112065 Insertion C
112017 112017 Insertion G
111980 111980 Insertion T
111977 111977 Insertion T
111973 111973 Insertion T
111971 111971 Insertion T
111968 111968 Insertion T
111962 111962 Insertion T
111956 111956 Substitution G T
111950 111950 Insertion T
111940 111941 Substitution GA AG
111925 111925 Substitution C G
111965 111965 Insertion T
Thirteen sequence changes were made in Chromosome III within the ORF YCL001W to correct the systematic reference sequence: The C at chromosomal coordinate 111925 was changed to G, the GA at 111940-1 was changed to AG, the G at 111956 was changed to T, a single G was inserted after the A at 112017, a single C was inserted after the A at 112065, and single Ts were inserted after chromosomal coordinates 111950, 111962, 111965, 111968, 111971, 111973, 111977, and 111980.
New:   111908 GTCATTTCCCTCTTGTTGTCGGTATTTTCAATCTTCAGTA 111947
              ||||||||||||||||||||| ||||||||||||||  ||
Old:   111904 GTCATTTCCCTCTTGTTGTCGCTATTTTCAATCTTCGATA 111943
New:   111948 TTCCAGTTATTTTTGCCCATTCTTTATTTGATTGTTATTTTCATTATTATTGTTTTTTTT 112007
              ||||||| ||||| |||||| ||| ||| ||| || |||| ||| |||||||||||||||
Old:   111944 TTCCAGT-ATTTTGGCCCAT-CTT-ATT-GAT-GT-ATTT-CAT-ATTATTGTTTTTTTT 111995
New:   112008 AACTATGAGAAGGCAGATTCAAGCATATGATAAAATATAGATATATACCCTTAGATATCG 112067
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old:   111996 AACTATGAGAAGGCAGATTCAA-CATATGATAAAATATAGATATATACCCTTAGATATCG 112054
New:   112068 GTAAGAAGAAACTATTCTCATTCTTCTAACTGATATACCCTGACTCCACATACCTATTCA 112127
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old:   112055 GTAAGAAGAAA-TATTCTCATTCTTCTAACTGATATACCCTGACTCCACATACCTATTCA 112113
1997-07-27 YCL001W 112872 112872 Deletion C
112531 112532 Deletion CA
112529 112529 Deletion T
112497 112497 Deletion C
112490 112490 Deletion C
Five deletions were made in Chromosome III in the region downstream of ORF YCL001W to correct the systematic reference sequence: The Cs at chromosomal coordinates 112490, 112497, and 112872 were deleted, as was the T at 112529, and the CA at 112531-2.
New:   112474 ACACGTTTATAATGTC-ATACTC-GTGGCGTGCATGTGTTTTAGTGTATTAGTTT-C--A 112528
              |||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |  |
Old:   112474 ACACGTTTATAATGTCCATACTCCGTGGCGTGCATGTGTTTTAGTGTATTAGTTTTCCAA 112533
New:   112829 GATGTAATAGAGAATTATCTGCGCTATATAGCTAGCAC-AGTGAACATCTATTTACTGCT 112887
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Old:   112834 GATGTAATAGAGAATTATCTGCGCTATATAGCTAGCACCAGTGAACATCTATTTACTGCT 112893
1997-07-27 YCR057C 221663 221663 Deletion C
The systematic reference sequence of Chromosome III was updated upstream of ORF YCR057C: The C at chromosomal coordinate 221663 was removed.
New:   221612 TGAGGCTAATGCAAAGAGTCTCCCATCAGGGCTGAACTTCACAGCGGAG-ATTTTTCTTT 221670
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old:   221614 TGAGGCTAATGCAAAGAGTCTCCCATCAGGGCTGAACTTCACAGCGGAGCATTTTTCTTT 221673
1997-07-27 YCR057C 221416 221416 Deletion G
220245 220245 Deletion T
The systematic reference sequence of Chromosome III was updated within ORF YCR057C: The T at chromosomal coordinate 220245 was removed, and the G at chromosomal coordinate 221416 was removed.
New:   220234 TTCAGAATTTT-GGCAGTGAACCTATCTTGATTAAACCTACCAGATATTATATCCTTTCT 220292
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old:   220234 TTCAGAATTTTTGGCAGTGAACCTATCTTGATTAAACCTACCAGATATTATATCCTTTCT 220293
New:   221373 CATAACGTAGTCTCTGTGCCCATTAAATGTTGTCGCCGCAAG-TTCTTTTCCTCTGAATC 221431
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old:   221374 CATAACGTAGTCTCTGTGCCCATTAAATGTTGTCGCCGCAAGGTTCTTTTCCTCTGAATC 221433
1997-07-27 YCR054C, YCR055C 219173 219173 Substitution G A
A single nucleotide substitution was made in Chromosome III between ORFs YCR054C and YCR055C to correct the systematic reference sequence: The G at chromosomal coordinate 219173 was changed to A.
New:   219154 GAATGTGCATAAATAGAGGACAGTGAATATTTTTCAAGGAAGCTCTTTCTCATTTTCTTC 219213
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Old:   219154 GAATGTGCATAAATAGAGGGCAGTGAATATTTTTCAAGGAAGCTCTTTCTCATTTTCTTC 219213
1997-07-27 YCR080W, YCR081W 253651 253651 Substitution C G
253510 253510 Insertion A
253494 253494 Insertion A
Two single nucleotide insertions were made in Chromosome III within the ORF YCR080W to correct the systematic reference sequence: An A was inserted after the G at chromosomal coordinate 253494, and another A was inserted after the G at 253510.
New:   253473 AAACGTGGTTGCATGAATTGAGATTCGTCTCACACTTCGACTGGTCAAAATTGGCAAGTT 253532
              |||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||
Old:   253473 AAACGTGGTTGCATGAATTGAG-TTCGTCTCACACTTCG-CTGGTCAAAATTGGCAAGTT 253530
One single nucleotide substitution was made in the region between ORFs YCR080W and YCR081W: the C at 253651 was changed to G.
New:   253653 GAAAAAGAAGAGGTCAAATGCTGCTGGGGCAGATGATGCCATTTCCATGCACCTGCTAAA 253712
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old:   253651 CAAAAAGAAGAGGTCAAATGCTGCTGGGGCAGATGATGCCATTTCCATGCACCTGCTAAA 253710
1997-07-27 YCR068W 237282 237282 Insertion C
One single nucleotide insertion was made in Chromosome III downstream of ORF YCR068W to correct the systematic reference sequence: A single C was inserted after the G at chromosomal coordinate 237282.
New:   237274 CTTGGATACCGAGCAGGCTGCCAAGTGCGTTGAACCAGAGCCCTGCGTAGATTGCTACAA 237333
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Old:   237274 CTTGGATAC-GAGCAGGCTGCCAAGTGCGTTGAACCAGAGCCCTGCGTAGATTGCTACAA 237332



Annotation Changes without sequence changes

Date Affected Features
2014-11-18 ARS314, ARS315, ARS316

As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome III based on Liachko et al. 2013: ARS314, ARS315, ARS316.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704.
SGD paper | PubMed | Full-Text

2014-11-18 ARS300, ARS305, ARS307, ARS309, ARS313, ARS314, ARS317, ARS318, ARS319

The chromosomal coordinates of the following ARS elements on Chromosome III were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS300, ARS305, ARS307, ARS309, ARS313, ARS314, ARS317, ARS318, ARS319.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704.
SGD paper | PubMed | Full-Text

2014-11-18 YCL054W-A

RDT1/YCL054W-A was added to the genome annotation based on Wilson and Masel 2011 as part of SGD's genome annotation revision R64.2.

Wilson BA and Masel J (2011) Putatively noncoding transcripts show extensive association with ribosomes. Genome Biol Evol 3():1245-52
SGD paper | PubMed | Full-Text

2009-02-19 ARS318

The position of the annotated ACS within ARS318 was updated based on Chang et al. 2008.

Chang F, et al. (2008) Analysis of chromosome III replicators reveals an unusual structure for the ARS318 silencer origin and a conserved WTW sequence within the origin recognition complex binding site. Mol Cell Biol 28(16):5071-81
SGD paper | PubMed | Full-Text

2008-06-04 YCLWdelta15

Carol Newlon identified an additional delta element on Chromosome III. This delta element is present in the current Chromosome III sequence, but was not in Newlon's clone A5C, which was used to generate the original Chromosome III sequence. The new delta element is being named YCLWdelta15, and is between tE(UUC)C and YCLCdelta1.
Newlon C (2008)
SGD paper

2008-03-05 YCRCtau1

YCRCtau1 was erroneously annotated on the Watson strand instead of the Crick strand. This error has been corrected. Thank you to Douda Bensasson from bringing this mistake to our attention.
Bensasson D (2008)
SGD papers

2007-12-14 HML, HMR, MATALPHA

The W, X, Y, Z1 and Z2 regions of the mating-type loci (HML, MAT, and HMR cassettes) were annotated based on Abraham et al. 1984, Astell et al. 1981, Tatchell et al. 1981, and Wang et al. 2001.

Astell CR, et al. (1981) The sequence of the DNAs coding for the mating-type loci of Saccharomyces cerevisiae. Cell 27(1 Pt 2):15-23 SGD paper | PubMed | Full-Text
Abraham J, et al. (1984) Regulation of mating-type information in yeast. Negative control requiring sequences both 5' and 3' to the regulated region. J Mol Biol 176(3):307-31 SGD paper | PubMed | Full-Text
Tatchell K, et al. (1981) In vitro mutation analysis of the mating-type locus in yeast. Cell 27(1 Pt 2):25-35 SGD paper | PubMed | Full-Text
Wang Y, et al. (2001) DNA replication forks pause at silent origins near the HML locus in budding yeast. Mol Cell Biol 21(15):4938-48 SGD paper | PubMed | Full-Text

2007-09-06 YCR092C

Based on experimental evidence published by Harrington and Kolodner, the start site for MSH3/YCR092C was moved 84 nt (28 codons) downstream. This change is consistent with that predicted by Kellis et al. 2003.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Harrington JM and Kolodner RD (2007) Saccharomyces cerevisiae Msh2-Msh3 acts in repair of base-base mispairs. Mol Cell Biol 27(18):6546-54
SGD paper | PubMed | Full-Text

2007-04-02 YCLCdelta1, YCRCdelta14, YCRCdelta6, YCRCdelta7

The following LTRs on Chromosome III were mistakenly annotated in the wrong direction (i.e., on the Watson strand instead of Crick), and the error has now been corrected: YCLCdelta1, YCRCdelta6, YCRCdelta7, YCRCdelta14. Thanks go to Marc Gartenberg for bringing this annotation error to our attention.

2007-03-06 ARS317

The ACS annotation was added based on Xu et al. 2006 and Brand et al. 1987.

Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276
SGD paper | PubMed | Full-Text
Brand AH, et al. (1987) A yeast silencer contains sequences that can promote autonomous plasmid replication and transcriptional activation. Cell 51(5):709-19
SGD Paper | PubMed | Full-Text

2006-09-06 ARS313, ARS314, ARS315, ARS316

The coordinates of the following ARS elements on Chromosome III were updated based on Nieduszynski et al. 2006: ARS313, ARS314, ARS315, ARS316.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD papers | PubMed Entry | Full-Text | Web Supplement

2006-01-11 YCL058W-A

YCL058W-A was originally added per Brachat et al., based on conservation with Ashbya gossypii. Kellis et al. also predicted a protein in the same frame, but with a 19 amino acid N-terminal deletion relative to the ORF predicted by Brachat et al. SGD has changed the annotation to that predicted by Kellis et al., based on conservation of that start site in sensu stricto strains of Saccharomyces.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text

2005-11-14 YCL048W-A

Based on genome sequence comparisons among six Saccharomyces species, Cliften et al. 2003 suggested that a new ORF, YCL048W-A, be added to the S. cerevisiae genome annotation. This suggestion was later confirmed by Zhang and Dietrich 2005 using high-throughput identification of transcription start sites.

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement
Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51.
SGD paper | PubMed | Full-Text | YFGdb

2004-10-12 CEN3

Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60
SGD paper | PubMed Full-Text
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
SGD paper | PubMed Full-Text

2004-08-27 YCR095W-A

The ORF YCR095W-A was added per Oshiro et al. 2002.

Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20.
SGD paper | PubMed | Full-Text | Web Supplement | YFGdb

2003-09-27 YCL002C

Based on the alignment of orthologs in related Saccharomyces species, Cliften et al. proposed an intron and new 5' exon for YCL002C. The resulting ORF is in the same frame, but has a 99-residue extension at the N-terminus.
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YCL037C

Based on the automated comparison of closely-related Saccharomyces species in Kellis et al. 2003, the start site for SRO9/YCL037C was moved 96 nt (32 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-09 TEL03L, TEL03R

The chromosomal locations for the following telomeric features were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL03L, TEL03L-XC, TEL03L-XR, TEL03L-TR, TEL03R, TEL03R-XC, TEL03R-XR, TEL03R-TR.

2003-07-29 YCR108C

Thanks to Kessler et al. for providing the coordinates of ORF YCR108C.

Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71.
SGD paper | PubMed | Full-Text

2003-07-29 YCR045W-A, YCR047W-A, YCR081C-A

Thanks to Kumar et al. for providing the coordinates of the following ORFs on Chromosome III: YCR045W-A, YCR047W-A, YCR081C-A.

Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63.
SGD paper | PubMed | Full-Text | YFGdb | Comments & Errata

2003-07-29 YCL005W-A, YCL058W-A, YCR075W-A

Thanks to Brachat et al. 2003 for providing the coordinates of the following ORFs on Chromosome III: YCL005W-A, YCL058W-A, YCR075W-A.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text

2000-12-01 YCL024W

The stop site of ORF YCL024W was moved 366 nt downstream, changing the relative coding coordinates from 1-2748 to 1-3114. Chromosomal coordinates change from 79125-81872 to 79161-82274.

2000-12-01 YCL010C

The stop site of YCL010C was moved 339 nt upstream, increasing the size of the coding region from 441 nt to 780 nt. The chromosomal coordinates have changed from 103995-103515 to 104345-103566.

2000-12-01 YCL008C

The start site of YCL008C was moved 252 nt upstream, and the stop site was moved 179 nt downstream, increasing the size of the coding region from 360 nt to 891 nt. The chromosomal coordinates have changed from 106208-105849 to 106849-105959.

2000-10-13 YCR103C

YCR103C was originally annotated as an ORF, but upon further review was removed from the genome annotation.

2000-09-14 YCR061W, YCR062W

After resequencing and annotation of Chromosome III, ORF YCR062W has been merged into neighboring ORF YCR061W. The coding region of YCR061W had been 1752 nt long, but is now 1896 nt in length.

2000-09-14 YCL021W-A, YCL026C-B, YCL057C-A

The following ORFs were added after the MIPS ChrIII sequence update: YCL021W-A, YCL026C-B, YCL057C-A.

2000-09-13 YCRCdelta7

YCRCdelta7 was shortened from 380 bp to 323 bp, a net decrease of 57 bp.

2000-09-13 YCL025C

The stop site of ORF YCL025C was moved 114 nt upstream, changing the relative coding coordinates from 1-1902 to 1-1788. Chromosomal coordinates change from 77886-75985 to 77918-76131.

2000-08-16 YCL006C

YCL006C was deleted as a result of a sequence change that created a stop codon after residue 23.

2000-08-11 YCR069W

Old name: YCR070W; new name: YCR069W; date: 2/15/2000; old coord: ChrIII; SGDID: Unknown; YCR070W incorporated into YCR069W

2000-02-10 YCL003W, YCL004W

YCL003W was originally annotated as an independent ORF, but as a result of a sequence change, it was merged with an adjacent ORF into a single reading frame, designated YCL004W. YCL004W + YCL003W = YCL004W from MIPS.

1999-07-17 YCL054W

The stop site of ORF YCL054W was moved 351 nucleotides downstream, increasing the length of the coding sequence from 2175 nt to 2526 nt.

1999-07-17 YCL012W

The stop site of ORF YCL012W was moved 137 nt downstream, lengthening the coding region from 459 nt to 696 nt. Chromosomal coordinates change from 100110-100568 to 100113-100808.

1999-07-17 YCL053C

ORF YCL053C has been deleted due to a sequence correction.

1999-07-17 YCL021W

ORF YCL021W was deleted as a result of corrections to the systematic sequence.

1999-07-17 YCL013W

The ORF YCL013W has been deleted as a result of updates to the systematic sequence.

1999-07-17 YCL039W

The start site of ORF YCL039W was moved 42 nucleotides downstream, reducing the length of the coding sequence from 2280 nt to 2238 nt.

1999-07-17 YCL024W

The stop site of ORF YCL024W was moved 297 nt downstream, changing the relative coding coordinates from 1-2451 to 1-2748. Chromosomal coordinates change from 79119-81569 to 79125-81872.

1998-12-21 YCL026C

ORF YCL026C was deleted due to a sequence correction.

1998-07-24 YCR055C, YCR057C, YCR058C

ORFs YCR055C and YCR058C were merged with existing ORF YCR057C. The coding region of YCR057C had been 1320 nt long, but is now 2772 nt in length.

1998-07-24 YCR029C

ORF YCR029C has been deleted from the genome annotation due to sequence correction.

1998-07-24 YCL062W, YCL063W

Due to several sequence changes in the region encompassing ORFs YCL062W and YCL063W, YCL062W has been merged into adjacent ORF YCL063W. The coding region of YCL063W had been 387 nt long, and is now 1272 nt in length.

1998-07-24 YCR029C-A, YCR030C

ORF YCR029C-A has been merged into neighboring ORF YCR030C. The coding region YCR030C had been annotated as 1974 nt long, but is now 2613 nt in length.

1998-07-24 YCR080W, YCR081W

YCR080W was originally annotated as an independent ORF, but upon further review was merged with neighboring ORF YCR081W. As a result, the annotated start site of YCR081W was moved 603 nt upstream, increasing the coding region of YCR081W in length from 3681 nt to 4284 nt.

1998-07-24 YCR074C

YCR074C was originally annotated as an ORF, but upon further review was removed from the genome annotation.

1998-07-24 YCR056W

ORF YCR056W was deleted from the genome annotation due to sequence correction.

1998-07-24 YCL060C, YCL061C

Due to several sequence changes in the region encompassing ORFs YCL060C and YCL061C, YCL060C has been merged into adjacent ORF YCL061C.

1998-07-24 YCR070W

ORF YCR070W has been deleted from the genome annotation.

1998-05-30 YCLX01W, YCLX02C, YCLX03C, YCLX04W, YCLX05C, YCLX06C, YCLX07W, YCLX09W, YCLX10C, YCLX11W, YCLX12W, YCRX01W, YCRX02C, YCRX03C, YCRX04W, YCRX05W, YCRX06W, YCRX07W, YCRX08W, YCRX09C, YCRX10W, YCRX11W, YCRX12W, YCRX14W, YCRX15W, YCRX16C, YCRX17W, YCRX18C, YCRX19W, YCRX20C, YCRX21C

The following putative ORFs were originally included in the annotation of Chromosome III, but were later withdrawn: YCLX01W, YCLX02C, YCLX03C, YCLX04W, YCLX05C, YCLX06C, YCLX07W, YCLX09W, YCLX10C, YCLX11W, YCLX12W, YCRX01W, YCRX02C, YCRX03C, YCRX04W, YCRX05W, YCRX06W, YCRX07W, YCRX08W, YCRX09C, YCRX10W, YCRX11W, YCRX12W, YCRX14W, YCRX15W, YCRX16C, YCRX17W, YCRX18C, YCRX19W, YCRX20C, and YCRX21C. SGD (1998) Putative ORF Annotations on Chromosome III SGD paper

1998-05-21 YCL001W

The start site of ORF YCL001W was moved 159 nt downstream.

1998-05-21 YCR018C-A, YCR102W-A

The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A.

The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.
Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51.
SGD paper | PubMed | Full-Text | YFGdb

1997-07-26 YCR097W-A, YCR097WA

The original YCR097W-A ORF (SGDID: S0000693) was deleted because: HMRA1/YCR097W contains two introns and the 3 intron is spliced less efficiently but probably does NOT create an alternative form of the protein. Because there is no evidence for a functional protein at the original YCR097W-A coordinates, this ORF was deleted. Note that a new ORF with the same name (YCR097W-A, SGDID: S0007632) has been added because of homology to a hemiascomycetous yeast protein, but that these two ORFs (the original vs the new YCR097W-A) are completely different, except that they have the same name.