Chromosome VIII History

This page lists all sequence and annotation changes that have been made to the Chromosome VIII systematic reference sequence since its intial release on 1996-07-31.

• The sequence of Chromosome VII has been updated 33 times, affecting 40 features.
  
• The annotation of Chromosome VII has been updated 24 times, affecting 69 features.
  
• Current and past versions can be obtained from SGD's Downloads.

Sequence Changes

Date	Affected Features	Start Coordinate of Change	End Coordinate of Change	Type of Change	Old Sequence	New Sequence
2011-02-03	ARS814, YHR092C	287178	287178	Insertion		C
		287123	287123	Deletion	C
		287116	287116	Deletion	G
	One single nucleotide was inserted, and two single nucleotides deleted, within the ORF HXT4/YHR092C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 16 amino acids longer. The two nucleotide deletions also alter the sequence of the overlapping ARS814. New 287091 CCGAACATCTTCTTGTAAAATGG-TTGATC-ATCATGCATTAGATCATCAGCGTTGTAGT 287148 ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| Old 287093 CCGAACATCTTCTTGTAAAATGGGTTGATCCATCATGCATTAGATCATCAGCGTTGTAGT 287152 New 287149 CAGTACCTCTCTTGTTTGGTGGAACCCAAGAAGGTGATTTCCATGGCAAAACACCTTCTT 287208 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 287153 CAGTACCTCTCTTGTTTGGTGGAACC-AAGAAGGTGATTTCCATGGCAAAACACCTTCTT 287211 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YHR049C-A	207353	207353	Deletion	A
	A single nucleotide was deleted near the middle of ORF YHR049C-A, altering its coding sequence. The start remains the same, but the C-terminal half of the protein sequence has changed and the annotated protein is now five amino acids shorter. New 207360 GTGCTGCTAA-CCCCGCCCGGCGCGAAAAATCCACCCGGGGTGCTTTAGCGTGGCTTACGAAGACCTTTT 207418 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 207353 GTGCTGCTAAACCCCGCCCGGCGCGAAAAATCCACCCGGGGTGCTTTAGCGTGGCTTACGAAGACCTTTT 207412 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YHR095W	293374	293374	Insertion		C
	A single C nucleotide was inserted within ORF YHR095W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 20 amino acids longer. New 293329 TACGTTTTTGCAAGCAAAAATGAAGATAATCCGAGCGCATGCGCAAGTAGTCCCTGCCAT 293388 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 293332 TACGTTTTTGCAAGCAAAAATGAAGATAATCCGAGCGCATGCG-AAGTAGTCCCTGCCAT 293390 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YHR168W	441869	441869	Insertion		G
	A single G nucleotide was inserted very near the 3' end of ORF MTG2/YHR168W, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 19 amino acids longer. New 441827 GTCAGGAATGGGACTGTGTTCCGATAAGCGCCCTCAGAGAGGAAAACATAGATGTGTTAA 441886 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 441829 GTCAGGAATGGGACTGTGTTCCGATAAGCGCCCTCAGAGAG-AAAACATAGATGTGTTAA 441887 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text