Chromosome II History
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YBR068C | 375081 | 375081 | Substitution | C | A |
375272 | 375272 | Substitution | T | A | ||
374011 | 374011 | Substitution | T | A | ||
Nucleotide substitutions within the coding region of BAP2/YBR068C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 139 is now Valine rather than Glutamic Acid, and residue 203 is now Tryptophan rather than Glycine.
New 373969 GAAGTCAAGGTCAATCTTGTCGAGGGGATTTAATAGCGTAAAATCACGGTTGTAAACCAT 374028 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 373966 GAAGTCAAGGTCAATCTTGTCGAGGGGATTTAATAGCGTAAAATCTCGGTTGTAAACCAT 374025 New 375049 AAGAATATAAATGTCCGGATTTATTTTATCATTCCAAAATTGAATAGTCATAGACGCGGT 375108 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old 375046 AAGAATATAAATGTCCGGATTTATTTTATCATTCCCAAATTGAATAGTCATAGACGCGGT 375105 New 375229 ATAGGTTACCGCCATCTCACCTGCAGCTTGGATCATGAAGTACGTCACGAAAGAAACCAA 375288 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 375226 ATAGGTTACCGCCATCTCACCTGCAGCTTGGATCATGAAGTACGTCTCGAAAGAAACCAA 375285 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR097W | 439496 | 439496 | Substitution | T | G |
437344 | 437344 | Substitution | A | G | ||
Nucleotide change(s) in the coding region of VPS15/YBR097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 134 is now Alanine rather than Threonine, and residue 851 is now Arginine rather than Isoleucine.
New 437325 ATTCATTGCTTTCCAGTTGTTAAATGCATTAAAGGACATTCATAATCTGAATATTGTCCA 437384 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 437319 ATTCATTGCTTTCCAGTTGTTAAATACATTAAAGGACATTCATAATCTGAATATTGTCCA 437378 New 439485 CTTAACTGCTGAAGACAGAAATTGGATTGATAAGTTCCACATTATTGGGCTAACAGAAAA 439544 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 439479 CTTAACTGCTGAAGACATAAATTGGATTGATAAGTTCCACATTATTGGGCTAACAGAAAA 439538 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR045C | 328382 | 328382 | Insertion | T | |
A single nucleotide was inserted within ORF GIP1/YBR045C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 66 amino acids longer.
New 328369 CTCAGTCTATAATTTTCTGCTTCATTTCTCTGCCTTTTATACTCTGTATATTGAAAATAA 328428 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 328368 CTCAGTCTATAATTT-CTGCTTCATTTCTCTGCCTTTTATACTCTGTATATTGAAAATAA 328426 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR044C | 324366 | 324366 | Insertion | T | |
One nucleotide was inserted within ORF TCM62/YBR044C, very near its 3' end, altering its coding sequence. The start, stop, and majority of reading frame remain the same, but the C-terminus is different and the annotated protein sequence is now one amino acid shorter.
New 324349 TGTGCCGTTCAGGCTTTTTGTATACACATGTGATAATTGTATTACAGCTTGTAAGTAATT 324408 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 324349 TGTGCCGTTCAGGCTTTT-GTATACACATGTGATAATTGTATTACAGCTTGTAAGTAATT 324407 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR007C | 250403 | 250403 | Substitution | C | G |
250039 | 250039 | Substitution | T | G | ||
Two nucleotide substitutions within the coding region of DSF2/YBR007C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 205 is now Serine rather than Arginine, and residue 327 is now Proline rather than Threonine.
New 250012 AGACCGTTTAGGAGATGGTTTGATGGGTGTTGTATCACTCTTAGTTAACTTGAGTTTGGA 250071 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 250013 AGACCGTTTAGGAGATGGTTTGATGGTTGTTGTATCACTCTTAGTTAACTTGAGTTTGGA 250072 New 250372 CCTATATTTCTCGAAGTTGAAAGGATTAGGGCTATTTGTGCTTCTATTGCCATTTTCAAG 250431 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Old 250373 CCTATATTTCTCGAAGTTGAAAGGATTAGGCCTATTTGTGCTTCTATTGCCATTTTCAAG 250432 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL105C | 17455 | 17455 | Substitution | A | C |
15835 | 15835 | Substitution | T | C | ||
15332 | 15332 | Substitution | G | C | ||
The substitution of three nucleotides within the coding region of PKC1/YBL105C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 81 is now Cysteine rather than Phenylalanine, residue 621 is now Arginine rather than Lysine, and residue 789 is now Alanine rather than Proline.
New 15301 TGCGGAGATTGTTGATCAGTGGTTCTGGAGGCATGAGTACTTGTAGGAGCCAAGGACACT 15360 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old 15301 TGCGGAGATTGTTGATCAGTGGTTCTGGAGGGATGAGTACTTGTAGGAGCCAAGGACACT 15360 New 15791 TAAATTTATTTAGTTTCTCACGCCCGTGCGTTTGTAGTGAAATTCTTTTATCAATAATAG 15850 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 15791 TAAATTTATTTAGTTTCTCACGCCCGTGCGTTTGTAGTGAAATTTTTTTATCAATAATAG 15840 New 17411 CATTTGGCGATTTGGTAGAAAGAAACCCGTATTCCTTCGAATTGCATCGCTCATTATCTT 17470 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 17411 CATTTGGCGATTTGGTAGAAAGAAACCCGTATTCCTTCGAATTGAATCGCTCATTATCTT 17470 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL057C | 113437 | 113437 | Deletion | G | |
One nucleotide was deleted within ORF PTH2/YBL057C, near its 5' end, altering its coding sequence. The stop and reading frame remain the same, but the start has been moved 18 nucleotides downstream and the annotated protein sequence is now six amino acids shorter.
New 113393 ATGGTGTAATTCGAAGAAACTGTCATCTTTTCCATTAAAAAG-ACGTTATCATGTTACTC 113451 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 113395 ATGGTGTAATTCGAAGAAACTGTCATCTTTTCCATTAAAAAGGACGTTATCATGTTACTC 113454 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL068W | 92918 | 92920 | Deletion | CCG | |
92916 | 92916 | Substitution | G | A | ||
92679 | 92679 | Substitution | C | A | ||
Two nucleotide substitutions and one trinucleotide deletion were made within the ORF PRS4/YBL068W, altering its coding sequence. The start, stop, and reading frame remain the same, but the annotated protein is now one amino acid shorter.
New 92637 TTAATGATTTCTTGATGGAATTATTAATTTTAATTCATGCTTGCAAAATTGCATCTGCAA 92696 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 92635 TTAATGATTTCTTGATGGAATTATTAATTTTAATTCATGCTTGCCAAATTGCATCTGCAA 92694 New 92877 ACAACCTATATGCAGAACCAAGTGTTTTAAATTATATTAGAAC---GAAAACAGATTTCG 92933 ||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| Old 92875 ACAACCTATATGCAGAACCAAGTGTTTTAAATTATATTAGAGCCCGGAAAACAGATTTCG 92934 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR078W | 394727 | 394727 | Insertion | C | |
One nucleotide was inserted within ORF ECM33/YBR078W, very near its 3' end, altering its coding sequence. The start, stop, and vast majority of reading frame remain the same, but the C-terminus is different and the annotated protein sequence is now 39 amino acids shorter.
New 394715 TGCTGCTGTTGGCGTTGCCTTACTATAAGATTAAAGCAACAATTTGTGTTTCTATTATTA 394774 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 394710 TGCTGCTGTTGGCGTTGC-TTACTATAAGATTAAAGCAACAATTTGTGTTTCTATTATTA 394768 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR076W | 391277 | 391277 | Insertion | A | |
390442 | 390442 | Deletion | G | |||
A single G nucleotide was deleted near the 3' end, and a single A nucleotide was inserted near the 5' end of ORF ECM8/YBR076W, altering its coding sequence. The ORF was extended 49 amino acids at the N-terminus and shortened 34 amino acids at the C-terminus, resulting in a protein that is 15 amino acids larger. Although this protein is altered at both ends, the central portion of the protein remains the same.
New 390408 AAACCATCAAGAACAAAATATTCCCACAAAGGAAAATATT-CAACGATAGCGAAAATTTT 390466 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old 390402 AAACCATCAAGAACAAAATATTCCCACAAAGGAAAATATTGCAACGATAGCGAAAATTTT 390461 New 391247 CGAACGAAATGTTTATATGTCCAAGTTATAACAAAAAGCAATTGATTGTGTACGCAAGAT 391306 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 391242 CGAACGAAATGTTTATATGTCCAAGTTATAACAAAA-GCAATTGATTGTGTACGCAAGAT 391300 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR137W | 513365 | 513365 | Substitution | A | G |
A single nucleotide substitution within the coding region of YBR137W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 110 is now Glycine rather than Serine.
New 513345 CAAGTTTCTATATGGGCTGCAAGAAAGGTGACAAAACACCGGAGGAAAAGTTTTTTGTGG 513404 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 513339 CAAGTTTCTATATGGGCTGCAAGAAAAGTGACAAAACACCGGAGGAAAAGTTTTTTGTGG 513398 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR121C | 481671 | 481675 | Substitution | TGATG | GTAGT |
Nucleotide substitutions within the coding region of GRS1/YBR121C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 563-564 are now TT rather than HH.
New 481665 TTGGCGACTTCAGTAGTAACAGGAACTAAATCTTTGTGGTTAGATAAAGGAACTAAAAGA 481724 |||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| Old 481659 TTGGCGACTTCATGATGAACAGGAACTAAATCTTTGTGGTTAGATAAAGGAACTAAAAGA 481718 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR108W | 456359 | 456359 | Substitution | C | T |
A single nucleotide substitution within the coding region of AIM3/YBR108W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 515 is now Valine rather than Alanine.
New 456345 AGGACATTATGATGTAGATGTCAACATCATGCCACCTCCAAAACCTTTCAGACATGGACT 456404 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 456339 AGGACATTATGATGTAGATGCCAACATCATGCCACCTCCAAAACCTTTCAGACATGGACT 456398 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR295W | 793986 | 793987 | Substitution | AC | CA |
Nucleotide substitutions within the coding region of PCA1/YBR295W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 382 is now Histidine rather than Threonine.
New 793961 GGATTGTGCTGTTACCTCAACTATTTCTGGACACTCTTCGAGTGAAATTTCAAGAATCGT 794020 ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Old 793955 GGATTGTGCTGTTACCTCAACTATTTCTGGAACCTCTTCGAGTGAAATTTCAAGAATCGT 794014 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR289W | 781354 | 781354 | Substitution | G | C |
780541 | 780541 | Substitution | C | A | ||
Two nucleotide substitutions within the coding region of SNF5/YBR289W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 564 is now Aspartic Acid rather than Glutamic Acid.
New 780521 ACAACCTCCCACCAATGTTCAGCCAACTATTGGCCAACTTCCTCAACTTCCAAAATTAAA 780580 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Old 780517 ACAACCTCCCACCAATGTTCAGCCCACTATTGGCCAACTTCCTCAACTTCCAAAATTAAA 780576 New 781311 GATATTGTCGTGGGACAAAACCAGTTAATCGATCAATTTGAGTGGGACATCTCTAATAGT 781370 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 781307 GATATTGTCGTGGGACAAAACCAGTTAATCGATCAATTTGAGTGGGAGATCTCTAATAGT 781366 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR288C | 779354 | 779356 | Substitution | TAC | ACT |
Nucleotide substitutions within the coding region of APM3/YBR288C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 35-36 are now QS rather than RT.
New 779321 TCACTACTGCTATCTTCGAGCAATTGAGGACATGTGGACTGAACGCGGGTCCACAGGTGC 779380 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old 779317 TCACTACTGCTATCTTCGAGCAATTGAGGACATGTGGTACGAACGCGGGTCCACAGGTGC 779376 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL099W | 38210 | 38210 | Substitution | A | T |
38067 | 38067 | Substitution | C | T | ||
The substitution of 2 nucleotides within the coding region of ATP1/YBL099W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 340 is now Serine rather than Proline.
New 38039 AGCCTACCCTGGTGATGTCTTTTACTTGCATTCAAGATTGCTAGAAAGAGCCGCTAAGCT 38098 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old 38036 AGCCTACCCTGGTGATGTCTTTTACTTGCATCCAAGATTGCTAGAAAGAGCCGCTAAGCT 38095 New 38169 GCTTATATTCCAACCAATGTTATTTCCATTACCGATGGTCAAATTTTCTTGGAAGCTGAA 38228 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 38166 GCTTATATTCCAACCAATGTTATTTCCATTACCGATGGTCAAATATTCTTGGAAGCTGAA 38225 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL097W | 42377 | 42377 | Substitution | C | G |
A single nucleotide substitution within the coding region of BRN1/YBL097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 517 is now Glycine rather than Alanine.
New 42359 CAAGATTGTTCATTAAACCGGGGCAGAAAATGAGTCTGTTCAGTCATAGGAAGCATACCA 42418 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 42356 CAAGATTGTTCATTAAACCGGCGCAGAAAATGAGTCTGTTCAGTCATAGGAAGCATACCA 42415 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL091C | 48369 | 48369 | Substitution | A | T |
A single nucleotide substitution within the coding region of MAP2/YBL091C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 86 is now Aspartic Acid rather than Valine.
New 48359 ACGTGATTCTTCATCCGTGGTTCTTTGCAGATTGAAATCTTGATGATAGTCCATCCACGC 48418 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 48356 ACGTGATTCTTCAACCGTGGTTCTTTGCAGATTGAAATCTTGATGATAGTCCATCCACGC 48415 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL088C | 55145 | 55145 | Substitution | A | C |
A single nucleotide substitution within the coding region of TEL1/YBL088C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1412 is now Cysteine rather than Phenylalanine.
New 55139 GCATCAAGGCAGTATTTCCAAGTTTTTATTTTGATGAGATCCCGATGCTCTAAAAGCTTT 55198 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Old 55136 GCATCAAGGAAGTATTTCCAAGTTTTTATTTTGATGAGATCCCGATGCTCTAAAAGCTTT 55195 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL084C | 68154 | 68155 | Substitution | TG | GA |
The substitution of two nucleotides within the coding region of CDC27/YBL084C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 430 is now Serine rather than Glutamine.
New 68108 CGACCTTAATATTAAAGCGAAATTATACATGATTTCAGGCAGCGTAATTGAATAATCACT 68167 ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Old 68105 CGACCTTAATATTAAAGCGAAATTATACATGATTTCAGGCAGCGTAATTTGATAATCACT 68164 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR275C | 754908 | 754908 | Substitution | T | C |
A single nucleotide substitution within the coding region of RIF1/YBR275C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 732 is now Alanine rather than Threonine.
New 754902 TACTTCAACAGCCTGGAACACAACTTTCATGATTTTATCGTATTCACGCTTGATGATCTG 754961 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 754897 TACTTCAACAGTCTGGAACACAACTTTCATGATTTTATCGTATTCACGCTTGATGATCTG 754956 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR270C | 743936 | 743938 | Substitution | GCC | CCG |
Nucleotide substitutions within the coding region of BIT2/YBR270C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 152-153 are now SG rather than RA.
New 743922 AGTGCCGTAGTTTTTTGACCCGCTCCTGCTTCGATTTCTCATATTATCTTTTGAATTGGT 743981 ||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| Old 743917 AGTGCCGTAGTTTTTTGACGCCCTCCTGCTTCGATTTCTCATATTATCTTTTGAATTGGT 743976 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR266C, YBR267W | 740291 | 740292 | Substitution | CG | GC |
Nucleotide substitutions within the coding regions of overlapping genes REI1/YBR267W and SLM6/YBR266C resulted in altered sequences for both proteins. The start, stop, and reading frames of both proteins remain the same, but protein residues 152-153 of REI1/YBR267W are now KL rather than NV, and protein residue 31 of SLM6/YBR266C is now Serine rather than Threonine.
New 740262 AGGAAGAAATGGCGGAAAGAGTAATGCAAGAAAAGCTACGCAACAGAGTCGATATTCCAC 740321 |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old 740257 AGGAAGAAATGGCGGAAAGAGTAATGCAAGAAAACGTACGCAACAGAGTCGATATTCCAC 740316 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR265W | 739341 | 739341 | Substitution | A | T |
A single nucleotide substitution within the coding region of TSC10/YBR265W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 255 is now Aspartic Acid rather than Glutamic Acid.
New 739302 CAAGCATGTGATATCATTGCCAAGTCGCTGGCCAGAGGTGATGATGACGTTTTTACAGAT 739361 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 739297 CAAGCATGTGATATCATTGCCAAGTCGCTGGCCAGAGGTGATGAAGACGTTTTTACAGAT 739356 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR094W | 433377 | 433378 | Substitution | CG | GC |
432380 | 432380 | Substitution | T | C | ||
Nucleotide changes within the coding region of PBY1/YBR094W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 450 is now Alanine rather than Arginine.
New 432345 GAGTGGATATTAATCGATGGAACTCCAGCATCGTGCGCAAACATCGGGCTGCACCTATTG 432404 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 432339 GAGTGGATATTAATCGATGGAACTCCAGCATCGTGCGCAAATATCGGGCTGCACCTATTG 432398 New 433365 ACTATTGATTTAGATTATGCTGAATTTCTAGACGACGCATTAGATGAAAATTGGGAATTA 433424 |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Old 433359 ACTATTGATTTAGATTATCGTGAATTTCTAGACGACGCATTAGATGAAAATTGGGAATTA 433418 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR089C-A | 426394 | 426396 | Substitution | CCG | GCC |
Nucleotide substitutions within the coding region of NHP6B/YBR089C-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 30 is now Glycine rather than Arginine.
New 426355 GACAATGTCTCTGTTTTCATTAGCAAAGAACATATAAGCTGACAAGCCCCTCTTAGGGGC 426414 ||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| Old 426349 GACAATGTCTCTGTTTTCATTAGCAAAGAACATATAAGCTGACAACCGCCTCTTAGGGGC 426408 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL056W | 114870 | 114870 | Substitution | A | G |
114868 | 114868 | Substitution | G | A | ||
Two nucleotide substitutions within the coding region of PTC3/YBL056W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 369 is now Glycine rather than Aspartic Acid.
New 114832 CGACATGGAAATTGATGATCTTGATACCGAATTAGGCAGCAGTGCTACTCCCTCAAAGTT 114891 ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| Old 114835 CGACATGGAAATTGATGATCTTGATACCGAATTGGACAGCAGTGCTACTCCCTCAAAGTT 114894 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR207W | 636336 | 636336 | Substitution | G | A |
636319 | 636322 | Substitution | GCTT | ACTG | ||
636306 | 636309 | Substitution | AATA | TATG | ||
636141 | 636141 | Substitution | A | G | ||
635890 | 635890 | Deletion | A | |||
635882 | 635882 | Insertion | T | |||
635247 | 635247 | Substitution | A | G | ||
635192 | 635192 | Substitution | A | G | ||
636342 | 636342 | Substitution | G | A | ||
635822 | 635822 | Substitution | C | G | ||
Nucleotide changes within the coding region of FTH1/YBR207W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 18 is now Glu rather than Lys, residue 36 is now Gly rather than Asp, residue 228 is now Glu rather than Gln, residues 249-250 are now VF rather than YS, residue 334 is now Gly rather than Glu, residues 389-390 are now IC rather than KY, and residues 399-401 are now EKY rather than GKC.
New 635196 GGAATCCTTAGAAATTGTTGTCATTGTTTCTATCCTGTTGACGATCGTCAAACAAGGTCT 635255 | |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Old 635191 GAAATCCTTAGAAATTGTTGTCATTGTTTCTATCCTGTTGACGATCGTCAAACAAGATCT 635250 New 635803 ACCCAAAAAGGTGTGAAATTCAGTGAAAAGTACTCCTTCTTCATATTACCATTTATAACG 635862 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Old 635798 ACCCAAAAAGGTGTGAAATTCAGTCAAAAGTACTCCTTCTTCATATTACCATTTATAACG 635857 New 635863 ACTTTGAGAGAAGGGTTAGAAGCTGTTGTATTC-ATTGGAGGTATCGGTATTGACCAACC 635921 ||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| Old 635858 ACTTTGAGAGAAGGGTTAGAAGCTG-TGTATTCAATTGGAGGTATCGGTATTGACCAACC 635916 New 636102 AGACTACGTCAACAAATGTAACGGTCAAGACATGAGTGAAGTAGGAAATGGACCCGGTTC 636161 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 636097 AGACTACGTCAACAAATGTAACGGTCAAGACATGAGTGAAGTAGAAAATGGACCCGGTTC 636156 New 636292 GCCTACTGGTTGGTATTAATATGCGCTTTGAAACTGCTAATGATAGAAGAAAAATACGGA 636351 ||||||||||||||||||| || ||||||||| || ||||||||||||| ||||| |||| Old 636287 GCCTACTGGTTGGTATTAAAATACGCTTTGAAGCTTCTAATGATAGAAGGAAAATGCGGA 636346 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL014C | 201635 | 201635 | Substitution | G | C |
A single nucleotide substitution within the coding region of RRN6/YBL014C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 39 is now Lysine rather than Asparagine.
New 201592 CCTCGGCCAATGTATCATCTACTGGTCTTAGCCATTGTGGCTTTTCTTGCTTCTTCGTAG 201651 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old 201595 CCTCGGCCAATGTATCATCTACTGGTCTTAGCCATTGTGGGTTTTCTTGCTTCTTCGTAG 201654 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL008W | 210433 | 210433 | Substitution | A | G |
A single nucleotide substitution within the coding region of HIR1/YBL008W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 260 is now Valine rather than Methionine.
New 210412 AATGGGCCCGTAAGTTCTGTGGCAATTGTAAATAGAGGAACTTGGGATACAAATGTTAGT 210471 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 210415 AATGGGCCCGTAAGTTCTATGGCAATTGTAAATAGAGGAACTTGGGATACAAATGTTAGT 210474 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR043C | 323835 | 323836 | Substitution | CG | GC |
Nucleotide substitutions within the coding region of QDR3/YBR043C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 37 is now Serine rather than Threonine.
Query 323809 CTATAATCGTTGTGCTCGCTGTGCGGGCTGCCGCTGCTTTCATCGCAGTGCATCATAACA 323868 |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 323809 CTATAATCGTTGTGCTCGCTGTGCGGCGTGCCGCTGCTTTCATCGCAGTGCATCATAACA 323868 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR141C | 527099 | 527099 | Substitution | A | G |
A single nucleotide substitution within the coding region of YBR141C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 312 is now Proline rather than Serine.
New 527085 AAAGCTACTCGGCTGCGGTGGAACTACCTGCAATTGATACAAACAATAGTACAACTTATT 527144 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 527079 AAAGCTACTCGGCTGCGGTGAAACTACCTGCAATTGATACAAACAATAGTACAACTTATT 527138 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR138C | 514965 | 514966 | Substitution | AC | CA |
Nucleotide substitutions within the coding region of YBR138C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 122 is now Leucine rather than Cysteine.
New 514955 TAGGCTTGGCACCTATCAATTGTGAGCGACGCTTTCTTACATTCAATAACTGTTGGTTCT 515014 |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 514949 TAGGCTTGGCACCTATACATTGTGAGCGACGCTTTCTTACATTCAATAACTGTTGGTTCT 515008 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR004C | 245111 | 245111 | Substitution | T | A |
A single nucleotide substitution within the coding region of GPI18/YBR004C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 187 is now Serine rather than Threonine.
New 245092 TACGGGCACGGAAATGGAGCATTCACGACTCCAAATACCAACAAATGCAAAAAAAAAAGA 245151 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 245094 TACGGGCACGGAAATGGTGCATTCACGACTCCAAATACCAACAAATGCAAAAAAAAAAGA 245153 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL106C | 13553 | 13553 | Substitution | G | A |
13492 | 13492 | Substitution | A | T | ||
13477 | 13477 | Substitution | G | A | ||
13102 | 13102 | Substitution | C | A | ||
11379 | 11379 | Substitution | A | C | ||
11345 | 11345 | Substitution | A | G | ||
11308 | 11309 | Substitution | AA | TT | ||
11053 | 11053 | Substitution | T | C | ||
Several nucleotide substitutions within the coding region of SRO77/YBL106C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 130 is now Isoleucine rather than Phenylalanine, residue 135 is now Serine rather than Proline, residue 260 is now Serine rather than Alanine, residue 834 is now Glycine rather than Valine, residue 858 is now Threonine rather than Serine, and 943 is now Glutamic Acid rather than Lysine.
New 11041 ACCTGTGATCTTCCGTACCGGGAGGTAACTTTCTGGCTGCATTACTACTACTGGAAGATA 11100 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Old 11041 ACCTGTGATCTTTCGTACCGGGAGGTAACTTTCTGGCTGCATTACTACTACTGGAAGATA 11100 New 11281 GTTGTGATATGTCAGCAGTATGATTCGTTCCGGTGGCACTTTCATTAAGTACTGAAATCA 11340 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Old 11281 GTTGTGATATGTCAGCAGTATGATTCGAACCGGTGGCACTTTCATTAAGTACTGAAATCA 11340 New 11341 AAGAGGCTTGGAATTTCCCTGTGCGAATGACAATGTCACCATTTTCTAATATAGATGAAT 11400 |||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Old 11341 AAGAAGCTTGGAATTTCCCTGTGCGAATGACAATGTCAACATTTTCTAATATAGATGAAT 11400 New 13081 TGACATCCCAAAATACCAAGGAATTATCTTCATGGACAGTTAATATATGTAAGGAATTTG 13140 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 13081 TGACATCCCAAAATACCAAGGCATTATCTTCATGGACAGTTAATATATGTAAGGAATTTG 13140 New 13441 ATCCACTCTCGAGGCCAATCAGCATCCAATCCAAGGACGGATCAGTCTCAATACAAGTGA 13500 |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| Old 13441 ATCCACTCTCGAGGCCAATCAGCATCCAATCCAAGGGCGGATCAGTCTCAAAACAAGTGA 13500 New 13501 TGCTGTTTGGACAGAAAACAGTAGTTAGAATCTGTTTCGAGTGTACTGAAAGAACTATTA 13560 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Old 13501 TGCTGTTTGGACAGAAAACAGTAGTTAGAATCTGTTTCGAGTGTACTGAAAGGACTATTA 13560 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR203W | 631936 | 631936 | Substitution | G | A |
631924 | 631924 | Substitution | G | A | ||
631912 | 631912 | Substitution | G | A | ||
631907 | 631907 | Substitution | G | A | ||
631342 | 631353 | Substitution | GCTGGCGAAACG | CGTTTCGCCAGC | ||
631940 | 631940 | Substitution | C | A | ||
Nucleotide changes within the coding region of COS111/YBR203W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 727-731 are now TFRQH rather than SWRND, residue 917 is now Asparagine rather than Serine, and residue 921 is now Glutamic Acid rather than Glycine.
New 631303 TGTGTGGTGCAGGCAATATATGGTAAAGTATTTTGTAATGAGGACGTTTCGCCAGCATTT 631362 |||||||||||||||||||||||||||||||||||||||||||| | || | |||| Old 631298 TGTGTGGTGCAGGCAATATATGGTAAAGTATTTTGTAATGAGGAGCTGGCGAAACGATTT 631357 New 631903 TGTTGGCGAAAATAACTACTATGCTGAAAGCATCATATAACGACTGCTCTCTTTTAACAG 631962 ||||||||| |||| ||||||||||| ||||||||||| ||| ||||||||||||||||| Old 631898 TGTTGGCGAGAATAGCTACTATGCTGGAAGCATCATATGACGCCTGCTCTCTTTTAACAG 631957 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR285W | 774080 | 774080 | Substitution | C | G |
A single nucleotide substitution within the coding region of YBR285W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 55 is now Aspartic Acid rather than Histidine.
New 774041 CTTAGAAAGCCCCACTGACGATAGCATGGAGGCGGACATTTCAGATAGAGAAATGGCTAC 774100 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 774037 CTTAGAAAGCCCCACTGACGATAGCATGGAGGCGGACATTTCACATAGAGAAATGGCTAC 774096 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR204C | 633189 | 633189 | Substitution | T | A |
A single nucleotide substitution within the coding region of YBR204C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 63 is now Valine rather than Glutamic Acid.
New 633163 CCTTATTCTTGAATTTCGATCCGATAGTTGTACATTAAAAAACTCCTCATGTTCTGCGAT 633222 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old 633158 CCTTATTCTTGAATTTCGATCCGATAGTTGTTCATTAAAAAACTCCTCATGTTCTGCGAT 633217 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR202W | 627486 | 627487 | Substitution | AT | TA |
627433 | 627439 | Substitution | ATCCGGG | CTTTGAA | ||
627421 | 627421 | Substitution | T | G | ||
Nucleotide changes within the coding region of MCM7/YBR202W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 552-558 is now GINTTLN rather than VINTNPG, and residue 574 is now Tyrosine rather than Isoleucine.
New 627403 AACAATTTCGATATCCAAGGCGGGTATCAATACAACTTTGAACGCCAGAACCTCAATCTT 627462 ||||||||||||||||||||||| ||||||||||| | | |||||||||||||||||| Old 627398 AACAATTTCGATATCCAAGGCGGTTATCAATACAAATCCGGGCGCCAGAACCTCAATCTT 627457 New 627463 AGCGGCAGCAAATCCGTTGTATGGTAGATATAATCCTAGATTATCACCTCTGGACAATAT 627522 |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old 627458 AGCGGCAGCAAATCCGTTGTATGGTAGAATTAATCCTAGATTATCACCTCTGGACAATAT 627517 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL080C | 73450 | 73450 | Substitution | C | G |
A single nucleotide substitution within the coding region of PET112/YBL080C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 415 is now Proline rather than Alanine.
New 73438 CGAAAACCGGAGGAGGCAAAATTTCTTTTGCTTTGGCCAATGGAATTTGTAGCTTGTTCA 73497 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 73435 CGAAAACCGGAGGAGCCAAAATTTCTTTTGCTTTGGCCAATGGAATTTGTAGCTTGTTCA 73494 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL067C | 95345 | 95345 | Substitution | G | T |
A single nucleotide substitution within the coding region of UBP13/YBL067C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 180 is now Glutamine rather than Histidine.
New 95333 TCTTTCTTGGTTGATCAGATTCTCTTGATTTTTTTGGAAATTGCAATATATTTTCACGTA 95392 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 95335 TCTTTCTTGGGTGATCAGATTCTCTTGATTTTTTTGGAAATTGCAATATATTTTCACGTA 95394 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR074W | 388774 | 388775 | Substitution | TT | AA |
Nucleotide substitutions within the coding region of YBR074W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 832 is now Asparagine rather than Phenylalanine.
New 388738 ACGAACCAATAGTTGCAGAGTTACTTTTGGAGGTGAAGGAGAACAGGGCTTGCACTTTAA 388797 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 388733 ACGAACCAATAGTTGCAGAGTTACTTTTGGAGGTGAAGGAGTTCAGGGCTTGCACTTTAA 388792 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR073W | 385360 | 385361 | Substitution | CG | GC |
Nucleotide substitutions within the coding region of RDH54/YBR073W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 752 is now Alanine rather than Arginine.
New 385318 TCTTGTTGAGTGCAAAATCGGGAGGTGTAGGATTGAATCTAGTCGGTGCTTCGCGACTTA 385377 ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 385313 TCTTGTTGAGTGCAAAATCGGGAGGTGTAGGATTGAATCTAGTCGGTCGTTCGCGACTTA 385367 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR152W, YBR153W | 547442 | 547442 | Substitution | A | T |
A single nucleotide substitution was made in the intergenic region between ORFs SPP381/YBR152W and RIB7/YBR153W.
New 547425 GCTTCTTTGTATTACTATCAACATTTTTAGAAGATATGTCTTTGACACCACTGTGTGAAG 547484 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old 547419 GCTTCTTTGTATTACTATCAACAATTTTAGAAGATATGTCTTTGACACCACTGTGTGAAG 547478 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBLCtau1, tF(GAA)B | 36312 | 36312 | Substitution | T | A |
A single nucleotide substitution was made in the intergenic region between Ty4 LTR YBLCtau1 and tRNA-Phe tF(GAA)B.
New 36299 TGTGCTTCAGTATTACATTTTTTGCCTTCAACGCCTTGATTGTTCTATTTTTGCTAATAA 36358 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 36296 TGTGCTTCAGTATTACTTTTTTTGCCTTCAACGCCTTGATTGTTCTATTTTTGCTAATAA 36355 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL099W, tF(GAA)B | 36673 | 36673 | Substitution | A | T |
A single nucleotide substitution was made in the intergenic region between tRNA-Phe tF(GAA)B and ORF ATP1/YBL099W.
New 36659 ATTTATTGTAATTATTATACATTGGTCATATCAAATTCACATCAGACTTCAATTTTTCAA 36718 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 36656 ATTTATTGTAATTATTAAACATTGGTCATATCAAATTCACATCAGACTTCAATTTTTCAA 36715 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR006W, YBR007C | 248623 | 248623 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs UGA2/YBR006W and DSF2/YBR007C.
New 248572 GCATGTATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATTTTTTGAAAGAAAA 248631 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Old 248574 GCATGTATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATTTTT-GAAAGAAAA 248632 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR001C, YBR002C | 241396 | 241396 | Substitution | G | A |
241359 | 241359 | Substitution | G | A | ||
Two separate single nucleotide substitutions were made in the intergenic region between ORFs NTH2/YBR001C and RER2/YBR002C.
New 241352 AAAGGAAAAATATAAATAAATAAATAAAATTGAGAAATAAAGATATTTAGTTTTAATGGA 241411 ||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 241354 AAAGGGAAAATATAAATAAATAAATAAAATTGAGAAATAAAGGATATTAGTTTTAATGGA 241413 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL005W, YBLWdelta8 | 220413 | 220414 | Substitution | AG | GA |
A dinucleotide substitution was made in the intergenic region between ORF PDR3/YBL005W and Ty1 LTR YBLWdelta8.
New 220372 ATGACAATACTTCATATCCCTTCTTATGAAAACGCAAAGAAAATAGGGAAGCAGAGCATA 220431 |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old 220375 ATGACAATACTTCATATCCCTTCTTATGAAAACGCAAAAGAAATAGGGAAGCAGAGCATA 220434 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL105C, YBL106C | 13982 | 13982 | Substitution | G | A |
13966 | 13966 | Substitution | C | A | ||
Two separate single nucleotide substitutions were made in the intergenic region between ORFs SRO77/YBL106C and PKC1/YBL105C.
New 13941 AGAAATATGTTAGTAGTAATATAATACTGAGCTGTTTCTTAAATGCTTCCTTAATAATGT 14000 ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| Old 13941 AGAAATATGTTAGTAGTAATATAATCCTGAGCTGTTTCTTAGATGCTTCCTTAATAATGT 14000 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | ARS209 | 254720 | 254720 | Insertion | T | |
254719 | 254719 | Insertion | T | |||
254616 | 254616 | Substitution | T | A | ||
254548 | 254548 | Insertion | A | |||
254532 | 254532 | Substitution | C | A | ||
254495 | 254495 | Substitution | G | T | ||
Several nucleotide changes were made within ARS209.
New 254452 AAATATCCTTTTTTTTTTCTTTGCATTTGTCTTCTTTCATTTTAAATCTTCATAATCTTC 254511 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 254453 AAATATCCTTTTTTTTTTCTTTGCATTTGTCTTCTTTCATTTGAAATCTTCATAATCTTC 254512 New 254512 CGGAAAAACTAGTGATGCGAAATATTGTAGAGAAAAAGCGCAGGGCATTCCTATACTTAG 254571 ||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| Old 254513 CGGAAAAACTAGTGATGCGCAATATTGTAGAGAAAA-GCGCAGGGCATTCCTATACTTAG 254571 New 254572 TAATCACCATCATAACGTATTTTAAAATGAAGAAGCGAACCTCAAAGAATTTTCTATACA 254631 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 254572 TAATCACCATCATAACGTATTTTAAAATGAAGAAGCGAACCTCATAGAATTTTCTATACA 254631 New 254692 TATATTGCAGAAAATGTGCTAGTAATATTGTTCTCTCTGTTGTCAATGGGCTTACAATTG 254751 |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| Old 254692 TATATTGCAGAAAATGTGCTAGTAATAT-G-TCTCTCTGTTGTCAATGGGCTTACAATTG 254749 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR285W, YBR286W | 774430 | 774430 | Substitution | C | G |
A single nucleotide substitution was made in the intergenic region between ORFs YBR285W and APE3/YBR286W.
New 774401 CTTATCGTCAGAAAGAGTGTTCTCTATGTTTTTGTGCTTCCATAAATATATAGTTCAAAA 774460 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 774397 CTTATCGTCAGAAAGAGTGTTCTCTATGTTTTTCTGCTTCCATAAATATATAGTTCAAAA 774456 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | ARS221 | 631981 | 631981 | Substitution | A | G |
631940 | 631940 | Substitution | C | A | ||
631936 | 631936 | Substitution | G | A | ||
Three single nucleotide substitutions were made within ARS221.
New 631933 CATCATATAACGACTGCTCTCTTTTAACAGCATACGTTCTGTTAATTTATTTGGCCAAAT 631992 |||||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||| Old 631928 CATCATATGACGCCTGCTCTCTTTTAACAGCATACGTTCTGTTAATTTATTTGACCAAAT 631987 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | ARS213 | 390033 | 390033 | Insertion | C | |
A single nucleotide insertion was made within ARS213.
New 389998 ACTGACACTAAAAAAAGGGTCGTACGTCTTACTGGCAGCGCCGAAAAATGTTTCGAAAAT 390057 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 389993 ACTGACACTAAAAAAAGGGTCGTACGTCTTACTGGCAGCGC-GAAAAATGTTTCGAAAAT 390051 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR201C-A, YBR202W | 625500 | 625500 | Substitution | T | C |
625435 | 625435 | Insertion | T | |||
A single nucleotide insertion and a single nucleotide substitution were made in the intergenic region between ORFs YBR201C-A and MCM7/YBR202W.
New 625423 ATTTTCTCAATAACAGGTCGAGGCCCCTTCTACCCTTGAATGCTACTTATTACTCACTCA 625482 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 625419 ATTTTCTCAATAACAGG-CGAGGCCCCTTCTACCCTTGAATGCTACTTATTACTCACTCA 625477 New 625483 TAATACATTGTATAAGCCTTCGCGTTTTTCACGGCCTCGAAAAAATTTTTCTTAACTAAT 625542 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 625478 TAATACATTGTATAAGCCTTCGTGTTTTTCACGGCCTCGAAAAAATTTTTCTTAACTAAT 625537 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR200W-A, YBR201W | 623444 | 623444 | Deletion | C | |
A single nucleotide deletion was made in the intergenic region between ORFs YBR200W-A and DER1/YBR201W.
New 623434 GAAGGTATAACAAAA-CAGATAGACACCTAATAAAGAACAAAATATTCCTATAGTTTTGC 623492 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 623429 GAAGGTATAACAAAACCAGATAGACACCTAATAAAGAACAAAATATTCCTATAGTTTTGC 623488 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL001C, YBL002W | 237021 | 237021 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs HTB2/YBL002W and ECM15/YBL001C.
New 236992 AGGGTCTAGTCTATCAGCCTCCGAAGGGAGTTGTATAAATGTATATATATAACTTTATAA 237051 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Old 236995 AGGGTCTAGTCTATCAGCCTCCGAAGG-AGTTGTATAAATGTATATATATAACTTTATAA 237053 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | ARS208, CEN2 | 238133 | 238133 | Substitution | G | A |
238116 | 238116 | Substitution | G | A | ||
Two separate single nucleotide substitutions were made in the intergenic region between ARS208 and CEN2.
New 238082 AGTACTTGCTTTCAGCAGAAAATGAAAAAAAGAACGTTCAAACAGACTGAAAATATAGCT 238141 |||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| Old 238084 AGTACTTGCTTTCAGCAGAAAATGAAAAAAAGGACGTTCAAACAGACTGGAAATATAGCT 238143 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL079W, YBL080C | 75208 | 75208 | Substitution | A | G |
A single nucleotide substitution was made in the intergenic region between ORFs PET112/YBL080C and NUP170/YBL079W.
New 75178 GGAGAATTACTGGAACCTAGGATCTGACAAGCGGACAAAAAAGCAGAGTGCGTTTATTAC 75237 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 75175 GGAGAATTACTGGAACCTAGGATCTGACAAGCGAACAAAAAAGCAGAGTGCGTTTATTAC 75234 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL077W, YBL078C | 80747 | 80747 | Deletion | T | |
A single nucleotide deletion was made in the intergenic region between ORFs ATG8/YBL078C and YBL077W.
New 80708 TTCAGACTTAAATGTAGACTTCATGTCTCTAGTAATTATTTT-ATTATGATTTTCTCAAC 80766 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 80705 TTCAGACTTAAATGTAGACTTCATGTCTCTAGTAATTATTTTTATTATGATTTTCTCAAC 80764 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL072C | 89277 | 89277 | Substitution | G | T |
A single nucleotide substitution was made within the 5' UTR intron of ORF RPS8A/YBL072C.
New 89267 GGCTTGATTTTTTGGGTACACAAAGGATTCAGTTTAGTGCACTGCTCCTGTCACAATTTA 89326 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Old 89265 GGCTTGATTTTTGGGGTACACAAAGGATTCAGTTTAGTGCACTGCTCCTGTCACAATTTA 89324 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL067C, YBL068W | 93622 | 93622 | Deletion | C | |
A single nucleotide deletion was made in the intergenic region between ORFs PRS4/YBL068W and UBP13/YBL067C.
New 93594 AAAGGAGACGGTGAACCTTTACCTTCC-TTGATATGCAAATATTTTTCAGCTTTTCCTAA 93652 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Old 93595 AAAGGAGACGGTGAACCTTTACCTTCCCTTGATATGCAAATATTTTTCAGCTTTTCCTAA 93654 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR077C, YBR078W | 392822 | 392822 | Insertion | T | |
392568 | 392569 | Substitution | CG | GC | ||
392557 | 392558 | Substitution | CG | GC | ||
392340 | 392340 | Deletion | TT | |||
Several nucleotide changes were made in the intergenic region between ORFs SLM4/YBR077C and ECM33/YBR078W.
New 392327 GATAACTGCCTTTTTTTTTT--CTTCTTATCTTCCCTTAATTAATTCATTAGAGTCTTTT 392384 |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 392321 GATAACTGCCTTTTTTTTTTTTCTTCTTATCTTCCCTTAATTAATTCATTAGAGTCTTTT 392380 New 392545 CACGACCCGGGTGGCTGCTGCGCCCTCGCGAAAAAGAAATGAAATGGAGTGCAAAAACGG 392604 |||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| Old 392541 CACGACCCGGGTGGCTCGTGCGCCCTCCGGAAAAAGAAATGAAATGGAGTGCAAAAACGG 392600 New 392805 AATGTCAAACACCTACGACTTTTCGCAATCAACGGACCTCTCTTGCATTTTTGTATTTAA 392864 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 392801 AATGTCAAACACCTACGACTTT-CGCAATCAACGGACCTCTCTTGCATTTTTGTATTTAA 392859 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR072C-A, YBR072W | 382742 | 382742 | Insertion | G | |
382729 | 382729 | Insertion | G | |||
Two separate single nucleotide insertions were made in the intergenic region between ORFs HSP26/YBR072W and YBR072C-A.
New 382719 TTGCTTGCATATGGGCTTGAAACATATGGTCATCACATCTGAGCGATTTTACCTCTTAGA 382778 |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| Old 382716 TTGCTTGCATATGG-CTTGAAACATATG-TCATCACATCTGAGCGATTTTACCTCTTAGA 382773 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR066C, YBR067C | 371424 | 371424 | Insertion | A | |
370774 | 370773 | Substitution | C | T | ||
A single nucleotide substitution and a single nucleotide insertion were made in the intergenic region between ORFs NRG2/YBR066C and TIP1/YBR067C.
New 370729 TTGTTCTTCGAACAGTAGCGAGTGCTCATATGACTTGGTGCCGGAAATTCATTTGAGCTG 370788 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 370727 TTGTTCTTCGAACAGTAGCGAGTGCTCATATGACTTGGTGCCGGAAACTCATTTGAGCTG 370786 New 371389 AAGGTTATAGTCTCCTTTTTTTCTTGGCTTCGGGAAAAATACGATTTGTTTGTTATTCTA 371448 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Old 371387 AAGGTTATAGTCTCCTTTTTTTCTTGGCTTCGGGAAAA-TACGATTTGTTTGTTATTCTA 371445 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | ARS230, YBL100W-C | 28909 | 28909 | Insertion | A | |
28887 | 28887 | Insertion | AT | |||
A dinucleotide insertion and a mononucleotide insertion were made in the intergenic region between ORF YBL100W-C and ARS230.
New 28859 ATTACTGTTTCGGGAATATAACGTTTGATATCGCTAGCGCACCCAGATGAGAAATCCGCA 28918 ||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| Old 28859 ATTACTGTTTCGGGAATATAACGTTTGAT--CGCTAGCGCACCCAGATGAGAA-TCCGCA 28915 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | ARS228 | 792273 | 792273 | Insertion | T | |
A single nucleotide insertion was made within ARS228.
New 792231 TTTGTTATGAATCTGAAAAGAAAAATACTATTTTAGCAATACAATGAATTTTAAAAAGTT 792290 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 792226 TTTGTTATGAATCTGAAAAGAAAAATACTATTTTAGCAATACAATGAA-TTTAAAAAGTT 792284 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | ARS225, YBR275C | 757291 | 757291 | Deletion | A | |
A single nucleotide deletion was made in the intergenic region between ORF RIF1/YBR275C and ARS225.
New 757242 ATCTTCTTGCTAACGATGAGTCGCCAATAAATAAAAAATCGACG-CGTCGGTCAATTATA 757310 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 757237 ATCTTCTTGCTAACGATGAGTCGCCAATAAATAAAAAATCGACGACGTCGGTCAATTATA 757306 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | ARS208 | 237892 | 237892 | Substitution | G | A |
237839 | 237839 | Substitution | G | A | ||
Two separate single nucleotide substitutions were made within ARS208.
New 237832 TTGCGAAAATTATTCTTTAATAGTTTAACTAAAAGTAAAAAGTTAGAAATCATAAATAAA 237891 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | Old 237834 TTGCGGAAATTATTCTTTAATAGTTTAACTAAAAGTAAAAAGTTAGAAATCATAAATAGA 237893 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL103C, YBL104C | 21376 | 21376 | Insertion | A | |
A single nucleotide insertion was made in the intergenic region between ORFs YBL104C and RTG3/YBL103C.
New 21361 CTTATGCTATCTTGAAATATATCATCGCCGTAAAGTATGATGTGTAGCGCATTAGTCTTC 21420 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 21361 CTTATGCTATCTTGAA-TATATCATCGCCGTAAAGTATGATGTGTAGCGCATTAGTCTTC 21419 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL102W, YBL103C | 28913 | 28913 | Substitution | C | A |
23855 | 23856 | Deletion | CC | |||
23947 | 23947 | Insertion | A | |||
Several sequence changes were made in the intergenic region between ORFs RTG3/YBL103C and SFT2/YBL102W.
New 23821 GAAGGCTTTTCTAATCACCATGGCTTTATTATTTC--AAAAGTAACTTGCGAAGAGTCAC 23878 ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 23820 GAAGGCTTTTCTAATCACCATGGCTTTATTATTTCCCAAAAGTAACTTGCGAAGAGTCAC 23879 New 23879 ATCCCGCGGAACGGCCCGCAATCGTGACCCGGCAAAAGGCGATTGTAATGAAGAGGGAGT 23938 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 23880 ATCCCGCGGAACGGCCCGCAATCGTGACCCGGCCAAAGGCGATTGTAATGAAGAGGGAGT 23939 New 23939 ATTGGTCAAGACTTGTACTATACTGAAATAGGAAGAAGATTGAATAAATTTGCATTCTAA 23998 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Old 23940 ATTGGTCA-GACTTGTACTATACTGAAATAGGAAGAAGATTGAATAAATTTGCATTCTAA 23998 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR125C, YBR126C | 488600 | 488601 | Substitution | TC | AT |
A dinucleotide substitution was made in the intergenic region between ORFs PTC4/YBR125C and TPS1/YBR126C.
New 488565 CGTTATGCGGTGTGAACAGCGACAATAAAAAAAAATGTGGGATAAATTATGGCTTTTTTT 488624 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 488559 CGTTATGCGGTGTGAACAGCGACAATAAAAAAAAATGTGGGTCAAATTATGGCTTTTTTT 488618 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR102C, YBR103W | 447535 | 447536 | Substitution | CG | GC |
A dinucleotide substitution was made in the intergenic region between ORFs EXO84/YBR102C and SIF2/YBR103W.
New 447525 AAAGGTTATGAGATATGCAAGACCATTCGTTTTGATTTGCAATTAGTGAGAACAATTTAA 447584 |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 447519 AAAGGTTATGAGATATCGAAGACCATTCGTTTTGATTTGCAATTAGTGAGAACAATTTAA 447578 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR013C, YBRCdelta14 | 265922 | 265922 | Deletion | C | |
265905 | 265905 | Substitution | T | G | ||
265902 | 265902 | Deletion | C | |||
Several nucleotide changes were made within the intergenic region between ORF YBR013C and Ty1 LTR YBRCdelta14.
New 265852 GATACATATCCTGAATAAGGGATATATCATTATGAGGTTAAGTGGCCTAAAA-ACGCAAT 265910 |||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| Old 265850 GATACATATCCTGAATAAGGGATATATCATTATGAGGTTAAGTGGCCTAAAACACTCAAT 265909 New 265911 TAATACGGATCC-TTGTACTATTAAGTCTTTTCTATCTCTGAAAATTAACTTAAGAAGCG 265969 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Old 265910 TAATACGGATCCCTTGTACTATTAAGTCTTTTCTATCTCTGAAAATTAACTTAAGAAGCG 265969 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR295W, YBR296C | 796707 | 796707 | Substitution | A | G |
A single nucleotide substitution was made in the intergenic region between ORFs PCA1/YBR295W and PHO89/YBR296C.
New 796671 TAAATTAGAAAAAAATTAATGCATCTTTAAGGTTTTAAATTAGAAATGTTTTAACTTTAA 796730 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 796665 TAAATTAGAAAAAAATTAATGCATCTTTAAGGTTTTAAATTAAAAATGTTTTAACTTTAA 796724 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR292C, YBR293W | 786761 | 786761 | Insertion | A | |
786736 | 786737 | Substitution | CT | TC | ||
Several nucleotide changes were made in the intergenic region between ORFs YBR292C and YBR293W.
New 786721 TTCCAAATCAGATTTTTTTTCGCAATGCTTAAATCTAGTAAACACAAAGTACTACCGAAA 786780 ||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| Old 786717 TTCCAAATCAGATTTTTTTCTGCAATGCTTAAATCTAGTAAACAC-AAGTACTACCGAAA 786776 New 786761 AACACAAAGTACTACCGAAAAGCAAGGATGGAAACTATGGCAGTATTGAAGAGACTGAAA 786820 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 786757 AACAC-AAGTACTACCGAAAAGCAAGGATGGAAACTATGGCAGTATTGAAGAGACTGAAA 786815 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL098W, YBL099W | 38920 | 38920 | Substitution | C | A |
38917 | 38917 | Substitution | C | T | ||
38800 | 38800 | Substitution | C | A | ||
38728 | 38728 | Substitution | C | A | ||
Several single nucleotide substitutions were made in the intergenic region between ORFs ATP1/YBL099W and BNA4/YBL098W.
New 38699 AAAAAAATAAAAATGAATATAAGGTACGTCTCAAAAAGAAATGTAAATATAGAAATTTTA 38758 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Old 38696 AAAAAAATAAAAATGAATATAAGGTACGTCTCCAAAAGAAATGTAAATATAGAAATTTTA 38755 New 38759 AAAAAAAAAACGAAAAAAAACATAACTAAATTTAAAGTGCAGCCAAACAATAACCCTGAA 38818 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 38756 AAAAAAAAAACGAAAAAAAACATAACTAAATTTAAAGTGCAGCCCAACAATAACCCTGAA 38815 New 38879 GTAAATAATGCCCCTACTTTTCTTCTAAGGAAATGAGTTACTACAAAAATAAGGAAATAT 38938 |||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||| Old 38876 GTAAATAATGCCCCTACTTTTCTTCTAAGGAAGTGAGTTACCACCAAAATAAGGAAATAT 38935 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL092W, YBL093C | 45495 | 45495 | Substitution | T | A |
A single nucleotide substitution was made in the intergenic region between ORFs ROX3/YBL093C and RPL32/YBL092W.
New 45479 ACTGGAGAAGAGTGTTTGAATCCAGCAGAAGGTAATACGCACCTTTCTCATCTATTTGCA 45538 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Old 45476 ACTGGAGAAGAGTGTTTGATTCCAGCAGAAGGTAATACGCACCTTTCTCATCTATTTGCA 45535 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL087C, YBL088C | 59406 | 59406 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs TEL1/YBL088C and RPL23A/YBL087C.
New 59399 ATTTCCCTTTTTCTTTGAAGGCTTTTTTTTCGAATTTCCTGCTTTTTTTGCGAGGCTTTG 59458 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 59396 ATTTCCCTTTT-CTTTGAAGGCTTTTTTTTCGAATTTCCTGCTTTTTTTGCGAGGCTTTG 59454 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBL086C, YBL087C | 61056 | 61056 | Deletion | T | |
A single nucleotide deletion was made in the intergenic region between ORFs RPL23A/YBL087C and YBL086C.
New 61019 AAAAACTTGGTCTGTTGAAAATAATAACTGCATGGGTTTTT-CAAAGCAGTTGGGGGTGT 61077 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 61015 AAAAACTTGGTCTGTTGAAAATAATAACTGCATGGGTTTTTTCAAAGCAGTTGGGGGTGT 61074 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR205W, YBR207W | 634934 | 634934 | Substitution | C | T |
A single nucleotide substitution was made in the intergenic region between ORFs KTR3/YBR205W and FTH1/YBR207W.
New 634903 ATATACACATAATTCAATGTAGTAGCCACCTCACTTTATTCTAGTGCCTTCTTGGGTTCA 634962 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 634898 ATATACACATAATTCAATGTAGTAGCCACCTCACTTCATTCTAGTGCCTTCTTGGGTTCA 634957 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR038W, YBR039W | 315270 | 315271 | Substitution | CG | GC |
315071 | 315071 | Deletion | G | |||
A single nucleotide deletion and a dinucleotide substitution were made in the intergenic region between ORFs CHS2/YBR038W and ATP3/YBR039W.
New 315050 TGTATGAGCTGGGCATCAAGAG-CTTTTGAGATTTTCCAAGTAGTAACTCATCTTTCTGA 315108 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 315049 TGTATGAGCTGGGCATCAAGAGGCTTTTGAGATTTTCCAAGTAGTAACTCATCTTTCTGA 315108 New 315229 TCGATAAAACAAAAAAAAAGTAAGAAGATATATGAATAGGAGCTGTCGCTAGAACTAGTA 315288 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 315229 TCGATAAAACAAAAAAAAAGTAAGAAGATATATGAATAGGACGTGTCGCTAGAACTAGTA 315288 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR036C, YBR037C | 310457 | 310457 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs CSG2/YBR036C and SCO1/YBR037C.
New 310430 TCCTTTAGAGTGAGAGAGCTTTTTTTTTTCTTGCGATACACCTTCGCCGGGTGATAGCCG 310489 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Old 310430 TCCTTTAGAGTGAGAGAGCTTTTTTTTT-CTTGCGATACACCTTCGCCGGGTGATAGCCG 310488 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YBR160W, YBR161W | 561435 | 561435 | Deletion | C | |
A single nucleotide deletion was made in the intergenic region between ORFs CDC28/YBR160W and CSH1/YBR161W.
New 561405 GCAAATTCATTGCTCTTTGAATTTTGAAGAGTTTCA-TTGTCACCGTTGAATAACCGAGA 561463 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 561399 GCAAATTCATTGCTCTTTGAATTTTGAAGAGTTTCACTTGTCACCGTTGAATAACCGAGA 561458 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2004-07-16 | YBL066C | 96812 | 96962 | Substitution | GTGGTTGGATAGAGAACAGTGTTAG TCCCGTAGAATCGTGGTCGTTGTTC TATGATATCAACTTTGGAACAACTC AGAGGTGGATATCCCGTCTTTTAGA GGACCGGGGTCGGACGCGGAATCCA ACTGTCATATATTGACCGAAACAAA G | GATGGTTTGGAAGTTAGAAGAAGTT ACAGTGTTAGTGCCCGTAGAAAATC GTTGGTTCGTTTTGTTGCTATTGAT ATCATTACTTTTGGAAAACAAGCTC AGAGGTGGATATGCCGTGCTTTTAG AGGAGCCGGGGTCGGAAACGACGGA ATGCAAATCTGTCATATTATTTGAC TTCGAAGCAATCG |
SGD re-sequenced this region in S288C and found that 37 nucleotide insertions and 4 nucleotide changes were necessary to correct the reference sequence. As a consequence of these changes, SEF1/YBL066C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 1,057 to 1,148 amino acids.
New: 1 TGTTTCCAGGAGTCTTCACGTTGTTTTCATTATCGATGGTTTGGAAGTTAGAAGAAGTTA 60 ||||||||||||||||||||||||||||||||||| ||||| ||| ||| |||| Current: 96777 TGTTTCCAGGAGTCTTCACGTTGTTTTCATTATCG-TGGTT-GGA---TAG-AGAA---- 96826 New: 61 CAGTGTTAGTGCCCGTAGAAAATCGTTGGTTCGTTTTGTTGCTATTGATATCATTACTTT 120 |||||||||| ||||||||| |||| || ||||| ||| ||| |||||||| ||||| Current: 96827 CAGTGTTAGT-CCCGTAGAA--TCGT-GG-TCGTT--GTT-CTA-TGATATCA--ACTTT 96875 New: 121 TGGAAAACAAGCTCAGAGGTGGATATGCCGTGCTTTTAGAGGAGCCGGGGTCGGAAACGA 180 |||| ||| ||||||||||||||| |||| ||||||||||| ||||||||||| || Current: 96876 -GGAA--CAA-CTCAGAGGTGGATATCCCGT-CTTTTAGAGGA-CCGGGGTCGGA--CG- 96926 New: 181 CGGAATGCAAATCTGTCATATTATTTGACTTCGAAGCAATCGGTGTACGTGAATGGGACA 240 |||||| ||| ||||||||| | ||||| |||| ||| ||||||||||||||||||| Current: 96927 CGGAATCCAA--CTGTCATAT-A-TTGAC--CGAAACAAA-GGTGTACGTGAATGGGACA 96979 | ||||||
2004-07-13 | YBL067C | 93899 | 93899 | Insertion | A | |
The work of Kellis et al. 2003 predicted the insertion of a single nucleotide; this sequence error was confirmed in S288C by SGD. As a consequence of this sequence change, UBP13/YBL067C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 688 to 747 amino acids.
New: 93883 TCGCTTTATAAAACAAAACATATGCTGTTGCCATATTTGGAGATTCACCTGTGAATTCTA 93942 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old: 93883 TCGCTTTATAAAACAAA-CATATGCTGTTGCCATATTTGGAGATTCACCTGTGAATTCTA 93941 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-07-12 | YBR062C | 366383 | 366383 | Deletion | T | |
The work of Cliften et al. 2003 predicted that there is a sequencing error in YBR062C: an single nucleotide should be deleted 100 nt upstream of the currently annotated start site. Assuming this sequence change, Cliften et al. further propose a new intron and 5' exon, and a framechange for this ORF. When spliced, this ORF would now encode a predicted protein of 180 amino acids. This sequence error was confirmed in S288C by SGD and the coordinates have been changed accordingly (start was moved upstream 195 nt and an intron was added at relative coordinates 17-98).
New: AAAGTTTTGAAATAGACCTTGCAGTTGGGATCT-GACCTGTCTTCTCTGCTCCTCCTGTG ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old: AAAGTTTTGAAATAGACCTTGCAGTTGGGATCTTGACCTGTCTTCTCTGCTCCTCCTGTG Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | ||||||
2004-07-09 | YBR108W | 457298 | 457298 | Insertion | G | |
The work of Kellis et al. 2003 predicted the insertion of a single G after the G at chromosomal coordinate 457298. This sequence error was confirmed in strain S288C by SGD. As a consequence of this sequence change which caused a frameshift, YBR108W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 848 to 947 amino acids.
New: CGGTTCGAAAAAAGTGAAGGACTCTAGCCCTGTTCCCTCAGATCTAGATGAAAAATATGT ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Old: CGGTTCGAAAAAAGTGAAG-ACTCTAGCCCTGTTCCCTCAGATCTAGATGAAAAATATGT Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-01-29 | YBL097W | 40900 | 40901 | Deletion | GA | |
Kellis et al. 2003 predicted and confirmed the deletion of two nucleotides (GA) at chromosomal coordinates 40900-40901. As a consequence of this deletion, YBL097W was extended at the 5' end, altering the N-terminus and increasing the predicted protein from 728 to 754 amino acids.
New 61 TTTACCAATAGA--TCCACCATGATGGCAAATTTTGAAGAATGGATCAAAATGGCTACAG 118 |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 40888 TTTACCAATAGAGATCCACCATGATGGCAAATTTTGAAGAATGGATCAAAATGGCTACAG 40947 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-01-29 | YBL013W | 203180 | 203180 | Insertion | C | |
A single C nucleotide insertion was confirmed by sequencing genomic DNA from FY23 (S288C) and a D273-10B related strain; GenBank accession number for FY23 is AY490279. The stop codon of ORF YBL013W has been moved downstream, so that the ORF is now 1206 nucleotides long as opposed to the previously annotated 1182 nt.
New 1141 GGCCAGTTCATGGCGCGCCTGCGGAAAAGATGCGGCGCCCTGAGTGAAAAGTTAGTTTTC 1200 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 203163 GGCCAGTTCATGGCGCG-CTGCGGAAAAGATGCGGCGCCCTGAGTGAAAAGTTAGTTTTC 203221 | ||||||
2004-01-28 | YBL006C, YBL006W-A | 216785 | 216785 | Deletion | G | |
Kellis et al. 2003 predicted and confirmed the deletion of a single nucleotide at 216785. As a consequence of this sequence change, YBL006C was extended at the 3' end, altering the C-terminus and increasing the predicted protein from 145 to 180 amino acids. In addition, YBL006W-A was extended at the 3' end, altering the C-terminus and increasing size of the predicted protein from 39 to 49 amino acids.
New 301 TCAAGTGTCGA-CTTTTCGCACCATTTCCACCGCACATTAGAATGCAAAGCTGCTCTAGA 359 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old TCAAGTGTCGACCTTTTCGCACCATTTCCACCGCACATTAGAATGCAAAGCTGCTCTAGA Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-01-26 | YBL103C-A, YBL104C | 21279 | 21279 | Insertion | T | |
18364 | 18364 | Insertion | G | |||
21288 | 21288 | Insertion | C | |||
21345 | 21345 | Insertion | A | |||
21347 | 21347 | Insertion | A | |||
Brachat et al. 2003 and Kellis et al. 2003 predicted and confirmed DIFFERENT sequence changes for YBL104C. Brachat et al. demonstrated the insertion of a single G nt, which extended the 3' end by 141 nt and altered the C-terminus, resulting in overlapping ORF YBL103C-A becoming part of YBL104C (Cliften et al. also predicted this change).
New: CTTCTGTCTGCATTGGATCGCGTGATTGCGTCCCATTTATTACAAAAGGTAAGTTTGACG ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Previous: 18350 CTTCTGTCTGCATTG-ATCGCGTGATTGCGTCCCATTTATTACAAAAGGTAAGTTTGACG 18408 Kellis et al. demonstrated the insertion of four separate nucleotides (a single T, a single C, and two separate As), which extended at the 5' end by 198 nt and altered the N-terminus. The inserted C (G on the opposite, coding strand) is the third nucleotide of the new ATG start codon. New: ATTATCATATGACCAATGGGTCACTTTTTTGATGAGACCCATGTTTATTCTTCTATACGT ||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| Previous: 21251 ATTATCATATGACCAATGGGTCACTTTTT-GATGAGACC-ATGTTTATTCTTCTATACGT 21308 New: TCGTGATACTGCACTTACGACTACCAGTAACATCAGAATAACCATAGAGC ||||||||||||||||||||||||||||||||||||| || ||||||||| Previous: 21309 TCGTGATACTGCACTTACGACTACCAGTAACATCAGA-TA-CCATAGAGC 21356 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-01-21 | YBR041W | 320081 | 320082 | Deletion | CC | |
Kellis et al. 2003 and Brachat et al. 2003 independently predicted and confirmed the deletion of two C nucleotides from YBR041W. As a consequence of this change, YBR041W was extended at the 3' end, altering the C-terminus and increasing the predicted protein from 623 to 669 amino acids.
New: TCTTATGCTATGCCCCTATTTGTTAAATTTGTTGATGAAATTAAAATGACAGATAA--TC |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Previous: 320025 TCTTATGCTATGCCCCTATTTGTTAAATTTGTTGATGAAATTAAAATGACAGATAACCTC 320084 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-01-20 | YBR157C | 553996 | 553996 | Insertion | G | |
Kellis et al. 2003 predicted and confirmed the insertion of a single G nt after the C at chromosomal coordinate 553996. As a consequence of this sequence change, YBR157C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 106 to 255 amino acids.
New: TATGGAGGAATTTCTCCTCGTTTTCACACCATCCTTGTCTCCAGGGAAAGAGTAGGTCTT ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Previous: 553978 TATGGAGGAATTTCTCCTC-TTTTCACACCATCCTTGTCTCCAGGGAAAGAGTAGGTCTT 554036 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-01-09 | YBR269C | 742165 | 742165 | Insertion | G | |
742175 | 742175 | Insertion | G | |||
Kellis et al. 2003 predicted and confirmed the insertion of G after the G at chromosomal coordinate 742165, and the insertion of another G after the G at 742175. As a consequence of these sequence changes, YBR269C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 130 to 138 amino acids. This sequence change was incorporated at MIPS prior to SGD, and was verified in strain S288C.
New: ACGAATAATCGCCGTGTCTCAACGGGTCCTGCTTGGGACCCCCAACTTCACCAGTCTTGG ||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| Previous: 742141 ACGAATAATCGCCGTGTCTCAACGG-TCCTGCTTGG-ACCCCCAACTTCACCAGTCTTGG Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2003-09-29 | YBR074W, YBR075W | 387625 | 387625 | Deletion | G | |
387430 | 387430 | Deletion | C | |||
Due to deletion of a C after the C at position 387430 and a deletion of G after the G at position 387625, YBR074W and YBR075W were merged. After merging YBR074W (386243 - 387484 (1-1242)) and YBR075W (387793 - 389175 (1-1383)), the coordinates of the merged ORF, YBR074W, are 386243 - 389173 (1 - 2931). YBR075W is now an alias of YBR074W. These sequence changes were verified in S288c strain by SGD.
Query: 1141 TCTCGTGATAGAATGACTTGGAAATCTTATTCATGGCTATCGTGGAC-ACGCTTTCCTCT 1199 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 387383 TCTCGTGATAGAATGACTTGGAAATCTTATTCATGGCTATCGTGGACCACGCTTTCCTCT 387442 Query: 1380 AAG-CCTATCAATTATCGAATTGTTCATTATTTTATGGACCATTTTACTTTTTACGTCGA 1438 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 387623 AAGGCCTATCAATTATCGAATTGTTCATTATTTTATGGACCATTTTACTTTTTACGTCGA 387682 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2003-01-03 | YBR098W, YBR100W | 442868 | 442868 | Deletion | C | |
Due to a change to the systematic sequence of chromosome II (C deletion at 442868), YBR098W and YBR100W have been merged to one single ORF of 691 aa. MMS4 is the standard name for the new, elongated ORF after merging; YBR100W and SLX2 are its aliases. The new coordinates of MMS4/YBR098W are 441473-443548, for a coding sequence of 2076 nt.
We thank Jim Brown (james.brown@stanford.edu), and Kirk Ehmsen (ktehmsen@ucdavis.edu) for reporting this sequence error on Chr II, which was verified in the FY1679 (S288c derivative) strain background by SGD. Old: 442861 AGAAAACCGTTTTGATTCTATATTATGATGCGCAAGAATTTTTTGAACAATACACTTCAC 442920 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| New: 442861 AGAAAAC-GTTTTGATTCTATATTATGATGCGCAAGAATTTTTTGAACAATACACTTCAC 442919 Xiao W, et al. (1998) Mms4, a putative transcriptional (co)activator, protects Saccharomyces cerevisiae cells from endogenous and environmental DNA damage. Mol Gen Genet 257(6):614-23 | ||||||
2003-01-02 | YBR086C | 422272 | 422273 | Substitution | TA | AT |
We received a direct notification from MIPS about the following sequence changes; we did not have this change in SGD, so the sequence was edited: The T at 422272 was changed to an A, and the A at 422273 was changed to a T. These differences changed amino acid residue 243 of IST2/YBR086C from Tyr (TAC) -> Ile (ATC). The coordinates of YBR086C are not changed due to this sequence update. References: (1) Sequence verification in FY1679 (S288c derivative strain) background by SGD, (2) Personal communication from Anna Kurlandzka (ania218@poczta.ibb.waw.pl).
Old: 422221 GTAGGCAAAAAAGACAAGATGGAAATCATTGGGCCGTTATAAATTTGCTTGTAGAAAATT 422280 ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| New: 422221 GTAGGCAAAAAAGACAAGATGGAAATCATTGGGCCGTTATAAATTTGCTTGATGAAAATT 422280 | ||||||
2001-05-29 | YBL069W | 91711 | 91711 | Deletion | C | |
A change was made to the systematic sequence of Chromosome II within the ORF AST1/YBL069W. The C at chromosomal coordinate 91711 was deleted, shifting the reading frame and moving the stop from 91722 to 92025:
Old: 91681 TTGATTCACGGCGGTGGTGCGTACGTAACCCACTGTAGGTGATTACGTTGCCAATTATAA 91740 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| New: 91681 TTGATTCACGGCGGTGGTGCGTACGTAACC-ACTGTAGGTGATTACGTTGCCAATTATAA 91739 | ||||||
2001-05-29 | YBL004W | 234918 | 234918 | Substitution | C | A |
A change was made to the systematic sequence of Chromosome II within the ORF UTP20/YBL004W. The C at chromosomal coordinate 234918 was changed to an A:
Old: 234901 CAGACCGTATTAGAAAGCAGAAAGGAAAGGAGATCTAAAAGGGCAATTCTGGCTGTTAAC 234960 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| New: 234901 CAGACCGTATTAGAAAGAAGAAAGGAAAGGAGATCTAAAAGGGCAATTCTGGCTGTTAAC 234960 | ||||||
1999-04-26 | YBR266C, YBR267W | 739912 | 739912 | Deletion | A | |
739866 | 739866 | Deletion | G | |||
Two changes were made to the systematic sequence of Chromosome II within the ORF REI1/YBR267W. The G at chromosomal coordinate 739866 was deleted, and the A at 739912 was deleted; as a result, the start of YBR267W was moved 294 nt upstream.
Note that the deletion at 739912 also affects the overlapping ORF SLM6/YBR266C; as a result, the stop of YBR266C was moved 111 nt upstream: Old: 739860 GAGCAGGCGGGCCCACATGAAGTCCGATTGGCATCGCTACAATTTGAAAAGAACGTGTTG 739919 |||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| New: 739860 GAGCAG-CGGGCCCACATGAAGTCCGATTGGCATCGCTACAATTTGAAAAGA-CGTGTTG 739917 | ||||||
1999-04-26 | YBR201W | 623651 | 623651 | Deletion | A | |
A change was made to the systematic sequence of Chromosome II in the region upstream of the ORF DER1/YBR201W. The A at chromosomal coordinate 623651 was deleted. As a result, the start of YBR201W was moved upstream 210 nucleotides, increasing the size of the predicted protein from 141 to 211 amino acids.
Old: 623640 GATCCAGGGAAAGGTAGTGTACAGTTATGATTTAGTATTCAAAAAGGGACAATATGGAAG 623699 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| New: 623640 GATCCAGGGAA-GGTAGTGTACAGTTATGATTTAGTATTCAAAAAGGGACAATATGGAAG 623698 | ||||||
1999-04-26 | YBR294W | 791709 | 791709 | Substitution | T | C |
A change was made to the systematic sequence of Chromosome II within the ORF SUL1/YBR294W. The T at chromosomal coordinate 791709 was changed to a C:
Old: 791700 TATGTGCTGTAACTGGGACAAATTTACCGTTTTTTCATATCGATATACCCGATTTTTCTA 791759 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| New: 791700 TATGTGCTGCAACTGGGACAAATTTACCGTTTTTTCATATCGATATACCCGATTTTTCTA 791759 | ||||||
1999-04-26 | YBR069C, YBR070C | 378824 | 378824 | Insertion | C | |
378810 | 378810 | Insertion | T | |||
378815 | 378815 | Deletion | C | |||
Three changes were made to the systematic sequence of Chromosome II in the intergenic region between the ORFs TAT1/YBR069C and ALG14/YBR070C. A single T was inserted after the T at chromosomal coordinate 378810, the C at 378815 was deleted, and a C was inserted after the G at 378824:
Old: 378781 GCCGGCCCTGACTGACCTTTTTTGTATTTT-GGCCCGTCCCGGCG-GGCGAAGAGTGAGAC 378839 |||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||| New: 378781 GCCGGCCCTGACTGACCTTTTTTGTATTTTTGGCC-GTCCCGGCGCGGCGAAGAGTGAGAC 378840 | ||||||
1999-04-23 | YBL067C | 94040 | 94040 | Substitution | G | C |
A change was made to the systematic sequence of Chromosome II within the ORF UBP13/YBL067C. The G at chromosomal coordinate 94040 was changed to a C:
Old: 94021 CATAATGGCCGTGTTGTGGGCCACCGCCCATATGAACGACAATCCCAGCCAATTCATACT 94080 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| New: 94021 CATAATGGCCGTGTTGTGGCCCACCGCCCATATGAACGACAATCCCAGCCAATTCATACT 94080 | ||||||
1999-04-23 | YBR006W | 247367 | 247367 | Substitution | C | T |
248539 | 248539 | Substitution | A | T | ||
248278 | 248278 | Substitution | A | T | ||
247262 | 247262 | Substitution | C | G | ||
Three single nucleotide (nt) substitutions were made to the systematic sequence of Chromosome II within the ORF UGA2/YBR006W, and one substitution was made in the adjacent intergenic region. The C at chromosomal coordinate 247262 was changed to a G, the C at 247367 was changed to a T, the A at 248278 was changed to a T (destroying the stop codon), and the A at 248539 was changed to a T. As a result, the stop was moved 186 nucleotides downstream, increasing the size of the coding sequence from 1308 nt to 1494 nt.
Old: 247261 TCGCAACCATCATTACTTTAGAAAATGGTAAAGCTCTAGGGGAAGCTAAAGGAGAAATCA 247320 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| New: 247261 TGGCAACCATCATTACTTTAGAAAATGGTAAAGCTCTAGGGGAAGCTAAAGGAGAAATCA 247320 Old: 247321 AATACGCGGCTTCGTATTTTGAGTGGTACGCCGAGGAAGCACCCCGCTTATATGGTGCTA 247380 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| New: 247321 AATACGCGGCTTCGTATTTTGAGTGGTACGCCGAGGAAGCACCCCGTTTATATGGTGCTA 247380 Old: 248221 CTAATGATACTGAGTTTGGTTTAGCAGCATATGTCTTTTCTAAAAATGTCAACACTTAAT 248280 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || New: 248221 CTAATGATACTGAGTTTGGTTTAGCAGCATATGTCTTTTCTAAAAATGTCAACACTTTAT 248280 Old: 248521 GTATATATCTATTGCATGAATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATT 248580 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| New: 248521 GTATATATCTATTGCATGTATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATT 248580 | ||||||
1999-04-23 | YBL066C | 97484 | 97485 | Substitution | TG | GC |
A change was made to the systematic sequence of Chromosome II within the ORF SEF1/YBL066C. The two nucleotides TG at positions 575 and 576 (chromosomal coordinates 97484-97485) were changed to GC, altering translation by changing amino acid 192 from Gln (CAA) to Ala (GCA). Note that this ORF is on the Crick strand.
Old: 97441 AGAACCGTCAGAATCTCCGTTATTTGTCTTGGCTAGCTTTTCTTGCTGCTTTAAGGCATT 97500 ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| New: 97441 AGAACCGTCAGAATCTCCGTTATTTGTCTTGGCTAGCTTTTCTGCCTGCTTTAAGGCATT 97500 Cherry JM, et al. (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America | ||||||
1999-04-22 | YBL033C | 159114 | 159114 | Substitution | C | G |
The C at chromosomal coordinate 159114 within the ORF RIB1/YBL033C was changed to a G, altering translation by changing amino acid 181 from Lys (AAG) to Asn (AAC). Note that this ORF is on the Crick strand:
Old: 159061 CGACCCTCTTGTCTTAGATACACGATAACACCATGGCCGTTTCCACCTTTGATCTTGCTT 159120 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| New: 159061 CGACCCTCTTGTCTTAGATACACGATAACACCATGGCCGTTTCCACCTTTGATGTTGCTT 159120 Cherry JM, et al. (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America | ||||||
1998-09-13 | YBL101C | 25408 | 25408 | Insertion | C | |
28272 | 28272 | Insertion | G | |||
28296 | 28296 | Insertion | C | |||
25394 | 25394 | Deletion | T | |||
28306 | 28306 | Substitution | A | G | ||
28302 | 28302 | Insertion | GG | |||
Six changes were made to the systematic sequence of Chromosome II within the ORF ECM21/YBL101C and in the adjacent intergenic region. Within the ORF, the T at chromosomal coordinate 25394 was deleted, and a single C was inserted after the C at 25408:
Old: 25381 CGGCATCATCGCTTGTATCCGGATGGCC-ACTAACTGACGTAGTTCTTGATAAGTTCAAT 25439 ||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| New: 25381 CGGCATCATCGCT-GTATCCGGATGGCCCACTAACTGACGTAGTTCTTGATAAGTTCAAT 25439 Upstream of the ORF, a single G was inserted after the G at 28272, a single C was inserted after the C at 28296, two nucleotides (nt) GG were inserted after the G at 28302, and the A at 28306 was changed to a G: Old: 28260 TTTTTCGCCACCG-TCTTGATGTTATAAACGGCATGCC-AATAGG--TAGAGAAAAATCT 28315 ||||||||||||| |||||||||||||||||||||||| |||||| ||| ||||||||| New: 28260 TTTTTCGCCACCGGTCTTGATGTTATAAACGGCATGCCCAATAGGGGTAGGGAAAAATCT 28319 The start site of YBL101C was then moved upstream, extending the size of the coding region from 3234 nt to 3354 nt, and the size of the predicted protein from 728 amino acids (aa) to 754 aa. | ||||||
1997-07-27 | YBL091C | 48615 | 48615 | Substitution | A | C |
The A at chromosomal coordinate 48615 (upstream of the Crick strand ORF MAP2/YBL091C at coordinates 48402-47353) was changed to a C, and the start site of YBL091C was then moved 216 nucleotides (nt) upstream to the newly-created start codon, extending the size of the coding sequence from 1050 nt to 1266 nt, the size of the predicted protein from 349 amino acids (aa) to 421 aa. Note that the sequence presented below is from the Watson strand:
New: 48600 TATTTCAGCGTCTGTCATTTTTCAATACGGTAGAGCTTCTACAGTACTTGTTGATGTAAA 48659 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old: 48600 TATTTCAGCGTCTGTAATTTTTCAATACGGTAGAGCTTCTACAGTACTTGTTGATGTAAA 48659 | ||||||
1997-07-27 | YBL103C | 22603 | 22603 | Insertion | G | |
A single G was inserted after the G at chromosomal coordinate 22603 within the ORF RTG3/YBL103C, shifting the frame and extending the 3' end by 510 nucleotides:
New: 22561 TACCTAGGTCATCGTAATTCAATAAAGATGGTGGAACCAACTGGCCGAGTTCTTTTATCT 22620 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old: 22561 TACCTAGGTCATCGTAATTCAATAAAGATGGTGGAACCAACTG-CCGAGTTCTTTTATCT 22619 |
Annotation Changes
Date | Affected Features |
---|---|
2014-11-18 | TLC1 |
The feature_type annotation of TLC1 was changed from ncRNA to telomerase_RNA_gene (SO:0001643) as part of SGD's genome annotation revision R64.2. | |
2014-11-18 | ARS207, ARS208, ARS209, ARS211, ARS214, ARS216, ARS217, ARS224, ARS231 |
As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome II based on Liachko et al. 2013: ARS207, ARS231, ARS208, ARS209, ARS211, ARS214, ARS216, ARS217, ARS224.
Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704
| |
2014-11-18 | ARS202, ARS207, ARS208, ARS209, ARS214, ARS224, ARS228, ARS231 |
The chromosomal coordinates of the following ARS elements on Chromosome II were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS202, ARS207, ARS231, ARS208, ARS209, ARS214, ARS224, ARS228.
Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704
| |
2014-11-18 | ARS200, ARS201, ARS203, ARS206, ARS217 |
The following new ARS elements on Chromosome II were added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS200, ARS201, ARS203, ARS206, ARS217.
Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704
| |
2014-11-18 | ETC8 |
The following previously unmapped features were identified as nuclear matrix attachment sites and assigned chromosomal coordinates based on Hiraga et al. 2012 as part of SGD's genome annotation revision R64.2: ETC1, ETC2, ETC3, ETC4, ETC6, ETC7, ETC8.
Hiraga SI, et al. (2012) TFIIIC localizes budding yeast ETC sites to the nuclear periphery. Mol Biol Cell 23(14):2741-54
| |
2009-05-07 | YBR073W |
The start site for RDH54/YBR073W was reinstated 102 nt (34 codons) upstream. This is a reversal of the start site change made to this ORF on 2003-09-22. Thank you to Nancy Hollingsworth for bringing this issue to our attention.
Shinohara M, et al. (1997) Characterization of the roles of the Saccharomyces cerevisiae RAD54 gene and a homologue of RAD54, RDH54/TID1, in mitosis and meiosis. Genetics 147(4):1545-56 Petukhova G, et al. (2000) Promotion of Rad51-dependent D-loop formation by yeast recombination factor Rdh54/Tid1. Genes Dev 14(17):2206-15 Chi P, et al. (2006) Yeast recombination factor Rdh54 functionally interacts with the Rad51 recombinase and catalyzes Rad51 removal from DNA. J Biol Chem 281(36):26268-79 Kwon Y, et al. (2008) ATP-dependent Chromatin Remodeling by the Saccharomyces cerevisiae Homologous Recombination Factor Rdh54. J Biol Chem 283(16):10445-52
| |
2009-05-07 | ARS212, ARS213, ARS221 |
The following ARS elements on Chromosome 2 were added to the genome annotation based on Raveendranathan et al. 2006: ARS212, ARS213, and ARS221.
Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39
| |
2007-07-09 | YBR215W |
The start of ORF HPC2/YBR215W was moved 90 nt upstream and an intron was added at relative coordinates 14..97 based on GenBank EF123149 and Juneau et al. 2007. According to Juneau et al. 2007, the intron is "inefficiently spliced" (splicing rate 85%). The ORF had been annotated as 1872 nt long, but is now 1962 nt in length.
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
| |
2007-04-05 | YBLCdelta7, YBRCdelta11, YBRCdelta14, YBRCdelta19 |
The following Ty1 LTRs on Chromosome II were mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick); the error has now been corrected, so that the LTRs are annotated on the Crick strand: YBLCdelta7, YBRCdelta11, YBRCdelta14, YBRCdelta19. | |
2007-04-05 | YBRCtau2 |
YBRWtau2, a Ty4 LTR on Chromosome II, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YBRCtau2 and is annotated on the Crick strand. The name YBRWtau2 is being retained as an alias. | |
2007-04-05 | YBLCtau1 |
YBLWtau1, a Ty4 LTR on Chromosome II, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YBLCtau1 and is annotated on the Crick strand. The name YBLWtau1 is being retained as an alias. | |
2007-04-04 | YBR089C-A |
NHP6B/YBR089C-A mRNA contains an intron in the 5' untranslated region (UTR).
Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
| |
2007-04-04 | YBL092W |
RPL32/YBL092W mRNA contains an intron in the 5' untranslated region (UTR).
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
| |
2007-04-04 | YBL072C |
RPS8A/YBL072C mRNA contains an intron in the 5' untranslated region (UTR).
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
| |
2006-10-04 | LSR1 |
The start site and the stop site for LSR1/snR20 (aka U2 snRNA) were each moved 4 nt upstream, to the positions determined by Ares M. Jr. (1986). Thanks to Wayne Decatur for bringing this update to our attention.
Ares M Jr (1986) U2 RNA from yeast is unexpectedly large and contains homology to vertebrate U4, U5, and U6 small nuclear RNAs. Cell 47(1):49-59
| |
2006-10-02 | ARS230, ARS231 |
ARS230 (also known as ARS201.5) and ARS231 (also known as ARS207.5) were added to the genome annotation based on Nieduszynski et al. 2006.
Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
| |
2006-09-07 | ARS202, ARS207, ARS208, ARS211, ARS214, ARS215, ARS216, ARS220, ARS222, ARS224, ARS225, ARS228 |
The following ARS elements on Chromosome II were added to SGD based on Nieduszynski et al. 2006: ARS202, ARS207, ARS208, ARS211, ARS214, ARS215, ARS216, ARS220, ARS222, ARS224, ARS225, ARS228.
Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
| |
2006-03-02 | ARS209 |
This new ARS element ARS209 was added to the genome annotation based on Bouton & Smith 1986 and Wyrick et al. 2001.
Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60 Bouton AH and Smith MM (1986) Fine-structure analysis of the DNA sequence requirements for autonomous replication of Saccharomyces cerevisiae plasmids. Mol Cell Biol 6(7):2354-63
| |
2005-11-10 | snR161 |
New snoRNA, snR161, added based on the work of Olivas et al. 1997 and Schattner et al. 2004. Note that Olivas et al. refer to this snoRNA as RNA161.
Olivas WM, et al. (1997) Analysis of the yeast genome: identification of new non-coding and small ORF-containing RNAs. Nucleic Acids Res 25(22):4619-25 Schattner P, et al. (2004) Genome-wide searching for pseudouridylation guide snoRNAs: analysis of the Saccharomyces cerevisiae genome. Nucleic Acids Res 32(14):4281-96
| |
2005-11-08 | YBR056C-B, YBR201C-A |
Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that two new ORFs, YBR056C-B and YBR201C-A, be added to the S. cerevisiae genome annotation.
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
| |
2005-11-07 | YBR286W |
After consultation with MIPS, SGD will incorporate the annotation change suggested by Kellis et al. 2003 for APE3/YBR286W. The start site is being moved 78 nt downstream from chromosomal coordinate 774618 to 774696, resulting in a predicted protein of 537 aa, as opposed to the previously annotated 563 aa. The 1692-nt ORF is now 1614 nt.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
| |
2004-10-12 | CEN2 |
Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.
Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
| |
2004-04-01 | RUF8 |
Feature annotation removed per John McCutcheon and Sean Eddy.
McCutcheon J and Eddy S (2004) Corrigendum: Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res 32 (15):4713
| |
2004-04-01 | YBR230W-A |
ORF identified by John McCutcheon and Sean Eddy.
McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28
| |
2004-01-07 | YBL091C-A |
Based on comparison to related fungi, Brachat et al., Blandin et al., and Cliften et al. all proposed an intron and 5' extension for YBL091C-A. The resulting ORF is in the same frame with the start codon shifted 316 bp upstream; the protein has a 76-residue extension at the N-terminus.
Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
| |
2003-12-17 | YBR111W-A |
The size of the first intron of YBR111W-A was increased and a second intron was added on the basis of conserved splice sites predicted by Cliften et al. 2003, as well as subsequent experimental evidence (GenBank AY278445). The chromosomal coordinates of the coding sequence have changed from 462094-462172..462175-462392 to 462094-462164..462245-462384..462455-462534.
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
| |
2003-12-17 | YBR255C-A |
The boundaries of the intron in ORF YBR255C-A were shifted by 1 bp on 5' end and 2 bp on 3' end on basis of conserved splice sites in other fungal species as predicted by Blandin et al. 2000.
Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6
| |
2003-09-22 | YBR280C |
The start site for YBR280C was moved 15 nt (5 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
| |
2003-09-22 | YBR172C |
The start site for SMY2/YBR172C was moved 150 nt (50 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
| |
2003-09-22 | YBL089W |
The start site for AVT5/YBL089W was moved 150 nt (50 codons) downstream based on the automated comparison of closely related Saccharomyces species by Kellis et al. 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been updated. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
| |
2003-09-22 | YBL068W |
The start site for PRS4/YBL068W was moved 84 nt (28 codons) downstream based on the automated comparison of closely related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
| |
2003-09-22 | YBR095C |
The start site for YBR095C was moved 69 nt (23 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
| |
2003-09-22 | YBR073W |
The start site for RDH54/YBR073W was moved 102 nt (34 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
| |
2003-09-22 | YBR058C |
The start site for UBP14/YBR058C was moved 66 nt (22 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
| |
2003-09-22 | YBR122C |
The start site for MRPL36/YBR122C was moved 57 nt (19 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The predicted protein translated from the conserved methionine contains a predicted mitochondrial targeting signal sequence (using both MitoProt (MIPS) and Predotar), while the predicted protein translated from the previously annotated S. cerevisiae start codon does not.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
| |
2003-09-22 | YBR264C |
The start site for YPT10/YBR264C was moved 57 nt (19 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
| |
2003-09-22 | YBR263W |
The start site for SHM1/YBR263W was moved 225 nt (75 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
| |
2003-09-09 | TEL02L, TEL02R |
The chromosomal locations for the following telomeric elements on Chromosome 2 were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL02L, TEL02L-XC, TEL02L-XR, TEL02L-YP, TEL02R, TEL02R-XC, TEL02R-XR, TEL02R-TR.
Note that TEL02L does have telomeric repeats (TEL02L-TR), but they are missing from the genome annotation due to sequencing difficulties encountered during the initial genome sequencing efforts in the 1990s. | |
2003-07-29 | YBL039C-A, YBR121C-A, YBR196C-B, YBR221W-A |
Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following four ORFs on Chromosome 2: YBL039C-A, YBR121C-A, YBR196C-B, YBR221W-A.
Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9 Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51 Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20
| |
2003-07-29 | YBR056W-A, YBR109W-A, YBR126W-B |
Thanks to MIPS for providing the coordinates of the following three ORFs on Chromosome 2: YBR056W-A, YBR109W-A, YBR126W-B. | |
2003-07-29 | YBL006W-A, YBL071C-B, YBL100W-C, YBL113W-A, YBR126W-A, YBR131C-A, YBR141W-A, YBR182C-A, YBR223W-A, YBR296C-A, YBR298C-A |
Thanks to Kumar et al. for providing the coordinates of the following 11 ORFs on Chromosome 2: YBL006W-A, YBL071C-B, YBL101W-C, YBL113W-A, YBR126W-A, YBR131C-A, YBR141W-A, YBR182C-A, YBR223W-A, YBR296C-A, YBR298C-A.
Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63
| |
2003-07-29 | YBL008W-A, YBL068W-A, YBL103C-A, YBR072C-A, YBR076C-A, YBR196C-A, YBR200W-A |
Thanks to Kessler et al. for providing the coordinates of the following seven ORFs on Chromosome 2: YBL008W-A, YBL068W-A, YBL103C-A, YBR072C-A, YBR076C-A, YBR196C-A, YBR200W-A.
Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
| |
2003-07-29 | YBL039W-B, YBR111W-A |
Thanks to Brachat et al. for providing the coordinates of the following two ORFs on Chromosome 2 based on homology to Ashbya gossypii: YBL039W-B, YBR111W-A.
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
| |
2003-03-06 | RUF8 |
Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8.
McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28
| |
2001-01-30 | YBL071W-A |
ORF added based on similarity to an S. pombe gene (information submitted by Valerie Wood). | |
2000-08-11 | YBR089C-A |
old name: YBR090C-A; new name: YBR089C-A; date: 11/1998; old coord: ChrII 426447 426148; SGDID: S0002157; Name changed due to nomenclature | |
2000-07-14 | YBR186W |
Davis et al. demonstrated an intron and 3' exon in PCH2/YBR186W that were not previously annotated. The addition of this intron and exon alters the C-terminus of the protein product and increases the protein size from 537 to 564 amino acids.
Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6
| |
1999-11-17 | YBL059C-A |
A new ORF, YBL059C-A, was identified from EST analysis (Evan Hurowitz in Pat Brown's lab). | |
1998-05-21 | YBL091C-A, YBL107W-A |
The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. |