Chromosome XVI History
This page lists all sequence and annotation changes that have been made to the Chromosome XVI systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome XVI has been updated 23 times, affecting 16 features.
- The annotation of Chromosome XVI has been updated 39 times, affecting 72 features.
- Current and past versions can be obtained from SGD's Download site.
Contents
[hide]Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YPL224C | 128039 | 128039 | Substitution | T | G |
126768 | 126768 | Insertion | C | |||
Two nucleotide changes were made within the ORF MMT2/YPL224C, altering its coding sequence: one single nucleotide substitution near the 5' end, and one single nucleotide insertion near the 3' end. The start and majority of the reading frame remain the same, but the C-terminus has changed, and the annotated protein is now 35 amino acids longer.
New 126721 ACCTTTAGAGTCAGAGGTTACATCAACAAACTCGACGTCCACCTTCCCCACGTTTGGCAC 126780 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 126721 ACCTTTAGAGTCAGAGGTTACATCAACAAACTCGACGTCCACCTTCCC-ACGTTTGGCAC 126779 New 127981 CAGGCTTGATGTTCTTATGGCCCTCCCGGCAGCATGGTAACTAGTGTTGTTATAACCTGGCACAAAGGAA 128050 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 127980 CAGGCTTGATGTTCTTATGGCCCTCCCGGCAGCATGGTAACTAGTGTTGTTATAACCTGTCACAAAGGAA 128049 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YPR035W | 642955 | 642955 | Substitution | G | A |
642995 | 642995 | Substitution | C | T | ||
Nucleotide change(s) in the coding region of GLN1/YPR035W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 251 is now Threonine rather than Alanine, and residue 264 is now Methionine rather than Threonine.
New 642949 GGTTGTCACACTAACGTTTCCACCAAGGAAATGAGACAACCAGGTGGTATGAAATACATCGAACAAGCCA 643018 ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old 642946 GGTTGTCACGCTAACGTTTCCACCAAGGAAATGAGACAACCAGGTGGTACGAAATACATCGAACAAGCCA 643015 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YPR097W | 727933 | 727933 | Substitution | G | A |
A single nucleotide substitution within the coding region of YPR097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 848 is now Serine rather than Glycine.
New 727918 ATTTTGAGAAGTTCATGAGTGATTTGATCAGGCTTGTTGATGATGTTATCAATGGTCAGT 727977 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 727916 ATTTTGAGAAGTTCATGGGTGATTTGATCAGGCTTGTTGATGATGTTATCAATGGTCAGT 727975 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YPR121W | 778863 | 778863 | Substitution | T | A |
A single nucleotide substitution within the coding region of THI22/YPR121W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 95 is now Glutamine rather than Histidine.
New 778858 CGGCGCTCAAAATATACCAAAGAAAATGGTATCTCAAATATTAGACGCCAATTTACAGGA 778917 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Old 778854 CGGCGCTCATAATATACCAAAGAAAATGGTATCTCAAATATTAGACGCCAATTTACAGGA 778913 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YPL108W, YPL109C | 347528 | 347528 | Insertion | G | |
347759 | 347759 | Insertion | C | |||
Two separate single nucleotides were inserted in the intergenic region between ORFs YPL109C and YPL108W.
New 347521 GGTATTATTGCCCCTCATATATTCGGGGTTATTTATTTTTCGTTGCTTGAAGTAAAGCCT 347580 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Old 347520 GGTATTATT-CCCCTCATATATTCGGGGTTATTTATTTTTCGTTGCTTGAAGTAAAGCCT 347578 New 347751 CCCTTTCGCGGCACTTTTTCTCTTAGCTCTGCTTGATACATCGACTGGGAACTTCTTCTCTTTGAGCCAA 347820 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 347749 CCCTTTCGCGG-ACTTTTTCTCTTAGCTCTGCTTGATACATCGACTGGGAACTTCTTCTCTTTGAGCCAA 347817 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YPR121W, YPRWdelta16 | 778376 | 778376 | Insertion | C | |
778302 | 778302 | Insertion | G | |||
Two single nucleotide insertions were made in the intergenic region between YPRWdelta16 and YPR121W/THI22.
New 778258 TTAATGGAATAACGTGATTTTTGTACCAAATTGCCTATTTCAGATTCGGCGTGCGCTTCC 778317 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 778256 TTAATGGAATAACGTGATTTTTGTACCAAATTGCCTATTTCAGATTC-GCGTGCGCTTCC 778314 New 778368 TGCACGGAAGATCCTTGCAGGAATCAAATACTGCCTTTCACTTTGCAACCTCTTAATCACATAGTAGCAC 778437 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 778365 TGCACGGAAGAT-CTTGCAGGAATCAAATACTGCCTTTCACTTTGCAACCTCTTAATCACATAGTAGCAC 778433 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YPR035W, YPR036W | 643579 | 643579 | Substitution | T | C |
A single nucleotide substitution was made in the intergenic region between ORFs YPR035W/GLN1 and YPR036W/VMA13.
New 643559 TCGAATTTTTTCTTTTTTTTTTTCTGCAAAGCGACGCTGTGTTGTATATTGCTCTAAAAT 643618 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old 643556 TCGAATTTTTTCTTTTTTTTTTTTTGCAAAGCGACGCTGTGTTGTATATTGCTCTAAAAT 643615 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YPL016W | 523639 | 523639 | Substitution | C | T |
A single nucleotide substitution was made within the ORF SWI1/YPL016W. Note that the protein sequence was not changed.
New 523619 GATTCCTCCCTAACCAATTTCCTTTGAAAATTCACAGAACTCCTTATTTGACTTCTTTGA 523678 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old 523616 GATTCCTCCCTAACCAATTTCCTCTGAAAATTCACAGAACTCCTTATTTGACTTCTTTGA 523675 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YPL016W, YPL017C | 520375 | 520375 | Insertion | C | |
520378 | 520378 | Substitution | C | G | ||
520646 | 520646 | Insertion | C | |||
520818 | 520818 | Deletion | T | |||
Four single nucleotide changes were made in the intergenic region between ORFs YPL016W/SWI1 and YPL017C/IRC15: two insertions, one substitution, and one deletion.
New 520320 AGATGCATGCCTGCAGGTCTGGGTGTACCCCCTGCCTGAGTGTTCCACCCAGGCCTCGCCGGAGGAAAAT 520389 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| Old 520318 AGATGCATGCCTGCAGGTCTGGGTGTACCCCCTGCCTGAGTGTTCCACCCAGGCCTCG-CGCAGGAAAAT 520386 New 520620 CATATTCACATTGCGTTTTAGTCATAACCACCTTCCGGTATTCATCATTCGTATTGAATA 520679 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Old 520617 CATATTCACATTGCGTTTTAGTCATAACCA-CTTCCGGTATTCATCATTCGTATTGAATA 520675 New 520800 ATCTCTGCTTTGGCATTTCGCG-TTGTTTCCTCTCACGGATTGCAGATTATTGTTCACCA 520858 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 520796 ATCTCTGCTTTGGCATTTCGCGTTTGTTTCCTCTCACGGATTGCAGATTATTGTTCACCA 520855 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YPL036W, YPL037C | 482773 | 482773 | Deletion | T | |
A single nucleotide was deleted from the intergenic region between ORFs YPL037C/EGD1 and YPL036W/PMA2.
New 482761 AAACATACCCATAAC-TTTTTTTTTTTCATTTTTCGTTGCTGTGTGCTAGTACAATTTAA 482819 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 482758 AAACATACCCATAACTTTTTTTTTTTTCATTTTTCGTTGCTGTGTGCTAGTACAATTTAA 482817 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YPR078C, YPR079W | 698524 | 698524 | Deletion | A | |
A single nucleotide deletion was made in the intergenic region between ORFs YPR078C and YPR079W/MRL1.
New 698519 TTCTTCTG-AAAAAAAAAAAAAAAAATTCAAAAAAAGACACCTTTCTACCTTGGCAGTAA 698577 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Old 698516 TTCTTCTGAAAAAAAAAAAAAAAAAATTCAAAAAAAGACACCTTTCTACCTTGGCAGTAA 698575 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2004-07-21 | YPL109C | 347273 | 347273 | Insertion | T | |
347265 | 347265 | Deletion | T | |||
347285 | 347285 | Insertion | A | |||
347375 | 347375 | Insertion | T | |||
The works of Kellis et al. 2003 and Cliften et al. 2003 predicted multiple insertions and deletions in YPL109C, and the sequence errors were confirmed in S288C by SGD. As a consequence of these changes, YPL109C was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 590 to 657 amino acids.
New: TGTTTTGGAAACGAATTTT-GTGTCAAATAAAAAGCAATTGACGTAGGTATTATGAACTG ||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||| Old: 347246 TGTTTTGGAAACGAATTTTTGTGTCAAA-AAAAAGCAATTG-CGTAGGTATTATGAACTG 347303 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2003-09-29 | YPR089W, YPR090W | 713683 | 713683 | Deletion | T | |
Due to deletion of a T at position 713683, YPR089W and YPR090W were merged. After merging YPR089W (713271 - 713738 (1-468)) and YPR090W (713728 - 715938 (1-2211)), the coordinates of the merged ORF, YPR089W, are 713271 - 715937 (1-2667). YPR090W is now an alias of YPR089W. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. |