Chromosome XV History
This page lists all sequence and annotation changes that have been made to the Chromosome XV systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome XV has been updated 63 times, affecting 53 features.
- The annotation of Chromosome XV has been updated 51 times, affecting 90 features.
- Current and past versions can be obtained from SGD's Download site.
Contents
[hide]Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YOL138C | 64173 | 64173 | Substitution | G | C |
61985 | 61985 | Substitution | A | T | ||
63708 | 63708 | Substitution | C | T | ||
Nucleotide change(s) in the coding region of RTC1/YOL138C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 393 is now Cysteine rather than Serine, and residue 548 is now Aspartic Acid rather than Glycine.
New 61970 CGCATGTCTGGGCGATCCGATTATTGGTGCTGTATGGGAAGAAAGCTTTTTAAAAGTTTC 62029 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 61970 CGCATGTCTGGGCGAACCGATTATTGGTGCTGTATGGGAAGAAAGCTTTTTAAAAGTTTC 62029 New 63660 GTAGGTTGAAGCTCCGGTTCTACCACCTCATATGAGCCTATCTCTTGGTCAACTGAAAGT 63719 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 63660 GTAGGTTGAAGCTCCGGTTCTACCACCTCATATGAGCCTATCTCTTGGCCAACTGAAAGT 63719 New 64140 GCATTGGCATTGTCGCCAACAAACCAGAGGCAGCATTTACCGTCTCTACCACCTGTAGCA 64199 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 64140 GCATTGGCATTGTCGCCAACAAACCAGAGGCAGGATTTACCGTCTCTACCACCTGTAGCA 64199 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL142W | 56036 | 56036 | Substitution | C | G |
Nucleotide change(s) in the coding region of RRP40/YOL142W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 160 is now Leucine rather than Phenylalanine.
New 55991 CTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTGAATTTCGCACGCC 56050 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 55990 CTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTCAATTTCGCACGCC 56049 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL077C | 186243 | 186243 | Substitution | A | C |
Nucleotide change(s) in the coding region of BRX1/YOL077C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 161 is now Glycine rather than Cysteine.
New 186230 TTTGGTGGTACACCAAAATTATGCACTAGCAACTCCTTAATTAATTGGTAGTGTGGGGAG 186289 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 186230 TTTGGTGGTACACAAAAATTATGCACTAGCAACTCCTTAATTAATTGGTAGTGTGGGGAG 1862890 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL075C | 190052 | 190052 | Substitution | CG | GC |
Nucleotide change(s) in the coding region of YOL075C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1164 is now Alanine rather than Arginine.
New 190020 TTTCGAAAAATGTATTTGTCATTATACCAAGAGCTTCGCCACAACAGGTAACAATAAAGG 190079 |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 190020 TTTCGAAAAATGTATTTGTCATTATACCAAGACGTTCGCCACAACAGGTAACAATAAAGG 190079 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR306C | 889947 | 889947 | Substitution | G | C |
Nucleotide change(s) in the coding region of MCH5/YOR306C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 495 is now Cysteine rather than Serine.
New 889913 ATGTAGCAAACAGCGCTTACAAAAGTTGCCAAACCGCAAAAAATAATATAGTGTTGGTAA 889972 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 889911 ATGTAGCAAACAGCGCTTACAAAAGTTGCCAAACCGGAAAAAATAATATAGTGTTGGTAA 889970 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR149C | 611036 | 611036 | Substitution | A | G |
611023 | 611024 | Substitution | GC | TG | ||
Nucleotide change(s) in the coding region of SMP3/YOR149C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 122-123 are now IK rather than MQ.
New 610993 TACGTAAGAAGTTAAAAGTAGACTTTTTTTGATGAATTGTACGGCCTTTCTCTCATCCCT 611052 ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| Old 610994 TACGTAAGAAGTTAAAAGTAGACTTTTTTGCATGAATTGTACAGCCTTTCTCTCATCCCT 611053 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR140W | 588363 | 588365 | Substitution | GCG | AGC |
588344 | 588344 | Deletion | C | |||
588318 | 588318 | Insertion | T | |||
Nucleotide change(s) in the coding region of SFL1/YOR140W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 446-462 are now FVQYQPQSQQHVTYAKQ rather than LYNTNRSRNQHVTYASE.
New 588314 TTTTTGTACAATACCAACCGCAGTCGCAAC-AACATGTGACTTATGCGAAGCAACCGGCA 588372 |||| ||||||||||||||||||||||||| |||||||||||||||||| |||||||| Old 588315 TTTT-GTACAATACCAACCGCAGTCGCAACCAACATGTGACTTATGCGAGCGAACCGGCA 588373 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL058W | 220195 | 220195 | Deletion | T | |
220207 | 220207 | Insertion | C | |||
Nucleotide change(s) in the coding region of ARG1/YOL058W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 329-332 are now SYFT rather than FLLH.
New 220179 TTGATATATAACGGTT-CCTACTTCACCCCAGAGTGTGAGTACATCAGATCTATGATCCA 220238 |||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| Old 220179 TTGATATATAACGGTTTCCTACTTCACCC-AGAGTGTGAGTACATCAGATCTATGATCCA 220237 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR130C | 570495 | 570495 | Substitution | A | G |
Nucleotide change(s) in the coding region of ORT1/YOR130C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 105 is now Serine rather than Phenylalanine.
New 570474 TCAGGATTTGCCCCAACGGGGAAACGTTTGTATGTTTTTCTAAAAATTTAGAACATTGGT 570533 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 570475 TCAGGATTTGCCCCAACGGGAAAACGTTTGTATGTTTTTCTAAAAATTTAGAACATTGGT 570534 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR297C | 874911 | 874911 | Substitution | C | T |
Nucleotide change(s) in the coding region of TIM18/YOR297C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 137 is now Glutamic Acid rather than Glycine.
New 874863 TCCTCCATAGAGGCAATAAAGGGCGAGCTTATGCCATCTTGGATACTTTTCCTTCGGTAT 874922 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 874862 TCCTCCATAGAGGCAATAAAGGGCGAGCTTATGCCATCTTGGATACTTTCCCTTCGGTAT 874921 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL022C | 280393 | 280393 | Substitution | A | G |
A single nucleotide substitution was made within ORF TSR4/YOL022C. Note that the protein sequence was not changed.
New 280377 GGTACCCCATTCCATGCCGTTATCGACAGACACTACTTCTTCCAGATCAAAAATCATCTT 280436 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 280378 GGTACCCCATTCCATACCGTTATCGACAGACACTACTTCTTCCAGATCAAAAATCATCTT 280437 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR255W, YOR256C | 808197 | 808197 | Insertion | A | |
A single nucleotide insertion was made in the intergenic region between ORFs OSW1/YOR255W and TRE2/YOR256C.
New 808183 TTACATAATTAAAGAAAAAATTTTATTAACATACTTCCTTATACTTACAATATGTATTCT 808242 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 808184 TTACATAATTAAAG-AAAAATTTTATTAACATACTTCCTTATACTTACAATATGTATTCT 808242 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR298C-A, YOR299W | 877795 | 877795 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs MBF1/YOR298C-A and BUD7/YOR299W.
New 877783 CTATTATTGGTTAAGCGACAGGCGCCTTTCCAGCTACCTAATATATACCACCACCGTCAA 877842 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 877782 CTATTATTGGTTAA-CGACAGGCGCCTTTCCAGCTACCTAATATATACCACCACCGTCAA 877840 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | ARS1531 | 35765 | 35765 | Substitution | G | C |
A single nucleotide substitution was made within ARS1531.
New 35751 TTTTCAAAATCCGCGCAAAATTATAGAATTCATCATATATAATGAAGGAACTGTGTTCCT 35810 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 35750 TTTTCAAAATCCGCGGAAAATTATAGAATTCATCATATATAATGAAGGAACTGTGTTCCT 35809 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2004-01-23 | ARS1531, YOL152W | 36149 | 36149 | Substitution | G | A |
36119 | 36119 | Substitution | G | C | ||
36056 | 36056 | Substitution | G | A | ||
36013 | 36013 | Substitution | T | A | ||
Four separate single nucleotide substitutions were made in the intergenic region between ARS1531 and ORF FRE7/YOL152W.
New 36001 AAAACTTGAGAATAACATAACCCTTTAATAGGCCAATGCAACTGATAGAACACCAGAAAA 36060 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| Old 36000 AAAACTTGAGAATTACATAACCCTTTAATAGGCCAATGCAACTGATAGAACACCAGGAAA 36059 New 36061 AGTTGTAATGCCAGTGCGGCTGAACAGAATCTGTGGTAATAGATTTCGGGTATAATGCGC 36120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 36060 AGTTGTAATGCCAGTGCGGCTGAACAGAATCTGTGGTAATAGATTTCGGGTATAATGCGG 36119 New 36121 AAATTAGGAATACTCATATGTTCAGATAGAATAAATAATAAAGAGACCTTCAACATAAAA 36180 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old 36120 AAATTAGGAATACTCATATGTTCAGATAGGATAAATAATAAAGAGACCTTCAACATAAAA 36179 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR256C | 809751 | 809751 | Substitution | C | T |
A single nucleotide substitution was made within ORF TRE2/YOR256C. Note that the protein sequence was not changed.
New 809693 GTCTATATTCTCACCATATGGCTCAGATATGAAGATTACAGCTTTAGCTCCGAATTTCTC 809762 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 809693 GTCTATATTCTCACCATATGGCTCAGATATGAAGATTACAGCTTTAGCCCCGAATTTCTC 809762 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL125W | 84121 | 84121 | Substitution | T | C |
A single nucleotide substitution was made within ORF TRM13/YOL125W.
New 84110 AAAAAATGCAACAAGACCAAACTAAGCCATTTAAACGATGATAAGCCATACTATGAACCG 84169 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 84110 AAAAAATGCAATAAGACCAAACTAAGCCATTTAAACGATGATAAGCCATACTATGAACCG 84169 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL058W, YOL059W | 219000 | 219000 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs GPD2/YOL059W and ARG1/YOL058W.
New 218990 ATGACTGCGTAGCGGCAGATAGTGTAATCTGAGCAGTTGCGAGACCCAGACTGGCACTGT 219049 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 218990 ATGACTGCGTA-CGGCAGATAGTGTAATCTGAGCAGTTGCGAGACCCAGACTGGCACTGT 219048 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. |