Details of 2023 Reference Genome Annotation Update R64.4

The S. cerevisiae strain S288C reference genome annotation was updated. The new genome annotation is release R64.4.1, dated 2023-08-23. Note that the underlying genome sequence itself was not altered in any way.

R64.4 Annotation update summary

This annotation update included (details in table below):

• new uORFs for 3 ORFs:
  • FPS1/YLL043W
  • ACC1/YNR016C
  • HOL1/YNR055C
• 8 new ncRNAs:
  • SUT035/YNCC0015W
  • SUT053/YNCD0033W
  • SUT468/YNCD0034C
  • SUT532/YNCG0047C
  • SUT125/YNCG0048W
  • SUT126/YNCG0049W
  • SUT390/YNCP0025W
  • SUT418/YNCP0026W
• 3 ORFs demoted from 'Uncharacterized' to 'Dubious' based on request from NCBI because they overlap tRNAs:
  • YDR278C
  • YOL013W-A
  • YPR108W-A

R64.4 Annotation update details

Chr	Feature	Description of change	Reference
III	SUT035/YNCC0015W	New ncRNA chrIII:205766..205942 (+ strand)	Xu Z, et al. (2009) PMID:19169243, Balarezo-Cisneros LN, et al. (2021) PMID:33493158
IV	YDR278C	Change ORF qualifier from Uncharacterized to Dubious	Requested by NCBI
IV	SUT053/YNCD0033W	New ncRNA chrIV:506334..507774 (+ strand)	Xu Z, et al. (2009) PMID:19169243, Balarezo-Cisneros LN, et al. (2021) PMID:33493158
IV	SUT468/YNCD0034C	New ncRNA chrIV:506546..507450 (- strand)	Xu Z, et al. (2009) PMID:19169243, Balarezo-Cisneros LN, et al. (2021) PMID:33493158
VII	SUT532/YNCG0047C	New ncRNA chrVII:17213..17709 (- strand)	Xu Z, et al. (2009) PMID:19169243, Balarezo-Cisneros LN, et al. (2021) PMID:33493158
VII	SUT125/YNCG0048W	New ncRNA chrVII:650855..651159 (+ strand)	Xu Z, et al. (2009) PMID:19169243, Balarezo-Cisneros LN, et al. (2021) PMID:33493158, Feng MW, et al. (2022) PMID:36712349
VII	SUT126/YNCG0049W	New ncRNA chrVII:660087..661399 (+ strand)	Xu Z, et al. (2009) PMID:19169243, Balarezo-Cisneros LN, et al. (2021) PMID:33493158
XII	FPS1/YLL043W	New uORF uORF2 3 codons chrXII:49924..49932 (+ strand) ATGCATTAA	Cartwright SP, et al. (2017) PMID:28279185
XIV	ACC1/YNR016C	New uORF 4 codons chrXIV:661704..661715 (- strand) ATGTGTTTATAA	Blank HM, et al. (2017) PMID:28057705
XIV	HOL1/YNR055C	New uORF 7 codons chrXIV:730381..730401 (- strand) ATGCTATTACTACCAAGTTGA	Vindu A, et al. (2021) PMID:34375581
XV	YOL013W-A	Change ORF qualifier from Uncharacterized to Dubious	Requested by NCBI
XVI	SUT390/YNCP0025W	New ncRNA chrXVI:52977..53465 (+ strand)	Xu Z, et al. (2009) PMID:19169243, Feng MW, et al. (2022) PMID:36712349
XVI	SUT418/YNCP0026W	New ncRNA chrXVI:588998..589830 (+ strand)	Xu Z, et al. (2009) PMID:19169243, Feng MW, et al. (2022) PMID:36712349
XVI	YPR108W-A	Change ORF qualifier from Uncharacterized to Dubious	Requested by NCBI