Chromosome VIII History
This page lists all sequence and annotation changes that have been made to the Chromosome VIII systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome VII has been updated 33 times, affecting 40 features.
- The annotation of Chromosome VII has been updated 24 times, affecting 69 features.
- Current and past versions can be obtained from SGD's Downloads.
Contents
[hide]Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | ARS814, YHR092C | 287178 | 287178 | Insertion | C | |
287123 | 287123 | Deletion | C | |||
287116 | 287116 | Deletion | G | |||
One single nucleotide was inserted, and two single nucleotides deleted, within the ORF HXT4/YHR092C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 16 amino acids longer. The two nucleotide deletions also alter the sequence of the overlapping ARS814.
New 287091 CCGAACATCTTCTTGTAAAATGG-TTGATC-ATCATGCATTAGATCATCAGCGTTGTAGT 287148 ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| Old 287093 CCGAACATCTTCTTGTAAAATGGGTTGATCCATCATGCATTAGATCATCAGCGTTGTAGT 287152 New 287149 CAGTACCTCTCTTGTTTGGTGGAACCCAAGAAGGTGATTTCCATGGCAAAACACCTTCTT 287208 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 287153 CAGTACCTCTCTTGTTTGGTGGAACC-AAGAAGGTGATTTCCATGGCAAAACACCTTCTT 287211 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR049C-A | 207353 | 207353 | Deletion | A | |
A single nucleotide was deleted near the middle of ORF YHR049C-A, altering its coding sequence. The start remains the same, but the C-terminal half of the protein sequence has changed and the annotated protein is now five amino acids shorter.
New 207360 GTGCTGCTAA-CCCCGCCCGGCGCGAAAAATCCACCCGGGGTGCTTTAGCGTGGCTTACGAAGACCTTTT 207418 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 207353 GTGCTGCTAAACCCCGCCCGGCGCGAAAAATCCACCCGGGGTGCTTTAGCGTGGCTTACGAAGACCTTTT 207412 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR095W | 293374 | 293374 | Insertion | C | |
A single C nucleotide was inserted within ORF YHR095W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 20 amino acids longer.
New 293329 TACGTTTTTGCAAGCAAAAATGAAGATAATCCGAGCGCATGCGCAAGTAGTCCCTGCCAT 293388 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 293332 TACGTTTTTGCAAGCAAAAATGAAGATAATCCGAGCGCATGCG-AAGTAGTCCCTGCCAT 293390 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR168W | 441869 | 441869 | Insertion | G | |
A single G nucleotide was inserted very near the 3' end of ORF MTG2/YHR168W, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 19 amino acids longer.
New 441827 GTCAGGAATGGGACTGTGTTCCGATAAGCGCCCTCAGAGAGGAAAACATAGATGTGTTAA 441886 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 441829 GTCAGGAATGGGACTGTGTTCCGATAAGCGCCCTCAGAGAG-AAAACATAGATGTGTTAA 441887 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHL037C | 441869 | 441869 | Deletion | G | |
A single nucleotide was deleted within the ORF YHL037C, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 26 amino acids shorter.
New 25801 ATGCAAGGGTTATGG-CATGCGCATCCATGTGGCGTTTCCTACTTTTATTTTTACATAAT 25859 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 25798 ATGCAAGGGTTATGGGCATGCGCATCCATGTGGCGTTTCCTACTTTTATTTTTACATAAT 25857 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHL047C | 8358 | 8358 | Insertion | G | |
A single nucleotide was inserted within the ORF ARN2/YHL047C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids shorter.
New 8341 TAAATCTTTCTTATGACCTGCCTAAGGCCTTTGCAAAACGTTTCGCGATCCAGTCATTGA 8400 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Old 8340 TAAATCTTTCTTATGACCT-CCTAAGGCCTTTGCAAAACGTTTCGCGATCCAGTCATTGA 8398 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR056C, YHR056W-A | 217753 | 217753 | Substitution | G | T |
A single nucleotide substitution within the coding region of YHR056W-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 116 is now Cysteine rather than Glycine. This nucleotide change also altered the DNA sequence, but not the amino acid sequence, of overlapping ORF RSC30/YHR056C.
New 217731 CAATTCCCACATATCGGTTTTGCCCTGTCGCACCCGATCTTTCTCTTCCTGCATTGGGTG 217790 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 217733 CAATTCCCACATATCGGTTTGGCCCTGTCGCACCCGATCTTTCTCTTCCTGCATTGGGTG 217792 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR072W | 240687 | 240687 | Substitution | G | A |
A single nucleotide substitution within the coding region of ERG7/YHR072W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 530 is now Asparagine rather than Aspartic Acid.
New 240651 AATGGAAACCTTGAATCCTGCTGAAGTTTTTGGTAACATAATGGTAGAATACCCATACGT 240710 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 240653 AATGGAAACCTTGAATCCTGCTGAAGTTTTTGGTGACATAATGGTAGAATACCCATACGT 240712 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR197W | 496180 | 496180 | Substitution | G | A |
A single nucleotide substitution within the coding region of RIX1/YHR197W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 762 is now Glutamic Acid rather than Glycine.
New 496127 GTTTGAAATTCCCGCTATCGAATTAAGTGATGACGAAGAGGAGGAGGAAGAAGAAGAATA 496186 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Old 496127 GTTTGAAATTCCCGCTATCGAATTAAGTGATGACGAAGAGGAGGAGGAAGAAGGAGAATA 496186 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHL040C, YHL041W | 18567 | 18567 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs YHL041W and ARN1/YHL040C.
New 18541 CTATCTCTTTACAAGCTGAATGGAATGGGGCTTAGCCGACTGGAAGGATAGGCTTGCCAA 18600 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old 18539 CTATCTCTTTACAAGCTGAATGGAATGGG-CTTAGCCGACTGGAAGGATAGGCTTGCCAA 18597 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | TEL08L-YP, YHL050C | 2251 | 2251 | Insertion | C | |
A single nucleotide insertion was made in the left telomere of chromosome 8, specifically within Y' element TEL08L-YP and the intron of overlapping ORF YHL050C.
New 2221 CTTAATTGGTGGCAATTCACCCTTACGATTCCTTGCGGCCCAACTGTTTTTTCTAGATAA 2280 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old 2221 CTTAATTGGTGGCAATTCACCCTTACGATTC-TTGCGGCCCAACTGTTTTTTCTAGATAA 2279 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR095W, YHR096C | 294437 | 294437 | Deletion | A | |
A single nucleotide deletion was made in the intergenic region between ORFs YHR095W and HXT5/YHR096C.
New 294409 ATCCTACTTAAAATAAAGAAAAAAAA-CAAAAACGTCATGATGATTTTGATATTATTAGA 294467 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 294411 ATCCTACTTAAAATAAAGAAAAAAAAACAAAAACGTCATGATGATTTTGATATTATTAGA 294470 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR009C, YHR010W | 126326 | 126326 | Insertion | C | |
A single nucleotide insertion was made in the intergenic region between ORFs YHR009C and RPL27A/YHR010W.
New 126300 GAACTGTCTGAGACAAAGTCTTTCCAGCAGAGCTCCGCCTACGCTCTTGCTGCAGAGATT 126359 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Old 126295 GAACTGTCTGAGACAAAGTCTTTCCAGCAGAG-TCCGCCTACGCTCTTGCTGCAGAGATT 126353 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR013C, YHR014W | 131454 | 131454 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs ARD1/YHR013C and SPO13/YHR014W.
New 131450 TGACGAAGTTTTATTTTGGAGCTTGATCGTATGTATTTAGGTTTCCCTTTTCACTTGGCAATTACTCGTT 131519 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 131444 TGACGAAGTTT-ATTTTGGAGCTTGATCGTATGTATTTAGGTTTCCCTTTTCACTTGGCAATTACTCGTT 131512 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHL023C, tH(GUG)H | 62687 | 62687 | Substitution | G | A |
A single nucleotide substitution was made in the intergenic region between ORF NPR3/YHL023C and tRNA tH(GUG)H.
New 62640 CTATGTTTAATGGTATTTCAAGATATCACAAGCGAAAAAGTTACTTAAGAAAAAAGACTA 62699 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 62638 CTATGTTTAATGGTATTTCAAGATATCACAAGCGAAAAAGTTACTTAAGGAAAAAGACTA 62697 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHL012W, YHL013C | 78734 | 78734 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs OTU2/YHL013C and YHL012W.
New 78720 ATTAAAAAAAGAATGCAGGAATAGCACCTTATAGTAAAAAAAGTAAATTTAAGTAATTAA 78779 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 78717 ATTAAAAAAAGAATGCAG-AATAGCACCTTATAGTAAAAAAAGTAAATTTAAGTAATTAA 78775 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | ARS805 | 64392 | 64392 | Insertion | A | |
A single nucleotide insertion was made within ARS805.
New 64380 AACATTAAAAAAAAAATTGTCACTACACAGAGAGAAAATAAATAAATATAAAGAATCACA 64439 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 64378 AACATTAAAAAAAAA-TTGTCACTACACAGAGAGAAAATAAATAAATATAAAGAATCACA 64436 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR132C, YHR132W-A | 369889 | 369889 | Insertion | A | |
369987 | 369987 | Deletion | T | |||
A single nucleotide insertion and a single nucleotide deletion were made in the intergenic region between ORFs ECM14/YHR132C and IGO2/YHR132W-A.
New 369838 GTCTTTTAAACCGTCGAAAATATTTTATCCTTCCTTCCATTTAGTTGGAACCATTTTCTA 369897 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 369841 GTCTTTTAAACCGTCGAAAATATTTTATCCTTCCTTCCATTTAGTTGGA-CCATTTTCTA 369899 New 369948 TGATCTTTTAAATTACAGGTTATCGCGGGAGAATATT-GGGGTTCAGAAATACAACACAT 370006 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 369950 TGATCTTTTAAATTACAGGTTATCGCGGGAGAATATTTGGGGTTCAGAAATACAACACAT 370009 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | RUF5-1, YHR052W | 212258 | 212258 | Deletion | A | |
212270 | 212276 | Deletion | TTTTTTT | |||
A single nucleotide deletion and a heptanucleotide deletion were made in the intergenic region between ORF YHR052W and ncRNA RUF5-1.
New 212229 ACGTTCTCATAATACATTTTAGGATTAATACATAT-GCTTTTTTTTT-------ATTCGAAATCT 212285 ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| Old 212223 ACGTTCTCATAATACATTTTAGGATTAATACATATAGCTTTTTTTTTTTTTTTTATTCGAAATCT 212287 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR170W, YHR171W | 445615 | 445615 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between NMD3/YHR170W and ATG7/YHR171W.
New 445607 CCGGCACGGCAAAACAAAAAAATTAAGGGAACTCATTATTTTACGATGCTACTTAGATAA 445666 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Old 445608 CCGGCACG-CAAAACAAAAAAATTAAGGGAACTCATTATTTTACGATGCTACTTAGATAA 445666 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR162W, YHR163W | 423723 | 423723 | Insertion | C | |
A single nucleotide insertion was made in the intergenic region between ORFs YHR162W and SOL3/YHR163W.
New 423707 CCCTGGTCCGCGACCAAATGGTGACAGTCGGTGTGTTTTCTGAGAGGGCTAGTTTGACCC 423766 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 423710 CCCTGGTCCGCGAC-AAATGGTGACAGTCGGTGTGTTTTCTGAGAGGGCTAGTTTGACCC 423768 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHL002W, YHL003C | 102564 | 102564 | Insertion | C | |
A single nucleotide insertion was made in the intergenic region between ORFs LAG1/YHL003C and HSE1/YHL002W.
New 102540 ATTCTAACTGTTAAATATAGGGGCCATGCCAGAGGCAATGCGTAAATCTATCTAAGGAAA 102599 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old 102536 ATTCTAACTGTTAAATATAGGGGCCATGC-AGAGGCAATGCGTAAATCTATCTAAGGAAA 102594 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2005-11-08 | YHL026C | 54135 | 54135 | Insertion | G | |
Based on the automated comparison of closely related Saccharomyces species, Cliften et al. suggest that the start site for YHL026C be moved 141 nt upstream. SGD confirmed the insertion of a single G nt between the G at 54135 and the T at 54136. As a consequence of this sequence change, YHL026C will be extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 268 to 315 amino acids.
New: ATGGAATTTCTGAACCCGGTCGGGGTCGCTGGCGCTGGCTCTGAGGATTTCATATATGTG |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Old: 54112 ATGGAATTTCTGAACCCGGTCGGG-TCGCTGGCGCTGGCTCTGAGGATTTCATATATGTG 54170 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. | ||||||
2004-07-26 | YHR131C, YHR131W-A | 367891 | 367891 | Insertion | C | |
The work of Kellis et al. proposed an insertion that would extend the YHR131C reading frame. This sequence error was confirmed in S288C by SGD. As a consequence of this change, YHR131C was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 840 to 850 amino acids. In addition, YHR131W-A was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 115 to 81 amino acids.
New: TAATTTGCCCTCTATTGGCAGAGCCATCCTTAACAAACGAACAACTTGTATGCACGATGT |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Old: 367868 TAATTTGCCCTCTATTGGCAGAGC-ATCCTTAACAAACGAACAACTTGTATGCACGATGT 367926 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-07-26 | YHL006C | 98461 | 98461 | Insertion | C | |
Kellis et al. predicted and confirmed the insertion of a single C nt. As a consequence of this sequence change, YHL006C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 159 to 150 amino acids.
New: 98439 GCCGTAACACAAGGCTAAGTAGCCGCAGCTGTTGCGGTCCATCTTGTGTCGCGGTGAGAT 98498 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old: 98439 GCCGTAACACAAGGCTAAGTAGC-GCAGCTGTTGCGGTCCATCTTGTGTCGCGGTGAGAT 98497 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-02-01 | YHR176W | 455503 | 455503 | Insertion | C | |
455307 | 455307 | Insertion | G | |||
Based on the comparison of related fungi, Brachat et al. suggested that the C-terminus of Fmo1p/YHR176Wp be extended at the C-Terminus. Zhang and Robertus resequenced this gene (in 2 S288C derived strains, X2180 and TR2), confirming the insertion of two nucleotides. As a consequence of these sequence changes, FMO1/YHR176W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 373 to 432 amino acids.
New: 455286 GGAACGCACAACTTCCCAAAGGGAAAGGACCTGGAATACTATGCAGAACTACAGGAACTA 455345 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old: 455286 GGAACGCACAACTTCCCAAAGG-AAAGGACCTGGAATACTATGCAGAACTACAGGAACTA 455344 New: 455346 CTGAATAGCATTCCACGTAGGGTCGGTCATTTCGAACCAGTTGTATGGGATGATAGACTG 455405 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old: 455345 CTGAATAGCATTCCACGTAGGGTCGGTCATTTCGAACCAGTTGTATGGGATGATAGACTG 455404 New: 455406 ATCGATCTAAGAAACAGTAGTTATACAGACAAAGAAGAAAGAAATGTGCTTCTAGCGGAA 455465 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old: 455405 ATCGATCTAAGAAACAGTAGTTATACAGACAAAGAAGAAAGAAATGTGCTTCTAGCGGAA 455464 New: 455466 CACGCACAAGCCCTAAAGAAAAAAAAAGCACCATACTTCCTTCCGGCGCCACATACTTAA 455525 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old: 455465 CACGCACAAGCCCTAAAGAAAAAAAAAGCACCATACTTC-TTCCGGCGCCACATACTTAA 455523 Zhang M and Robertus JD (2002) Molecular cloning and characterization of a full-length flavin-dependent monooxygenase from yeast. Arch Biochem Biophys 403(2):277-83. | ||||||
2004-07-26 | YHR056C, YHR056W-A | 217751 | 217751 | Deletion | T | |
Based on the automated comparison of related fungi, Cliften et al. and Brachat et al. both suggest that the start site for RSC30/YHR056C be moved 155 nt upstream. Based on experimental evidence, Angus-Hill et al. proposed the deletion of a single T nt upstream of RSC30/YHR056C, allowing a 51 amino acid N-terminal extension. This sequence change was confirmed in S288c by SGD. As a consequence of this sequence change, two ORFs were extended: (1) RSC30/YHR056C was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 832 to 883 amino acids; (2) YHR056W-A was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 143 to 144 amino acids.
New: 217704 AAAACAGTCCGGCTTGTTATACTTGACGCAATTCCCACATATCGGTTT-GGCCCTGTCGC 217762 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old: 217704 AAAACAGTCCGGCTTGTTATACTTGACGCAATTCCCACATATCGGTTTTGGCCCTGTCGC 217763 Angus-Hill ML, et al. (2001) A Rsc3/Rsc30 zinc cluster dimer reveals novel roles for the chromatin remodeler RSC in gene expression and cell cycle control. Mol Cell 7(4):741-51. |