Chromosome IV History

This page lists all sequence and annotation changes that have been made to the Chromosome IV systematic reference sequence since its intial release on 1996-07-31.
The sequence of Chromosome IV has been updated 63 times, affecting 69 features.
The annotation of Chromosome IV has been updated 63 times, affecting 111 features.
Current and past versions can be obtained from SGD's Download site.

Sequence Changes

Date	Affected Features	Start Coordinate of Change	End Coordinate of Change	Type of Change	Old Sequence	New Sequence
2011-02-03	YDR215C	894308	894308	Insertion		G
	A single C nucleotide was inserted within ORF YDR215C, altering its coding sequence. The start and first half of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 10 amino acids longer. New 894294 GAATGATTGCCGAAAGGGCGGGCCCTAGTCAATGGCATCATGCGGGAACGTGCAGTAAAG 894353 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 894292 GAATGATTGCCGAAAGG-CGGGCCCTAGTCAATGGCATCATGCGGGAACGTGCAGTAAAG 894350 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDL190C	119470	119470	Substitution	G	A
		119564	119564	Substitution	T	A
		121289	121289	Substitution	G	A
	Two nucleotide substitutions in the coding region of UFD2/YDL190C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 102 is now Leucine rather than Serine, and residue 677 is now Valine rather than Aspartic Acid. A third nucleotide substitution did not affect the protein sequence. New 119460 GCCCCTTGCACGATTATCCAGCTCATTTTGGATATTATGCACCTCAGCCAAATTACTTAG 119519 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Old 119461 GCCCCTTGCGCGATTATCCAGCTCATTTTGGATATTATGCACCTCAGCCAAATTACTTAG 119520 New 119520 GCCTTCATCCAACAGGAAAGTCAAGTCATTCAACATACGAGCAACGAACCTCACAAAAAA 119579 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 119521 GCCTTCATCCAACAGGAAAGTCAAGTCATTCAACATACGAGCATCGAACCTCACAAAAAA 119580 New 121260 ACCATTCATGCAAAAGTTTTCTATTTGTAAGGCAACGACACCATAGCCAATGACAAGACG 121319 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Old 121261 ACCATTCATGCAAAAGTTTTCTATTTGTGAGGCAACGACACCATAGCCAATGACAAGACG 121320 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR360W	1194955	1194955	Insertion		C
	A single C nucleotide was inserted within ORF OPI7/YDR360W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 16 amino acids longer. New 1194953 GGCTAACGCCTACGGGTAATAGCCGGCCTTTGAAAATTTCGCGGCTGCAGCAAGTACGCA 1195012 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Old 1194947 GGCTAACGC-TACGGGTAATAGCCGGCCTTTGAAAATTTCGCGGCTGCAGCAAGTACGCA 1195005 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR350C	1176395	1176395	Insertion		C
	A single nucleotide was inserted within ORF ATP22/YDR350C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 73 amino acids longer. New 1176353 TGATTTCAAAGCCCCCGAAGAGTATCTTATTGTACCAGGAGCGTGCTCCTTTTTCGTCTC 1176412 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 1176348 TGATTTCAAAGCCCCCGAAGAGTATCTTATTGTACCAGGAGCGTGCTC-TTTTTCGTCTC 1176406 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDL028C	402651	402651	Deletion	C
		402661	402661	Insertion		T
	Nucleotide changes within the coding region of MPS1/YDL028C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 211-213 are now TKR rather than RRE. New 402627 AAATCAATTGAATCATAATCCGTATT-TCTCTTCGTTTCTTTAAAGTTTGTTTGGTGAGA 402685 |||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| Old 402625 AAATCAATTGAATCATAATCCGTATTCTCTCTTCGTT-CTTTAAAGTTTGTTTGGTGAGA 402683 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR527W	1491667	1491667	Substitution	G	C
		1491661	1491661	Substitution	G	A
	Two nucleotide substitutions within the coding region of RBA50/YDR527W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 192-194 are now EEA rather than GEG. New 1491653 AAAAAGACGTGGAAGAAGAAGCAAAAACTAATGATGACGTCGATGATATCGCACCCTTAG 1491712 ||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| Old 1491646 AAAAAGACGTGGAAGGAGAAGGAAAAACTAATGATGACGTCGATGATATCGCACCCTTAG 1491705 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR541C	1519663	1519663	Substitution	C	G
	A single nucleotide substitution within the coding region of YDR541C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 341 is now Glutamine rather than Glutamic Acid. New 1519673 GTTCTGCTTCTTCAAAATTTGGGCAGCAGTATCATGGACACTTTCGTGTAAACTTCTGAA 1519732 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 1519658 GTTCTCCTTCTTCAAAATTTGGGCAGCAGTATCATGGACACTTTCGTGTAAACTTCTGAA 1519717 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDL239C	30786	30786	Substitution	G	A
	A single nucleotide substitution within the coding region of ADY3/YDL239C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 569 is now Glutamic Acid rather than Glycine. New 30781 TATCGAATATTGATAACTTTGGGTTGACCGGTCAACATCTTTTAGAATTTTTCCAGGAAA 30840 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 30781 TATCGGATATTGATAACTTTGGGTTGACCGGTCAACATCTTTTAGAATTTTTCCAGGAAA 30840 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDL237W	30786	30786	Substitution	G	A
	A single nucleotide substitution within the coding region of AIM6/YDL237W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 44 is now Asparagine rather than Aspartic Acid. New 30781 TATCGAATATTGATAACTTTGGGTTGACCGGTCAACATCTTTTAGAATTTTTCCAGGAAA 30840 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 30781 TATCGGATATTGATAACTTTGGGTTGACCGGTCAACATCTTTTAGAATTTTTCCAGGAAA 30840 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR505C	1457020	1457020	Substitution	C	T
	A single nucleotide substitution within the coding region of PSP1/YDR505C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 532 is now Lysine rather than Glutamic Acid. New 1456973 TTATCAAGTCTCTAAAATCATTTCTCTCCTCACAAACGTAGTAAAACGTTAATTTCTTTC 1457032 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Old 1456966 TTATCAAGTCTCTAAAATCATTTCTCTCCTCACAAACGTAGTAAAACGTTAATTCCTTTC 1457025 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDL102W	277105	277106	Substitution	CG	GC
	Two nucleotide substitutions within the coding region of POL3/YDL102W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 78-79 are now EL rather than DV. New 277080 AATTAGAGTCTACTTTTGAACAAGAGCTATCGCAAATGGAACATGATATGGCCGACCAAG 277139 ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 277080 AATTAGAGTCTACTTTTGAACAAGACGTATCGCAAATGGAACATGATATGGCCGACCAAG 277139 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR414C	1296177	1296177	Substitution	C	G
	A single nucleotide substitution within the coding region of ERD1/YDR414C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 168 is now Alanine rather than Glycine. New 1296173 TCAATGGTTTTGCAAACGATGTCAACGTGTCAGAGATTAAAATGTAGGTATTCCTTAAGG 1296232 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 1296166 TCAATGGTTTTCCAAACGATGTCAACGTGTCAGAGATTAAAATGTAGGTATTCCTTAAGG 1296225 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDL195W	108307	108307	Substitution	T	A
	A single nucleotide substitution within the coding region of SEC31/YDL195W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 367 is now Threonine rather than Serine. New 108300 AAGCCAACTGTTTTCCATTTACAAGCCCCAACTTGGTATGGGGAACCATCTCCCGCAGCT 108359 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 108301 AAGCCATCTGTTTTCCATTTACAAGCCCCAACTTGGTATGGGGAACCATCTCCCGCAGCT 108360 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDL031W	396410	396410	Insertion		T
		396437	396437	Deletion	G
		396451	396451	Substitution	T	G
		396504	396504	Substitution	C	G
	Nucleotide changes within the coding region of DBP10/YDL031W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 733-741 are now SHSIEDEIL rather than HILSKMKFW, residue 746 is now Glycine rather than Valine, and residue 764 is now Aspartic Acid rather than Histidine. New 396358 ACGAAAGGCGACTGAAAGAAGGGAACTATTAGAAAAGGAAAGAATGGCTGGTCTTTCACA 396417 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Old 396356 ACGAAAGGCGACTGAAAGAAGGGAACTATTAGAAAAGGAAAGAATGGCTGGTCTT-CACA 396414 New 396418 TTCTATCGAAGATGAAATTTTG-AAAGGTGACGATGGTGAGACAGGTTACACCGTGTCAG 396476 |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| Old 396415 TTCTATCGAAGATGAAATTTTGGAAAGGTGACGATGTTGAGACAGGTTACACCGTGTCAG 396474 New 396477 AGGATGCCTTAAAAGAATTTGAAGATGCGGACCAATTATTAGAAGCACAGGAAAACGAAA 396536 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old 396475 AGGATGCCTTAAAAGAATTTGAAGATGCGCACCAATTATTAGAAGCACAGGAAAACGAAA 396534 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDL240W	24415	24415	Substitution	C	A
	A single nucleotide substitution within the coding region of LRG1/YDL240W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 531 is now Glutamine rather than Histidine. New 24361 AGCATCTAACAAGGTAGGCAGAAACTCTTTACAGAGTACTATGCTAAAGGAACAAACTTA 24420 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Old 24361 AGCATCTAACAAGGTAGGCAGAAACTCTTTACAGAGTACTATGCTAAAGGAACACACTTA 24420 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR470C	1400867	1400867	Substitution	C	T
	A single nucleotide substitution within the coding region of UGO1/YDR470C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 114 is now Glutamic Acid rather than Glycine. New 1400863 CCAGCAGTTGTTCAAATATTTTTCGCCATTTCTGGATGTTAACCAATTCCGCCCATTCAA 1400922 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 1400856 CCAGCAGTTGTCCAAATATTTTTCGCCATTTCTGGATGTTAACCAATTCCGCCCATTCAA 1400915 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDL047W, YDL048C	369180	369180	Insertion		A
		369163	369163	Insertion		G
	Two separate single nucleotide insertions were made in the intergenic region between ORFs STP4/YDL048C and SIT4/YDL047W. New 369144 CAAATTGCAAAGCCGCGGCGGTTCCCGGAAAAAAAAAAAGGAAGGCCACGCTATTGGTAA 369203 |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| Old 369144 CAAATTGCAAAGCCGCGGCG-TTCCCGGAAAAAAAAAA-GGAAGGCCACGCTATTGGTAA 369201 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDL046W, YDL047W	371114	371114	Insertion		A
	A single nucleotide insertion was made in the intergenic region between ORFs SIT4/YDL047W and NPC2/YDL046W. New 371099 ATCCCTGATAATAAAAAAACTTTAATCAACACTCGGGAGGGGAAATATAAAAGACTGGCG 371158 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 371097 ATCCCTGATAATAAAAAA-CTTTAATCAACACTCGGGAGGGGAAATATAAAAGACTGGCG 371155 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR541C, YDR542W	1522501	1522501	Deletion	T
	A single nucleotide deletion was made in the intergenic region between ORF YDR541C and PAU10/YDR542W. New 1522493 TCTGTACTCTTTTCTTTTCTTTC-TTTTTTTTTTTTAACAAGAAAAATGGTACCCGGGTA 1522551 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old 1522478 TCTGTACTCTTTTCTTTTCTTTCTTTTTTTTTTTTTAACAAGAAAAATGGTACCCGGGTA 1522537 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR541C, YDRWdelta31	1519599	1519599	Substitution	C	G
	A single nucleotide substitution was made in the intergenic region between Ty1 LTR YDRWdelta31 and ORF YDR541C. New 1519603 CTTATGGTTTCGCTTGATTATTTTGGCTTCACATAATTGCGAGATTATGTGTGGTATGGC 1519662 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 1519588 CTTATGGTTTCCCTTGATTATTTTGGCTTCACATAATTGCGAGATTATGTGTGGTATGGC 1519647 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR539W, YDR540C	1516838	1516839	Substitution	TT	ATTA
		1516819	1516819	Insertion		T
		1516809	1516812	Substitution	GTGC	TGTTGCT
	Several small sequence changes were made in the intergenic region between ORFs FDC1/YDR539W and IRC4/YDR540C. New 1516803 TATCGTCTATATCTTTGTTGCTTTAAAGGTTAGCGTATAGTAAGGTAAATTAACTATATG 1516862 ||||||||||||||| ||| ||||||| |||||||||||||||||| | |||||||| Old 1516794 TATCGTCTATATCTT--GTGC-TTAAAGG-TAGCGTATAGTAAGGTAA--TTACTATATG 1516847 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR536W, YDR538W	1509885	1509885	Insertion		G
	A single nucleotide insertion was made in the intergenic region between ORFs STL1/YDR536W and PAD1/YDR538W. New 1509883 TTCCGCTTGCCGGCAATGCCTATAAAAAGCTTATAAAATAGCCCGACTCCGTAGTCTTAA 1509942 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 1509875 TTCCGCTTGCC-GCAATGCCTATAAAAAGCTTATAAAATAGCCCGACTCCGTAGTCTTAA 1509933 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR533C, YDR534C	1502725	1502725	Insertion		T
	A single nucleotide insertion was made in the intergenic region between ORFs HSP31/YDR533C and FIT1/YDR534C. New 1502693 TTTCTTCTCTCTGACCTAAATTATTACAGCCATATATAACTTTTTTTTTTAAATTCGGAT 1502752 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old 1502686 TTTCTTCTCTCTGACCTAAATTATTACAGCCATATATAAC-TTTTTTTTTAAATTCGGAT 1502744 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDL039C, YDL040C	381865	381865	Deletion	T
	A single nucleotide deletion was made in the intergenic region between ORFs NAT1/YDL040C and PRM7/YDL039C. New 381839 CAGAAAGAGTCTGATAATAATAATTTTTT-ATTGAATCCGAAGATATTCTATAATCAAAT 381897 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old 381836 CAGAAAGAGTCTGATAATAATAATTTTTTTATTGAATCCGAAGATATTCTATAATCAAAT 381895 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDL033C, YDL034W	392616	392616	Substitution	A	G
	A single nucleotide substitution was made in the intergenic region between ORFs YDL034W and SLM3/YDL033C. New 392578 GGTTCAATTAGGCAAGTATGTTGCTAAGATTAATTGCTGCGGCGCATCGTATAAGGTGAT 392637 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old 392576 GGTTCAATTAGGCAAGTATGTTGCTAAGATTAATTGCTGCAGCGCATCGTATAAGGTGAT 392635 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDL234C, YDL235C	34008	34008	Deletion	T
	A single nucleotide deletion was made in the intergenic region between ORFs YPD1/YDL235C and GYP7/YDL234C. New 33961 TTCTTTTGAATTTTTCAAAGAAATAAAACTATTACACGTCAGTGGTT-ATCAATGATCCA 34019 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 33961 TTCTTTTGAATTTTTCAAAGAAATAAAACTATTACACGTCAGTGGTTTATCAATGATCCA 34020 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDL183C, YDL184C	130626	130626	Substitution	T	A
	A single nucleotide substitution was made in the intergenic region between ORFs RPL41A/YDL184C and YDL183C. New 130620 TGGGGAAAAGTGAAACTTTCGGGTAGGGTAATGAGGCCAGCCTTGCCTGGGAAAAAGTTA 130679 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 130621 TGGGGTAAAGTGAAACTTTCGGGTAGGGTAATGAGGCCAGCCTTGCCTGGGAAAAAGTTA 130680 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDL182W, YDL183C	132292	132292	Substitution	T	A
	A single nucleotide substitution was made in the intergenic region between ORFs YDL183C and LYS20/YDL182W. New 132240 TTTTATGGGCTCTAAATCGGTATAAGCTCAACAAATGGTTGAGGGCCGAATAAACGAAAA 132299 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Old 132241 TTTTATGGGCTCTAAATCGGTATAAGCTCAACAAATGGTTGAGGGCCGAATTAACGAAAA 132300 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDL137W, YDL138W	215996	215996	Insertion		C
	A single nucleotide insertion was made in the intergenic region between ORFs RGT2/YDL138W and ARF2/YDL137W. New 215950 CGATCTTGCACCTCCACGTACTCCTTTTGAATAGTACACATATACCCTTACAGGAGATCG 216009 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 215951 CGATCTTGCACCTCCACGTACTCCTTTTGAATAGTACACATATACC-TTACAGGAGATCG 216009 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR334W, YDR335W	1140697	1140697	Insertion		G
	A single nucleotide insertion was made in the intergenic region between ORFs SWR1/YDR334W and MSN5/YDR335W. New 1140653 GTCACCAATTTCTATTTACCGGGTGATGGCGGCGCGCCACAGCGGAGGGGCATTGCCACA 1140712 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 1140649 GTCACCAATTTCTATTTACCGGGTGATGGCGGCGCGCCACAGCGGAGGG-CATTGCCACA 1140707 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR324C, YDR325W	1117110	1117110	Insertion		GG
	A dinucleotide insertion was made in the intergenic region between ORFs UTP4/YDR324C and YCG1/YDR325W. New 1117073 AGTAATGCCTACAGCCTTGGATAAGACAAAGAAGTTAACAGGCCGCGCCCATCATGCAAG 1117132 |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 1117071 AGTAATGCCTACAGCCTTGGATAAGACAAAGAAGTTAACA--CCGCGCCCATCATGCAAG 1117128 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR072C, YDR073W	592033	592033	Insertion		G
	A single nucleotide insertion was made in the intergenic region between ORFs IPT1/YDR072C and SNF11/YDR073W. New 592014 CAAGGATAACCCCGCTGTGCGGTGAAACCACCCTCTTTTCACGTTTCTTCAAGGCCAGTG 592073 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 592013 CAAGGATAACCCCGCTGTGCG-TGAAACCACCCTCTTTTCACGTTTCTTCAAGGCCAGTG 592071 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR062W, YDR063W	578232	578232	Deletion	T
	A single nucleotide deletion was made in the intergenic region between ORFs LCB2/YDR062W and AIM7/YDR063W. New 578215 AAACACGCAACGTCTTTTT-GACATAAACTTAAAACTGCCAAAAGTCAAACAAAAATTGC 578273 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Old 578213 AAACACGCAACGTCTTTTTTGACATAAACTTAAAACTGCCAAAAGTCAAACAAAAATTGC 578272 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR059C, YDR060W	569994	569994	Insertion		G
	A single nucleotide insertion was made in the intergenic region between ORFs UBC5/YDR059C and MAK21/YDR060W. New 569985 ATGCTTCAAAAGCGCTTGCTACGAGAGTTTACACCGTACTAGCACTAGCAATACATCTAG 570044 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 569984 ATGCTTCAAAA-CGCTTGCTACGAGAGTTTACACCGTACTAGCACTAGCAATACATCTAG 570042 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR043C, snR47	542033	542033	Deletion	A
	A single nucleotide deletion was made in the intergenic region between snoRNA SNR47 and ORF NRG1/YDR043C. New 541986 AATAATTAACTATACTATTGTTCGGAGACAGTTCTGATGCCTAGTAAAA-CGCTTGCAGC 542044 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 541984 AATAATTAACTATACTATTGTTCGGAGACAGTTCTGATGCCTAGTAAAAACGCTTGCAGC 542043 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR310C, YDR311W	1084534	1084534	Deletion	A
	A single nucleotide deletion was made in the intergenic region between ORFs SUM1/YDR310C and TFB1/YDR311W. New 1084494 AACACAAATGGTATTAAAAGGATAGATGAAAAAAAAAAAAAAA-TTAAAGCCACTAGTAA 1084552 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 1084491 AACACAAATGGTATTAAAAGGATAGATGAAAAAAAAAAAAAAAATTAAAGCCACTAGTAA 1084550 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDR300C, YDR301W	1063029	1063029	Substitution	C	A
	A single nucleotide substitution was made in the intergenic region between ORFs PRO1/YDR300C and CFT1/YDR301W. New 1063014 AATAAATAAATTTAGACCAAAATGTAACCATTGATAAGTGAGAGTCTTAAATTTAACATG 1063073 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 1063011 AATAAATAAATTTAGACCCAAATGTAACCATTGATAAGTGAGAGTCTTAAATTTAACATG 1063070 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDL071C, YDL072C	330573	330573	Deletion	T
	A single nucleotide deletion was made in the intergenic region between ORFs YET3/YDL072C and YDL071C. New 330540 TTGCTATATACCATTGTTATATACGGCACTTTT-CCACTCTTCTTCCCCTTAATGGAGTG 330598 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 330540 TTGCTATATACCATTGTTATATACGGCACTTTTTCCACTCTTCTTCCCCTTAATGGAGTG 330599 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2011-02-03	YDL069C, YDL070W	332995	332995	Insertion		A
	A single nucleotide insertion was made in the intergenic region between ORFs BDF2/YDL070W and CBS1/YDL069C. New 332949 ATGGGCTTCATGCCCTAATTAAGGAAAAAAAGAAAAGAAAAAAAAAATTGGGAAGAATGG 333008 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 332950 ATGGGCTTCATGCCCTAATTAAGGAAAAAAAGAAAAGAAAAAAAAA-TTGGGAAGAATGG 333008 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 SGD paper | PubMed | Full-Text
2008-06-05	YDL038C, YDL039C	382381	382381	Insertion		G
	Greg Prelich's lab discovered an error in the systematic reference sequence for Chromosome 4. This error was verified in the S288C strain background. Therefore, the following correction was made: insert a G after the G at 382381. New: 1737 TTTGGTGATGGTAGTGTCTTTGGGACCCGAGTAATTTGGGTTCCCAACCTCAGACTGAAT 1678 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old: 382343 TTTGGTGATGGTAGTGTCTTTGGGACCCGAGTAATTTGG-TTCCCAACCTCAGACTGAAT 382401 As a result of this change, ORF YDL038C was merged into ORF PRM7/YDL039C. The new longer ORF is 2097 nt long. The name YDL038C is being retained as an alias for PRM7/YDL039C. Prelich G (2008) SGD papers
2006-04-13	YDR015C	478023	478023	Insertion		C
	A sequence error in the SGD sequence has been corrected: a single C was inserted in between the G at chromosomal coordinate 478023 and the C at 478024 on chromosome IV (what was three Cs is now 4 Cs). This makes the ORF of YDR015C shorter (79 amino acids) than what was originally annotated (129 aa). New: 181 AAACAACAACTTCGTGCCAAAAATCTGTCTGAGAACACAGGTGGCGGAAGCCCCAATGGG 240 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Old: 477974 AAACAACAACTTCGTGCCAAAAATCTGTCTGAGAACACAGGTGGCGGAAG-CCCAATGGG 478032 Tsubouchi H and Roeder GS (2006) Budding yeast Hed1 down-regulates the mitotic recombination machinery when meiotic recombination is impaired. Genes Dev 20(13):1766-75 SGD papers PubMed Full-Text Comments & Errata
2006-01-19	YDR083W	613206	613206	Insertion		G
	SGD confirmed the sequence error suggested by Kellis et al and has updated the sequence accordingly. As a consequence of this change, RRP8/YDR083W has been extended on the 3' end, altering the C-terminus and increasing the size of the predicted protein from 383 to 392 amino acids. Insert a G after the G at 613206 New: 613187 AAGACGGAAAATTGCCGAAGGAAAATGGCTCTTGAAGC 613224 |||||||||||||||||||| ||||||||||||||||| Old: 613187 AAGACGGAAAATTGCCGAAG-AAAATGGCTCTTGAAGC 613223 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata
2004-07-22	YDR031W	503841	503841	Insertion		G
	The work of Kellis et al. 2003 predicted insertion of a single nucleotide within the coding region of YDR031W; SGD resequenced this region and found that a single G nucleotide was necessary to correct the reference sequence. As a consequence of this change, YDR031W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 117 to 121 amino acids. New: 301 TAAAAATATTAAGCCTTCAATTAATGGAGTAAACTTGGAATTAATCAAGGACTGA 355 ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old: 503805 TAAAAATATTAAGCCTTCAATTAATGGAGTAAACTTG-AATTAATCAAGGACTGA 50385 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata
2004-07-21	YDR179W-A	819479	819479	Insertion		G
	The work of Brachat et al. 2003 predicted insertion of a single nucleotide upstream of YDR179W-A; SGD resequenced this region and found that a single G nucleotide was necessary to correct the reference sequence. As a consequence of this change, YDR179W-A was extended at the 5' end, altering the N-terminus without changing the translation frame and increasing the size of the predicted protein from 268 to 463 amino acids. New: 1 TTTTATACAACACCAATTCCAGTTTAATTACCAAGTACCGAAGGCCAAATGCCTCAAATC 60 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old: 819437 TTTTATACAACACCAATTCCAGTTTAATTACCAAGTACCGAAG-CCAAATGCCTCAAATC 819495 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. SGD paper | PubMed | Full-Text
2004-02-11	YDL127W	235713	235713	Insertion		A
	Kellis et al. 2003 predicted and confirmed the insertion of a single A nt. As a consequence of this sequence change, PCL2/YDL127W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 279 to 308 amino acids. New: 235675 GAACATACAACATAGACTCCAAACACGATAACAAGGAAAATAGGCCAATACCGACAATTA 235734 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old: 235675 GAACATACAACATAGACTCCAAACACGATAACAAGGAAA-TAGGCCAATACCGACAATTA 235733 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata
2004-02-11	YDR007W	462037	462037	Substitution	A	C
	Although the systematic sequence for TRP1/YDR007W originally contained a nonsense (ochre) mutation at codon 67, systematic reference strain S288C does not actually contain this mutation in TRP1, which was introduced during the creation of strain AB972. AB972 is an ethidium bromide-induced derivative of the strain X2180-1B-trp1, which was supplied by E. Jones [M.V. Olson]. The lineage of AB972 traces directly to the strain S288C with no intervening outcrosses. The strain AB972 was the origin of the clone used for sequencing this segment of chromosome IV. In order to more accurately present this region of within the S288C reference strain, SGD has sequenced the S288C TRP1 locus and did not find the internal STOP codon. Thus, SGD has updated the TRP1 sequence by changing the previously annotated internal STOP (TAA) to serine (TCA). New: 462018 AAAGCATATAAAAATAGTTCAGGCACTCCGAAATACTTGGTTGGCGTGTTTCGTAATCAA 462077 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Old: 462018 AAAGCATATAAAAATAGTTAAGGCACTCCGAAATACTTGGTTGGCGTGTTTCGTAATCAA 462077
2004-02-06	YDR359C	1192051	1192051	Deletion	A
	Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggested that the stop site for YDR359C be moved 67 nt downstream. Jacques Cote and colleagues resequenced S288C, W303, and BY4741 and confirmed the deletion of a single A nt (see GenBank accession AY464182). As a consequence of this sequence change, the stop of YDR359C was moved 70 nt downstream, increasing the size of the predicted protein from 959 to 982 amino acids. New: 1192020 AGATGGAGATGATTTCGGTGGCGGAGCTTGA-GACCCTGGTTGTAGTTGCTGCA 1192072 ||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old: 1192020 AGATGGAGATGATTTCGGTGGCGGAGCTTGAAGACCCTGGTTGTAGTTGCTGCA 1192073 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata
2003-09-30	YDR474C, YDR475C	1409656	1409656	Insertion		C
		1409510	1409510	Insertion		G
	Due to insertion of G at position 1409511 and a C at position 1409657, YDR474C and JIP4/YDR475C have been merged. After merging YDR474C (1409119 - 1407452 (1-1668)) and JIP4/YDR475C (1410080 - 1409613 (1-468)), the coordinates of the merged ORF, JIP4/YDR475C, are 1410082 - 1407452 (1-2631). YDR474C is now an alias of JIP4/YDR475C. This sequence change was verified in strain S288C by SGD. Old: 1409461 ATCGATGATCTATCTGATTTTTCTTCTTGATCCATAGTTGTCTCCAATTG-CATACGCCC 1409519 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| New: 1409461 ATCGATGATCTATCTGATTTTTCTTCTTGATCCATAGTTGTCTCCAATTGGCATACGCCC 1409520 Old: 1409640 GAGGTGGAGAAGAATAC-TGCCGGGACTAGCACTGCCCTCTCGCCTACTCGAATAGCTAT 1409698 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| New: 1409641 GAGGTGGAGAAGAATACCTGCCGGGACTAGCACTGCCCTCTCGCCTACTCGAATAGCTAT 1409700 Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6 SGD paper | PubMed | Full-Text Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata
2002-12-17	YDR325W	1117105	1117105	Deletion	G
	Due to the deletion of G at 1117105, the start for YDR325W has been moved 48 nt downstream from 1117069 to 1117116. The stop has not been changed. Thanks to Denise Bertsch for reporting this sequence error to SGD. Old: 1117081 TTGGATAAGACAAAGAAGTTAACAGCCGCGCCCATCATGCAAGATCCTGATGGTATTGAC 1117140 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| New: 1117081 TTGGATAAGACAAAGAAGTTAACA-CCGCGCCCATCATGCAAGATCCTGATGGTATTGAC 1117139 Lavoie BD, et al. (2002) In vivo dissection of the chromosome condensation machinery: reversibility of condensation distinguishes contributions of condensin and cohesin. J Cell Biol 156(5):805-15 SGD papers | PubMed | Full-Text
2002-12-17	YDR494W	1437732	1437747	Deletion	GATCCTCCTTGATTTT
	Due to the deletion of 16 nt between 1437732-1437747, which had been tandemly duplicated in error, the coordinates of RSM28/YDR494W have been changed. The 16 nucleotides that were removed were near the 3' end of YDR494W, shifting the stop 235 nt downstream, for a net increase in length of 219 nt (from 867 nt to 1086 nt). See GenBank accession number AF459095. Thanks to Tom Fox for reporting this sequence error to SGD. Old: 1437681 cctaaacacgccaaactttggtaaatatacaccaggatcctccttgatttt 1437731 ||||||||||||||||||||||||||||||||||||||||||||||||||| New: 1437681 cctaaacacgccaaactttggtaaatatacaccaggatcctccttgatttt 1437731 Old: 1437732 gatcctccttgatttttgccaaagagcctcaattgcagaatttacttattgaagaagacc 1437791 |||||||||||||||||||||||||||||||||||||||||||| New: 1437732 ----------------tgccaaagagcctcaattgcagaatttacttattgaagaagacc 1437775
2000-04-06	YDR470C	1400863	1400863	Substitution	T	C
	The T at coordinate 1400863 within YDR470C was replaced with a C (tgtCcaa). This results in a replacement of a Glu (GAA) with a Gly (GGA) on the Crick strand where the gene is located. This change was sent to SGD by Hartmut Wohlrab (wohlrab@bbri.org). Old: 1400821 AGCAATTGAAAATACTTTCTGAAAAACATATCCAGCAGTTGTTCAAATATTTTTCGCCAT 1400880 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| New: 1400821 AGCAATTGAAAATACTTTCTGAAAAACATATCCAGCAGTTGTCCAAATATTTTTCGCCAT 1400880 Belenkiy R, et al. (2000) The yeast mitochondrial transport proteins: new sequences and consensus residues, lack of direct relation between consensus residues and transmembrane helices, expression patterns of the transport protein genes, and protein-protein interactions with other proteins. Biochim Biophys Acta 1467(1):207-18 SGD paper | PubMed Entry | Full-Text
1999-02-09	YDL048C	368211	368255	Deletion	CATTACTGAGTCAATGCTTGATGCA AAAGATGATGATACCAGCAT
	The first 45 nucleotides of YDL048C (from chromosomal coordinates 368211-368255) were deleted, leaving translation unaffected. This chunk was tandemly-duplicated in error. Old: 368154 cgtctcatgggacattactgagtcaatgcttgatgcaaaagatgatgataccagcat 368210 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| New: 368154 cgtctcatgggacattactgagtcaatgcttgatgcaaaagatgatgataccagcat 368210 Old: 368211 cattactgagtcaatgcttgatgcaaaagatgatgataccagcataggggaagccaaaga 368270 ||||||||||||||| New: 368211 ---------------------------------------------aggggaagccaaaga 368225

Annotation Changes without sequence changes

Date	Affected Features
2014-11-18	ARS404 The chromosomal coordinates of the ARS consensus sequence annotated within ARS404 were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2. Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. SGD paper | PubMed | Full-Text
2014-11-18	ARS400, ARS403, ARS405, ARS406, ARS409, ARS410, ARS412, ARS413, ARS417, ARS419, ARS421, ARS422, ARS423, ARS425, ARS428, ARS429, ARS430, ARS431, ARS433, ARS440, ARS446, ARS451 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome IV based on Liachko et al. 2013: ARS400, ARS403, ARS405, ARS406, ARS409, ARS410, ARS412, ARS413, ARS417, ARS419, ARS421, ARS422, ARS451, ARS423, ARS425, ARS428, ARS429, ARS430, ARS431, ARS433, ARS440, ARS446. Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. SGD paper | PubMed | Full-Text
2014-11-18	ARS404, ARS409, ARS412, ARS415, ARS416, ARS417, ARS418, ARS419, ARS420, ARS421, ARS423, ARS430, ARS431, ARS435, ARS453 The chromosomal coordinates of the following ARS elements on Chromosome IV were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS404, ARS409, ARS412, ARS415, ARS416, ARS417, ARS418, ARS419, ARS420, ARS421, ARS423, ARS430, ARS431, ARS453, ARS435. Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. SGD paper | PubMed | Full-Text
2014-11-18	ARS409.5 ARS409.5 was added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2. Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. SGD paper | PubMed | Full-Text
2014-11-18	YDR134C The feature_type annotation of YDR134C was changed from pseudogene to blocked_reading_frame (SO:0000718) as part of SGD's genome annotation revision R64.2.
2014-11-18	YDR098C The annotated translation start for GRX3/YDR098C was moved 105 nt downstream to what was previously Met36, based on Li et al. 2009 as part of SGD's genome annotation revision R64.2. Old chromosomal coords: 645035..644178 Old relative coords: 1..858 New chromosomal coords: 644930..644178 New relative coords: 1..753 Li H, et al. (2009) The yeast iron regulatory proteins Grx3/4 and Fra2 form heterodimeric complexes containing a [2Fe-2S] cluster with cysteinyl and histidyl ligation. Biochemistry 48(40):9569-81 SGD paper | PubMed | Full-Text
2014-11-18	ETC1, ETC6 The following previously unmapped features were identified as nuclear matrix attachment sites and assigned chromosomal coordinates based on Hiraga et al. 2012 as part of SGD's genome annotation revision R64.2: ETC1, ETC2, ETC3, ETC4, ETC6, ETC7, ETC8. Hiraga SI, et al. (2012) TFIIIC localizes budding yeast ETC sites to the nuclear periphery. Mol Biol Cell 23(14):2741-54 SGD paper | PubMed | Full-Text
2009-05-07	ARS411, ARS412, ARS415, ARS420, ARS427, ARS436, ARS439, ARS442 The following ARS elements on Chromosome 4 were added to the genome annotation based on Raveendranathan et al. 2006: ARS411, ARS412, ARS415, ARS420, ARS427, ARS436, ARS439, and ARS442. Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39 SGD paper | PubMed | Full-Text
2007-07-10	YDL115C The start of ORF IWR1/YDL115C was moved 409 nt upstream and an intron was added at relative coordinates 83-152 based on experimental evidence in Juneau et al. 2007 and Miura et al. 2006. See also GenBank EF123147 and Brachat et al. 2003. Note that this is the same intron that was briefly incorporated into SGD (for one month from 2004-01-23 to 2004-02-24), but then removed awaiting experimental evidence. Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. SGD paper | PubMed | Full-Text Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 SGD papers | PubMed | Full-Text | Web Supplement | YFGdb Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 SGD paper | PubMed | Full-Text | YFGdb
2007-04-27	YDL189W RBS1/YDL189W mRNA contains an intron in the 5' untranslated region (UTR). [see GenBank Accession #AY245794; Zhang, Z and Dietrich, F.S] Davis CA and Ares M Jr (2006) Accumulation of unstable promoter-associated transcripts upon loss of the nuclear exosome subunit Rrp6p in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 103(9):3262-7 SGD paper | PubMed | Full-Text | Web Supplement | YFGdb
2007-04-04	YDR099W BMH2/YDR099W mRNA contains an intron in the 5' untranslated region (UTR). Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 SGD papers | PubMed | Full-Text | Web Supplement | YFGdb Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 SGD paper | PubMed | Full-Text | YFGdb Zhang Z, et al. (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9 SGD paper | PubMed | Full-Text | YFGdb
2007-04-04	YDL137W ARF2/YDL137W mRNA contains an intron in the 5' untranslated region (UTR). Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 SGD papers | PubMed | Full-Text | Web Supplement | YFGdb Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 SGD paper | PubMed | Full-Text | YFGdb
2007-04-04	YDL061C RPS29B/YDL061C mRNA contains an intron in the 5' untranslated region (UTR). Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 SGD papers | PubMed | Full-Text | Web Supplement | YFGdb Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 SGD paper | PubMed | Full-Text | YFGdb
2007-04-04	snR47 The coordinates of both the 5' and 3' ends of snR47 were shifted 47 nucleotides towards the left end of the chromosome to match those given in the yeast snoRNA database at UMass Amherst and as reported in Balakin AG et al. (1996) and the corresponding GenBank entry U56648. Thanks to Jason Hoskins for reporting this discrepancy and to Wayne Decatur for providing additional confirmation. Balakin AG, et al. (1996) The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell 86(5):823-34 SGD paper | PubMed | Full-Text
2007-04-02	YDRCsigma4 YDRWsigma4, a Ty3 LTR on Chromosome IV, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YDRCsigma4 and is annotated on the Crick strand. The name YDRWsigma4 is being retained as an alias.
2007-04-02	YDRWsigma2 YDRCsigma2, a Ty3 LTR on Chromosome IV, was mistakenly annotated on the wrong strand (i.e., on Crick instead of Watson). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YDRWsigma2 and is annotated on the Watson strand. The name YDRCsigma2 is being retained as an alias.
2007-03-06	ARS416 The ACS within ARS1/ARS416 was annotated based on Xu et al. 2006 and Celniker et al. 1984. Celniker SE, et al. (1984) Deletion mutations affecting autonomously replicating sequence ARS1 of Saccharomyces cerevisiae. Mol Cell Biol 4(11):2455-66 SGD paper | PubMed | Full-Text Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276 SGD paper | PubMed | Full-Text
2007-03-06	ARS404 The ACS within ARS404 was annotated based on Xu et al. 2006 and Russell et al. 1986. Russell DW, et al. (1986) Structure of the Saccharomyces cerevisiae HO gene and analysis of its upstream regulatory region. Mol Cell Biol 6(12):4281-94 SGD paper | PubMed | Full-Text Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276 SGD paper | PubMed | Full-Text
2007-03-06	ARS400 ARS400 was added to the genome annotation on Chromosome IV at coordinates 137-1392 based on Xu et al. 2006. Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276 SGD paper | PubMed | Full-Text
2006-10-05	ARS432, ARS450, ARS451, ARS452, ARS453 The following ARS elements on Chromosome IV, in addition to the ARS Consensus Sequence (ACS) for ARS432, were added to the genome annotation based on Nieduszynski et al. 2006: ARS450/417.5, ARS451/422.5, ARS452/431.5, ARS453/432.5. Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 SGD papers | PubMed Entry | Full-Text | Web Supplement
2006-09-08	ARS403, ARS405, ARS406, ARS409, ARS410, ARS413, ARS414, ARS417, ARS418, ARS419, ARS421, ARS423, ARS425, ARS428, ARS429, ARS430, ARS431, ARS433, ARS434, ARS435, ARS440, ARS443, ARS446 The following new ARS elements on Chromosome IV were added to SGD based on Nieduszynski et al. 2006: ARS403, ARS405, ARS406, ARS409, ARS410, ARS413, ARS414, ARS417, ARS418, ARS419, ARS421, ARS423, ARS425, ARS428, ARS429, ARS430, ARS431, ARS433, ARS434, ARS435, ARS440, ARS443, ARS446. Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 SGD papers | PubMed Entry | Full-Text | Web Supplement
2006-09-08	ARS422 The coordinates of ARS422 were updated based on Nieduszynski et al. 2006. Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 SGD papers | PubMed Entry | Full-Text | Web Supplement
2006-05-08	CEN4 The previously annotated 3' boundary of CEN4 was adjusted to coincide with the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae. Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 SGD paper | PubMed | Full-Text Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68 SGD paper | PubMed | Full-Text
2006-04-14	YDR014W-A New ORF HED1/YDR014W-A was added to the genome annotation for Chromosome IV at coordinates 477794 - 478282 based on Tsubouchi & Roeder 2005. Tsubouchi H and Roeder GS (2006) Budding yeast Hed1 down-regulates the mitotic recombination machinery when meiotic recombination is impaired. Genes Dev 20(13):1766-75 SGD paper | PubMed | Full-Text | Comments & Errata
2006-04-13	YDR015C Due to the correction of a sequence error, the stop site of YDR015C was moved 150 nt upstream, making the predicted protein 79 amino acids rather than 129 aa. The old coordinates for YDR015C were 478195-477806, but are now 478196-477957. Tsubouchi H and Roeder GS (2006) Budding yeast Hed1 down-regulates the mitotic recombination machinery when meiotic recombination is impaired. Genes Dev 20(13):1766-75 SGD paper | PubMed | Full-Text | Comments & Errata
2006-04-13	YDL200C The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., and so the start site for MGT1/YDL200C was moved 54 nt (18 codons) downstream. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2006-04-12	YDL065C, YDL216C The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al. and this was incorporated into SGD. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2006-04-12	YDR422C Based on mutant analysis by Hedbacker et al. 2004, the start codon for SIP/YDR422C was moved 144 bp (48 codons) downstream. Hedbacker et al. 2004 showed that the first ATG of the ORF is not required for expression of functional Sip1p. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Hedbacker K, et al. (2004) Cyclic AMP-dependent protein kinase regulates the subcellular localization of Snf1-Sip1 protein kinase. Mol Cell Biol 24(5):1836-43 SGD paper | PubMed | Full-Text
2006-04-12	ARS422 ARS422, also known as "ARO1 ARS", was added to the genome annotation for Chromosome IV at coordinates 702799-703275 based on Wyrick et al. 2001 and Larimer et al. 1983. Larimer FW, et al. (1983) Isolation of the ARO1 cluster gene of Saccharomyces cerevisiae. Mol Cell Biol 3(9):1609-14 SGD paper | PubMed | Full-Text Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60 SGD paper | PubMed | Full-Text | YFGdb | Comments & Errata
2006-04-10	ARS416 ARS416, originally designated ARS1, was added to the genome annotation for Chromosome IV at coordinates 462351-463189 based on Wyrick et al. 2001, Stinchcomb et al. 1979, and GenBank Accession U01086. "ARS1" is being retained as the Standard Gene Name for historical reasons, but the systematic name "ARS416" is being used for consistency purposes, to indicate that this ARS is part of Chromosome IV. Stinchcomb DT, et al. (1979) Isolation and characterisation of a yeast chromosomal replicator. Nature 282(5734):39-43 SGD paper | PubMed | Full-Text Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60 SGD paper | PubMed | Full-Text | YFGdb | Comments & Errata
2006-04-10	ARS404 ARS404, also known as "HO ARS", was added to the genome annotation for Chromosome IV at coordinates 45919-46272 based on Wyrick et al. 2001 and Russell et al. 1986. Russell DW, et al. (1986) Structure of the Saccharomyces cerevisiae HO gene and analysis of its upstream regulatory region. Mol Cell Biol 6(12):4281-94 SGD paper | PubMed | Full-Text Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60 SGD paper | PubMed | Full-Text | YFGdb | Comments & Errata
2005-11-22	YDL208W The start site of NHP2/YDL208W is being moved 51 bp downstream from 87462 to 87513 based on the 5' SAGE data used by Zhang & Dietrich 2005 to map transcription start sites. This annotation change was also suggested by Kellis et al. 2003. The annotated protein is reduced in length from 173 aa to 156 aa. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51. SGD paper | PubMed | Full-Text | YFGdb
2005-11-22	YDR378C The start site of LSM6/YDR378C is being moved 111 bp downstream from 1229710 to 1229599, based on the 5' SAGE data used by Zhang & Dietrich 2005 to map transcription start sites. Bouveret et al. 2000 also suggested this new start site because it is consistent with the protein's apparent molecular mass of 9.3 kDa, and is supported by comparison of the yeast Lsm6p sequence with homologs from other organisms. The annotated size of the protein changes from 123 aa to 86 aa. Bouveret E, et al. (2000) A Sm-like protein complex that participates in mRNA degradation. EMBO J 19(7):1661-71 SGD paper | PubMed | Full-Text Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51. SGD paper | PubMed | Full-Text | YFGdb
2005-11-16	YDL007C-A, YDR119W-A, YDR374W-A, YDR461C-A Based on genome sequence comparisons among six Saccharomyces species, Cliften et al. 2003 suggested that the following new ORFs be added to the S. cerevisiae genome annotation: YDL007C-A, YDR119W-A, YDR374W-A, YDR461C-A. Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2004-10-12	CEN4 Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003. Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 SGD paper | PubMed | Full-Text Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68 SGD paper | PubMed | Full-Text
2004-04-01	snR84 Start and stop coordinates updated per McCutcheon & Eddy 2004. McCutcheon JP and Eddy SR (2004) Detailed correction to: Computational identification of noncoding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res. 31:4119-4128, 2003 SGD paper | Web Supplement
2004-02-24	YDL115C Davis et al. 2000 demonstrated that there is an intron in the 5'UTR of IWR1/YDL115C that does not affect the coding region. Based on sequence comparison with related fungi, Brachat et al. 2003 later predicted a different intron that would extend the N-terminus of IWR1/YDL115C. Brachat et al. predict that the intron uses the same 5' splice junction demonstrated by Davis et al., but a different 3' splice junction. The intron predicted by Brachat et al. was briefly incorporated into SGD (for one month from 2004-01-23 to 2004-02-24), but was then removed and will be not annotated again until supported by experimental evidence. Intron and splice junctions confirmed by Davis et al.: 1st exon ...GGATTCTGTG CAGGCATTAT intron GTATGTGTTG TTATTCTACC GATATAACAA AAATGCGTTT GACTAACTAA GTTCATCTGG GACAATTCAG TAATTGATGA GGGGAAAAG 2nd exon AGTGAAGAAG CAGAAGTTCA... Intron and splice junctions predicted by Brachat et al.: 1st exon ...GGATTCTGTG CAGGCATTAT intron GTATGTGTTG TTATTCTACC GATATAACAA AAATGCGTTT GACTAACTAA GTTCATCTGG GACAATTCAG 2nd exon TAATTGATGA GGGGAAAAGA... Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6 SGD paper | PubMed | Full-Text Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. SGD paper | PubMed | Full-Text
2004-01-26	YDR381C-A Increased the size of the intron in YDR381C-A by 1 bp on 5' end and 2 bp on 3' end based on conserved splice site sequences. See Blandin et al. 2000. Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6 SGD paper | PubMed | Full-Text
2004-01-23	YDL115C Based on analyses of homology and synteny in Ashbya gossypii and Candida albicans, Brachat et al. (2003) proposed an intron and 5' extension for IWR1/YDL115C. The resulting ORF is in the same frame with the start codon shifted 409 bp upstream, now including a 70-bp intron; the protein has a 113-residue extension at the N-terminus. Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. SGD paper | PubMed | Full-Text
2003-09-27	YDR318W Based on the alignment of orthologs in related Saccharomyces species, Cliften et al. proposed an intron and new 5' exon for MCM21/YDR318W. The resulting ORF is in the same frame with the start moved 434 nt upstream, and the protein has a 117-residue extension at the N-terminus. The same intron and 5' exon are also described by Ortiz et al. 1999. Ortiz J, et al. (1999) A putative protein complex consisting of Ctf19, Mcm21, and Okp1 represents a missing link in the budding yeast kinetochore. Genes Dev 13(9):1140-55 SGD paper | PubMed | Full-Text Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2003-09-22	YDL069C The start site of CBS1/YDL069C was moved 12 nt (4 codons) downstream, based on automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Deletion analyses by Krause-Bucholz et al. 2000 demonstrate that N-terminal sequences are not essential for either the function or mitochondrial targeting of this protein. Krause-Buchholz U, et al. (2000) Identification of functionally important regions of the Saccharomyces cerevisiae mitochondrial translational activator Cbs1p. Yeast 16(4):353-63 SGD paper | PubMed | <353::AID-YEA539>3.0.CO;2-%23 Full-Text Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2003-09-22	YDR383C Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for NKP1/YDR383C was moved 42 nt (14 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2003-09-22	YDR400W Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for URH1/YDR400W was moved 114 nt (38 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) This start site was previously proposed by Kurtz et al, who noted that translation from this second methionine is more consistent with the observed size of URH1 and has closer similarity to related proteins. Kurtz JE, et al. (2002) The URH1 uridine ribohydrolase of Saccharomyces cerevisiae. Curr Genet 41(3):132-41 SGD paper | PubMed | Full-Text Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2003-09-22	YDR205W The start site of MSC2/YDR205W was moved 48 nt (16 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2003-09-22	YDR486C Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for VPS60/YDR486C was moved 99 nt (33 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2003-09-22	YDL144C The start site of YDL144C was moved 9 nt (3 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2003-09-22	YDR463W Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for STP1/YDR463W was moved 174 nt (58 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Previously published data from Wang et al. demonstrate that the second in frame methionine is the most likely start codon. Wang SS, et al. (1992) STP1, a gene involved in pre-tRNA processing, encodes a nuclear protein containing zinc finger motifs. Mol Cell Biol 12(6):2633-43 SGD paper | PubMed | Full-Text Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2003-09-22	YDL139C The start site of YDL139C was moved 72 nt (24 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2003-09-22	YDR083W The start site of RRP8/YDR083W was moved 57 nt (19 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2003-09-22	YDR485C Based on the automated comparison of closely related Saccharomyces species by Kellis et al., the start site for VPS72/YDR485C was moved 45 nt (15 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2003-09-09	TEL04L, TEL04R The chromosomal locations for the following telomeric elements on Chromosome IV were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL04L, TEL04L-XC, TEL04L-XR, TEL04L-TR, TEL04R, TEL04R-XC, TEL04R-XR, TEL04R-TR, TEL04R-YP.
2003-07-29	YDL025W-A, YDL086C-A, YDL159C-B, YDR354C-A, YDR464C-A, YDR510C-A, YDR524C-A, YDR545C-A Thanks to Kumar et al. for providing the coordinates of the following ORFs on Chromosome IV: YDL025W-A, YDL086C-A, YDL159C-B, YDR354C-A, YDR464C-A, YDR510C-A, YDR524C-A, YDR545C-A. Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63. SGD paper | PubMed | Full-Text | YFGdb | Comments & Errata
2003-07-29	YDL160C-A Thanks to Brachat et al. for providing the coordinates of ORF YDL160C-A. Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. SGD paper | PubMed | Full-Text
2003-07-29	YDL022C-A, YDR169C-A, YDR182W-A, YDR183C-A, YDR194W-A, YDR246W-A, YDR406W-A Thanks to Kessler et al. for providing the coordinates of the following ORFs on Chromosome IV: YDL022C-A, YDR169C-A, YDR182W-A, YDR183C-A, YDR194W-A, YDR246W-A, YDR406W-A. Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. SGD paper | PubMed | Full-Text
2003-07-29	YDR003W-A, YDR118W-A, YDR320W-B, YDR371C-A Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following ORFs on Chromosome IV: YDR003W-A, YDR118W-A, YDR320W-B, YDR371C-A. Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9 SGD paper | PubMed | Full-Text Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. SGD paper | PubMed | Full-Text | YFGdb Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. SGD paper | PubMed | Full-Text | Web Supplement | YFGdb
2003-07-29	YDR524C-B, YDR524W-C Thanks to MIPS for providing the coordinates of the following ORFs on Chromosome IV: YDR524C-B, YDR524W-A.
2003-03-06	snR84 Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8. McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28 SGD paper | PubMed | Full-Text | Comments & Errata
2001-03-09	snR47 Changed from W -> C: old start coord: 541641; old stop coord: 541701 new start coord: 541739; new stop coord: 541641. Balakin AG, et al. (1996) The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell 86(5):823-34 SGD paper | PubMed | Full-Text , Ni et al. (1996) Cell 86(5):823-834 snoRNA database Personal communication: Dr. Eric Steinmetz Dept. of Biomolecular Chemistry University of Wisconsin 1300 University Ave. Madison, WI 53706
2001-01-30	YDL085C-A ORF added based on similarity to an S. pombe gene (information submitted by Valerie Wood).
2000-12-01	YDR139C The intron of ORF YDR139C was moved 3 nt downstream as a whole, changing the relative coordinates of the coding region from 1-146..220-307 to 1-149..223-307. Note that while the coding sequence has changed slightly, the genomic sequence remains unchanged.
2000-07-22	YDL189W The start site of ORF YDL189W was moved 238 nt downstream and the annotated intron was removed, changing the relative coordinates of the coding region from 1-100..246-1612 to 1-1374. Note that the stop remains unchanged.
1999-07-17	YDR381W A new intron and 5' exon were added to YDR381W. Relative coordinates change from 1-321 to 1-285..1052-1447, and chromosomal coordinates change from 1237718-1238038 to 1236547-1236831..1237598-1237993.
1998-05-21	YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD. Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. SGD paper | PubMed | Full-Text | YFGdb