Chromosome XIV History
This page lists all sequence and annotation changes that have been made to the Chromosome XIV systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome XIV has been updated 43 times, affecting 41 features.
- The annotation of Chromosome XIV has been updated 33 times, affecting 59 features.
- Current and past versions can be obtained from SGD's Download site.
Contents
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YNL008C | 618198 | 618198 | Deletion | G | |
A single C nucleotide was deleted within ORF YNL008C, altering its coding sequence. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 7 amino acids longer.
New 618178 AAAAGCTAAATACATCTC-TGTTATGGAGCAATTGCTTAACATGTTGCAATATATTTGTA 618236 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 618180 AAAAGCTAAATACATCTCGTGTTATGGAGCAATTGCTTAACATGTTGCAATATATTTGTA 618239 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL243W | 189081 | 189081 | Substitution | CG | GC |
Nucleotide change(s) in the coding region of SLA2/YNL243W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 344 is now Alanine rather than Arginine.
New 189059 ATCCCCACTGCCACTGGTGCAGCTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAG 189118 ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 189060 ATCCCCACTGCCACTGGTGCACGTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAG 189119 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL175C | 307728 | 307728 | Substitution | T | G |
Nucleotide change(s) in the coding region of NOP13/YNL175C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 296 is now Alanine rather than Glutamic Acid.
New 307678 ATTCGCAATGGCCTTCCGGCAATTTTTCTACAACTTTTATCCTTTAATGCATTAGTAGAT 307737 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 307680 ATTCGCAATGGCCTTCCGGCAATTTTTCTACAACTTTTATCCTTTAATTCATTAGTAGAT 307739 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YNL176C | 306231 | 306231 | Substitution | C | A |
Nucleotide change(s) in the coding region of YNL176C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 251 is now Phenylalanine rather than Cysteine.
New 306178 GAAAGCGATGAACTGTAAAACGATGTGGAAGTATTCCGACTGGAACTTGGGAATGTGGTA 306237 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Old 306180 GAAAGCGATGAACTGTAAAACGATGTGGAAGTATTCCGACTGGAACTTGGGCATGTGGTA 306239 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. |