Chromosome VIII History
This page lists all sequence and annotation changes that have been made to the Chromosome VIII systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome VII has been updated 33 times, affecting 40 features.
- The annotation of Chromosome VII has been updated 24 times, affecting 69 features.
- Current and past versions can be obtained from SGD's Downloads.
Contents
[hide]Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | ARS814, YHR092C | 287178 | 287178 | Insertion | C | |
287123 | 287123 | Deletion | C | |||
287116 | 287116 | Deletion | G | |||
One single nucleotide was inserted, and two single nucleotides deleted, within the ORF HXT4/YHR092C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 16 amino acids longer. The two nucleotide deletions also alter the sequence of the overlapping ARS814.
New 287091 CCGAACATCTTCTTGTAAAATGG-TTGATC-ATCATGCATTAGATCATCAGCGTTGTAGT 287148 ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| Old 287093 CCGAACATCTTCTTGTAAAATGGGTTGATCCATCATGCATTAGATCATCAGCGTTGTAGT 287152 New 287149 CAGTACCTCTCTTGTTTGGTGGAACCCAAGAAGGTGATTTCCATGGCAAAACACCTTCTT 287208 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 287153 CAGTACCTCTCTTGTTTGGTGGAACC-AAGAAGGTGATTTCCATGGCAAAACACCTTCTT 287211 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR049C-A | 207353 | 207353 | Deletion | A | |
A single nucleotide was deleted near the middle of ORF YHR049C-A, altering its coding sequence. The start remains the same, but the C-terminal half of the protein sequence has changed and the annotated protein is now five amino acids shorter.
New 207360 GTGCTGCTAA-CCCCGCCCGGCGCGAAAAATCCACCCGGGGTGCTTTAGCGTGGCTTACGAAGACCTTTT 207418 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 207353 GTGCTGCTAAACCCCGCCCGGCGCGAAAAATCCACCCGGGGTGCTTTAGCGTGGCTTACGAAGACCTTTT 207412 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR095W | 293374 | 293374 | Insertion | C | |
A single C nucleotide was inserted within ORF YHR095W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 20 amino acids longer.
New 293329 TACGTTTTTGCAAGCAAAAATGAAGATAATCCGAGCGCATGCGCAAGTAGTCCCTGCCAT 293388 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 293332 TACGTTTTTGCAAGCAAAAATGAAGATAATCCGAGCGCATGCG-AAGTAGTCCCTGCCAT 293390 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR168W | 441869 | 441869 | Insertion | G | |
A single G nucleotide was inserted very near the 3' end of ORF MTG2/YHR168W, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 19 amino acids longer.
New 441827 GTCAGGAATGGGACTGTGTTCCGATAAGCGCCCTCAGAGAGGAAAACATAGATGTGTTAA 441886 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 441829 GTCAGGAATGGGACTGTGTTCCGATAAGCGCCCTCAGAGAG-AAAACATAGATGTGTTAA 441887 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. |