Chromosome X History
This page lists all sequence and annotation changes that have been made to the Chromosome X systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome X has been updated 106 times, affecting 81 features.
- The annotation of Chromosome X has been updated 31 times, affecting 65 features.
- Current and past versions can be obtained from SGD's Download site.
Contents
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YJR103W | 622414 | 622414 | Insertion | C | |
A single C nucleotide was inserted very near the 3' end of ORF URA8/YJR103W, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 14 amino acids longer.
New 622379 GAAGGTGCTGGAACCATCAAGACCGTTTTGGGGGCTTGTGGCCGCAGCCTCCGGCACACT 622438 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 622368 GAAGGTGCTGGAACCATCAAGACCGTTTTGGGGGCTTGTGGCCGCAG-CTCCGGCACACT 622426 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL171C | 99777 | 99778 | Substitution | CG | GC |
99767 | 99767 | Substitution | G | C | ||
99792 | 99793 | Substitution | AA | TT | ||
Nucleotide changes within the coding region of YJL171C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 366 is now Lysine rather than Leucine, residue 371 is now Alanine rather than Arginine, and residue 374 is now Lysine rather than Asparagine.
New 99757 ATACACCGTTTTGCATCTTCGTTAAAGCAACACCATTCGACTTCGAGGTGGTCGAAGGCG 99816 |||||||||||||||| ||||||||| ||||||||||||| ||||||||||||||||| Old 99751 ATACACCGTTTTGCATGTTCGTTAAACGAACACCATTCGACAACGAGGTGGTCGAAGGCG 99810 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR107W | 627524 | 627525 | Substitution | CC | GG |
627367 | 627369 | Substitution | CCT | TCC | ||
Nucleotide change(s) in the coding region of YJR107W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 14 is now Proline rather than Leucine, and residue 66 is now Glycine rather than Proline.
New 627368 TGCCCATCACTCCATATATCTATGAGCGTCTAGTATATTTCTTCAACGACGGAGGTTGTC 627427 |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| Old 627357 TGCCCATCACCCTATATATCTATGAGCGTCTAGTATATTTCTTCAACGACGGAGGTTGTC 627416 New 627488 CACCACATATTAACTTCTGCAATGATGAGATAATTAACCCAACAGCGGGTCAAACAGTGG 627547 ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 627477 CACCACATATTAACTTCTGCAATGATGAGATAATTAACCCAACAGCGCCTCAAACAGTGG 627536 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR098C | 613918 | 613918 | Insertion | T | |
613905 | 613905 | Insertion | T | |||
613904 | 613904 | Insertion | T | |||
Three nucleotides were inserted near the middle of ORF YJR098C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
New 613899 TAAAAAAGTTGGTTTCTTTAGTGAAAATAGTTTTATTCCACATCACATCATCTCCAAACC 613958 |||||||||||||| | ||||||||||||| ||||||||||||||||||||||||||||| Old 613891 TAAAAAAGTTGGTT-C-TTAGTGAAAATAG-TTTATTCCACATCACATCATCTCCAAACC 613947 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL015C | 407437 | 407437 | Insertion | A | |
A single nucleotide was inserted within the ORF YJL015C very near its 5' end, necessitating a change in annotation to a downstream start codon. The sequence change makes the longer version of the protein no longer possible in the reference sequence. The stop and reading frame remain the same, but the annotated protein is now 30 amino acids shorter.
New 407400 TAAACTTTTTCGTTTAACGTGACGCATGGTGCGAAGAAAAAAAAATAGCAAATCGCCACT 407459 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 407394 TAAACTTTTTCGTTTAACGTGACGCATGGTGCGAAGAAAAAAAA-TAGCAAATCGCCACT 407452 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL130C | 171996 | 171997 | Substitution | CG | GC |
Nucleotide changes within the coding region of URA2/YJL130C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 123 is now Alanine rather than Arginine.
New 171954 AGCTGGGATCCCTTCATTTTGTAACCATTTACCTAAGGAAGATTTAGCAAGATAATGAGA 172013 |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 171950 AGCTGGGATCCCTTCATTTTGTAACCATTTACCTAAGGAAGATTTACGAAGATAATGAGA 172009 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL128C | 179435 | 179435 | Substitution | G | C |
179433 | 179433 | Substitution | C | G | ||
Nucleotide changes within the coding region of PBS2/YJL128C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 222-223 are now GL rather than AV.
New 179394 TTAGTGGGCATTTTTAATGACATTCCTCCTGGTGGTAATTTGAGCCCTCGACGGGCACTT 179453 ||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| Old 179390 TTAGTGGGCATTTTTAATGACATTCCTCCTGGTGGTAATTTGACCGCTCGACGGGCACTT 179449 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR150C | 709354 | 709354 | Substitution | C | T |
A single nucleotide substitution within the coding region of DAN1/YJR150C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 115 is now Glutamic Acid rather than Glycine.
New 709317 TGGAAGAAGCCTCTGTGGTAGAAGCTGGTACTGCAGTAGCAATACCTTCATTCGCAAGTG 709376 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 709307 TGGAAGAAGCCTCTGTGGTAGAAGCTGGTACTGCAGTAGCAATACCTCCATTCGCAAGTG 709366 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR149W | 708354 | 708354 | Substitution | T | A |
A single nucleotide substitution within the coding region of YJR149W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 402 is now Aspartic Acid rather than Valine.
New 708347 CGCAAGATTGAAAATTGACGGAAAATAATATAAATACATATAAAAGACCTGATACTTATT 708406 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 708337 CGCAAGATTGAAAATTGTCGGAAAATAATATAAATACATATAAAAGACCTGATACTTATT 708396 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR132W | 670283 | 670283 | Substitution | T | G |
A single nucleotide substitution within the coding region of NMD5/YJR132W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 258 is now Alanine rather than Serine.
New 670247 TTTTTTTGTCAGCATCATTCAGCAGCCATTGCCTCAGGAAGTTTTGGCTATATCAGATAT 670306 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 670237 TTTTTTTGTCAGCATCATTCAGCAGCCATTGCCTCAGGAAGTTTTGTCTATATCAGATAT 670296 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL179W | 89005 | 89005 | Substitution | C | A |
A single nucleotide substitution within the coding region of PFD1/YJL179W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 74 is now Aspartic Acid rather than Alanine.
New 88981 CAAATACGTTAATGATTTATCACATGACGAAACTGTTCTTCTGGATCAAAGAAAAACATT 89040 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 88979 CAAATACGTTAATGATTTATCACATGCCGAAACTGTTCTTCTGGATCAAAGAAAAACATT 89038 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL164C | 110920 | 110920 | Insertion | T | |
110898 | 110898 | Deletion | T | |||
Nucleotide changes within the coding region of TPK1/YJL164C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 79-86 are now SGKYSLQD rather than VGSIVYKN.
New 110877 TACCCAGTGTCCTTAATATCTGAAAGT-CTTGTAAACTATACTTCCCACTTGTAACTCTC 110935 ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| Old 110871 TACCCAGTGTCCTTAATATCTGAAAGTTCTTGTAAACTATACTTCCCACT-GTAACTCTC 110929 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR129C | 664657 | 664657 | Substitution | G | T |
A single nucleotide substitution within the coding region of YJR129C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 118 is now Lysine rather than Threonine.
New 664657 TTCCTCAATTTTGATCTTTACGTCCTCGTCAAACCTGTACCTCACGACGTCTTTCATCAT 664716 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 664647 TTCCTCAATTGTGATCTTTACGTCCTCGTCAAACCTGTACCTCACGACGTCTTTCATCAT 664706 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJR106W | 625480 | 625480 | Substitution | G | A |
A single nucleotide substitution within the coding region of ECM27/YJR106W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 219 is now Asparagine rather than Aspartic Acid.
New 625479 GAGCCTCAGAGAAAACTCCGTTTCTCCTTTTTTGGATGACTCTCTGATGGCTTCTGGTTT 625538 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 625467 GAGCCTCAGAGAAGACTCCGTTTCTCCTTTTTTGGATGACTCTCTGATGGCTTCTGGTTT 625526 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL011C | 414287 | 414288 | Substitution | CG | GC |
Nucleotide substitutions within the coding region of RPC17/YJL011C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 159 is now Glycine rather than Alanine.
New 414280 TACACTCATGCGTAGCCAGAGATGATCTCTAGCATTTCCTCAATTGTTTTTTCGTCAAAT 414339 |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 414273 TACACTCATGCGTACGCAGAGATGATCTCTAGCATTTCCTCAATTGTTTTTTCGTCAAAT 414332 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL188C, YJL189W | 76241 | 76241 | Substitution | T | C |
A single nucleotide substitution within the coding region of BUD19/YJL188C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 90 is now Cysteine rather than Tyrosine. This nucleotide change is also present in the intron of the overlapping ORF, RPL39/YJL189W, but does not change the protein coding sequence of RPL39/YJL189W.
New 76201 TTTATGTCAGGTGGTATTGCCTTGGATCCGTGAATGCATCACATTGATGAGTTTGAACAT 76260 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 76200 TTTATGTCAGGTGGTATTGCCTTGGATCCGTGAATGCATCATATTGATGAGTTTGAACAT 76259 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL186W | 81335 | 81335 | Substitution | T | G |
A single nucleotide substitution within the coding region of MNN5/YJL186W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 395 is now Valine rather than Phenylalanine.
New 81301 CAAGGCACTGCCGGTGAAGGTGACAAAGACACTTTCGTCGCTGCTGCCCATGCCTTGAAT 81360 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 81299 CAAGGCACTGCCGGTGAAGGTGACAAAGACACTTTCTTCGCTGCTGCCCATGCCTTGAAT 81358 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YJL183W | 84958 | 84958 | Substitution | G | A |
A single nucleotide substitution within the coding region of MNN11/YJL183W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 298 is now Aspartic Acid rather than Glycine.
New 84911 AATCATTTTGAATATAGTTCGGCAAAGATTATCATTCCACATGATGCGGATGGTAATATT 84970 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 84909 AATCATTTTGAATATAGTTCGGCAAAGATTATCATTCCACATGATGCGGGTGGTAATATT 84968 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. |