Chromosome XIII History
This page lists all sequence and annotation changes that have been made to the Chromosome XIII systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome XIII has been updated 13 times, affecting 16 features.
- The annotation of Chromosome XIII has been updated 32 times, affecting 70 features.
- Current and past versions can be obtained from SGD's Download site.
Contents
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YMR290W-A | 851740 | 851740 | Substitution | G | A |
851734 | 851734 | Substitution | G | A | ||
Nucleotide change(s) in the coding region of YMR290W-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 105-107 are now KKK rather than RKR.
New 851700 TAAAGCTAATATTGAAAAAAAAAAAAAAAAAAAAAAGAAAAAGCAAATAAAAAATTTTCA 851759 ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| Old 851699 TAAAGCTAATATTGAAAAAAAAAAAAAAAAAAAAAGGAAAAGGCAAATAAAAAATTTTCA 851758 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YMR299C | 864682 | 864682 | Substitution | G | T |
Nucleotide change(s) in the coding region of DYN3/YMR299C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 223 is now Lysine rather than Threonine.
New 864660 TCGGTATTAATATCTCACTGCGTTTGACCATTTCAATATGATCTTTCATATCTCTATCTT 864719 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old 864659 TCGGTATTAATATCTCACTGCGTGTGACCATTTCAATATGATCTTTCATATCTCTATCTT 864718 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YMR317W | 908172 | 908183 | Substitution | TCAGTGAGTTCG | GTAATTAGTTCA |
908194 | 908201 | Substitution | CGTCAACA | GGGCAACG | ||
908216 | 125495 | 908216 | T | C | ||
Nucleotide change(s) in the coding region of YMR317W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 271-279 are now VISSEASWA rather than SVSSEASSS.
New 908160 CGGCAACGTCTAGCGTAATTAGTTCAGAAGCTTCATGGGCAACGTCTAGCTCAGTGAGCTCGGAAGCTCC 908229 |||||||||||||| | | ||||| |||||||||| | |||| |||||||||||||| ||||||||||| Old 908158 CGGCAACGTCTAGCTCAGTGAGTTCGGAAGCTTCATCGTCAACATCTAGCTCAGTGAGTTCGGAAGCTCC 908227 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YMR262W | 794225 | 794225 | Substitution | G | C |
Nucleotide change(s) in the coding region of YMR262W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 167 is now Cysteine rather than Tryptophan.
New 794220 ATTTTGCCGACTGGCAAGGCACACAAGCAAGCCCATCTCTATACACGATGTAAAGTGCCA 794279 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 794219 ATTTTGGCGACTGGCAAGGCACACAAGCAAGCCCATCTCTATACACGATGTAAAGTGCCA 794278 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YMR008C, YMR009W | 283468 | 283468 | Insertion | G | |
A single nucleotide was inserted in the intergenic region between ORFs PLB1/YMR008C and ADI1/YMR009W.
New 283440 GAAATATCGGAGTCTTGCTATTGTTCAGGGCTTTGCCGGTGCGTAAATAATAGGCTGAAG 283499 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old 283440 GAAATATCGGAGTCTTGCTATTGTTCAGG-CTTTGCCGGTGCGTAAATAATAGGCTGAAG 283498 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YML131W, YML132W | 9542 | 9542 | Deletion | T | |
A single nucleotide was deleted from the intergenic region between ORFs COS3/YML132W and YML131W.
New 9531 TTTTTTTTTTT-GCCTTCTTCATACTTTTACTCCTGCTTTTATTACTCTAAATTTCATTTTTATTTATTC 9599 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 9531 TTTTTTTTTTTTGCCTTCTTCATACTTTTACTCCTGCTTTTATTACTCTAAATTTCATTTTTATTTATTC 9600 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YMRCtau3, YMRWdelta20 | 808976 | 808976 | Substitution | A | T |
A single nucleotide substitution was made in the intergenic region between LTRs YMRCtau3 and YMRWdelta20.
New 808920 TGATTTGCGCAACGCAGATACAGATTTTACTTTATTCTTCGTGCCTAAAATGGACCATCGTTTCACTTAC 808989 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 808919 TGATTTGCGCAACGCAGATACAGATTTTACTTTATTCTTCGTGCCTAAAATGGACCAACGTTTCACTTAC 808988 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YML121W, YML122C | 26602 | 26602 | Insertion | T | |
A single nucleotide was inserted in the intergenic region between ORFs YML122C and GTR1/YML121W.
New 26580 TTTTATTGAATCTTTTTTTTTTTGTAAGAAAATTAAGGTTTATTAGGCAGAGTATACCGA 26639 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 26581 TTTTATTGAATCTTTTTTTTTT-GTAAGAAAATTAAGGTTTATTAGGCAGAGTATACCGA 26639 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YMR315W-A, YMR316W | 904639 | 904639 | Insertion | G | |
A single nucleotide was inserted in the intergenic region between ORFs YMR315W-A and DIA1/YMR316W.
New 904620 TTCTTTTTTTTGGCGCAGCAAGGGACAATGGTCCCTTTTTGAGAAAATGTTGTAGGCTTG 904679 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 904619 TTCTTTTTTTTGGCGCAGCAA-GGACAATGGTCCCTTTTTGAGAAAATGTTGTAGGCTTG 904677 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2004-02-28 | YMR268W-A, YMR269W | 804684 | 804684 | Deletion | C | |
Deleted C at 804684 and moved YMR269W start 208 bp upstream from 804663 (old YMR269W start) to 804455 (YMR268W-A start) based on Brachat et al. 2003. This resulted in the merge of YMR268W-A, which was added in June 2003 based on Kessler et al. 2003, into YMR269W. As a result of this sequence correction and locus merge, the YMR269W protein increases in size from 142 amino acids to 211 amino acids, and YMR268W-A is no longer considered a separate ORF.
New: 181 AACCTGGATGTAAGCACTGATTCGAATAATGGCAGTATTAAATTTACTC-AAAATGAGGC 239 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old: 804635 AACCTGGATGTAAGCACTGATTCGAATAATGGCAGTATTAAATTTACTCCAAAATGAGGC 804694 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. |