Chromosome XII History
This page lists all sequence and annotation changes that have been made to the Chromosome XII systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome XII has been updated 28 times, affecting 34 features.
- The annotation of Chromosome XII has been updated 38 times, affecting 94 features.
- Current and past versions can be obtained from SGD's Download site.
Contents
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YLR407W | 933639 | 933639 | Insertion | G | |
A single G nucleotide was inserted within the ORF YLR407W near its 3' end, altering its coding sequence. The start and vast majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now one amino acid shorter.
New 933597 AATGCAGGCTGGACGGAAACGAGAAAGTGGGCTAATGCTGCCAAGGGCATGCCATGACTG 933656 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 933596 AATGCAGGCTGGACGGAAACGAGAAAGTGGGCTAATGCTGCCAA-GGCATGCCATGACTG 933654 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR402W | 924691 | 924691 | Insertion | G | |
A single G nucleotide was inserted within the ORF YLR402W near its 5' end, necessitating a change in annotation to a downstream start codon. The sequence change makes the longer version of the protein no longer possible in the reference sequence. The stop and reading frame remain the same, but the annotated protein is now 108 amino acids shorter, less than half its original size.
New: 924657 TTAAGTCTCTTCATCCCGTGTACTATTACCCGACAGGTTTCTGCGGCATGTTCTGTGGAA 924716 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old: 924657 TTAAGTCTCTTCATCCCGTGTACTATTACCCGACA-GTTTCTGCGGCATGTTCTGTGGAA 924715 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLL054C | 32902 | 32902 | Insertion | A | |
A single nucleotide was inserted very near the 3' end of ORF YLL054C, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 74 amino acids longer.
New 32881 AATTGTGGATTGTTTAATTTTGATGTGAACGAAAAGGACTTATCCCTTCCCATACCCCAT 32940 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 32881 AATTGTGGATTGTTTAATTTTG-TGTGAACGAAAAGGACTTATCCCTTCCCATACCCCAT 32939 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR313C | 760764 | 760764 | Insertion | CC | |
A GG dinucleotide was inserted within the ORF SPH1/YLR313C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 131 amino acids shorter.
New 760738 CTTGAACATCATTCAAAATGCCCTGCCTGCCATAGGAAGAACAACCATTGATTTACTCTC 760797 ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 760740 CTTGAACATCATTCAAAATGCCCTG--TGCCATAGGAAGAACAACCATTGATTTACTCTC 760797 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR314C | 762846 | 762846 | Substitution | A | T |
Nucleotide change(s) in the coding region of CDC3/YLR314C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 431 is now Glutamine rather than Leucine.
New 762828 TGTAAAGTTTTTTCTTCTTGTTGTTTAGATATTGGATCGAACTCTTTGAAAACTGAATTATCTTGCTTAA 762897 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Old 762828 TGTAAAGTTTTTTCTTCTAGTTGTTTAGATATTGGATCGAACTCTTTGAAAACTGAATTATCTTGCTTAA 762897 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR318W | 767026 | 767027 | Substitution | TC | CT |
Nucleotide change(s) in the coding region of EST2/YLR318W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 162 is now Alanine rather than Valine.
New 766978 AAATCGTGGGTAACAGATGTAACGAACCTCATCTGCCGCCCAAATGGGCTCAACGATCATCCTCATCATC 767047 |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old 766978 AAATCGTGGGTAACAGATGTAACGAACCTCATCTGCCGCCCAAATGGGTCCAACGATCATCCTCATCATC 767047 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR024C, YLR025W | 193483 | 193483 | Substitution | A | C |
A single nucleotide substitution was made in the intergenic region between ORFs UBR2/YLR024C and SNF7/YLR025W.
New 193439 ATTGAAAGTATGAATGCGTTGATTATTGGGTTTCTCCCCACAGCTGTACATTGACGATGC 193498 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 193440 ATTGAAAGTATGAATGCGTTGATTATTGGGTTTCTCCCCACAGATGTACATTGACGATGC 193499 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR023C, YLR024C | 187423 | 187423 | Deletion | A | |
187394 | 187394 | Deletion | A | |||
Two separate single nucleotide deletions were made in the intergenic region between ORFs IZH3/YLR023C and UBR2/YLR024C.
New 187381 ACCTTATCCATCAA-CACTTTCTCCATTTCCTGCAGGGTAAAA-AGAAAAGTGAAGTCAC 187438 |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| Old 187380 ACCTTATCCATCAAACACTTTCTCCATTTCCTGCAGGGTAAAAAAGAAAAGTGAAGTCAC 187439 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR412C-A, YLR412W | 949230 | 949230 | Insertion | C | |
A single nucleotide insertion was made in the intergenic region bewteen ORFs BER1/YLR412W and YLR412C-A.
New 949197 TCATTCACTACATAGTACTTTATAACTAAACTGTAACCTTTCAGGGCATCGTAACCTGAC 949256 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 949195 TCATTCACTACATAGTACTTTATAACTAAACTGTAA-CTTTCAGGGCATCGTAACCTGAC 949253 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR346C, YLR347C | 822958 | 822958 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs YLR346C and KAP95/YLR347C.
New 822948 TCAGCAGGTGCGGCTGTGCCTTTTCACTTTCAGCTAAGATGTTTGCAAGCAAGAATTAACAGATAAGCCG 823017 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 822948 TCAGCAGGTGC-GCTGTGCCTTTTCACTTTCAGCTAAGATGTTTGCAAGCAAGAATTAACAGATAAGCCG 823016 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR451W, YLR452C | 1038769 | 1038769 | Deletion | C | |
A single nucleotide deletion was made in the intergenic region between ORFs LEU3/YLR451W and SST2/YLR452C.
New 1038716 TTTTAATGAATGAATTTGCGTTCAATCCCAAGGTTTAAAGTCCTTTTCTTTTTTTG-CGTAATGTTTACT 1038784 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 1038713 TTTTAATGAATGAATTTGCGTTCAATCCCAAGGTTTAAAGTCCTTTTCTTTTTTTGCCGTAATGTTTACT 1038782 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR449W, YLR450W | 1032533 | 1032533 | Deletion | G | |
A single nucleotide deletion was made in the intergenic region between ORFs FPR4/YLR449W and HMG2/YLR450W.
New 1032527 GTTATAGTAA-GACACTTCAGTGAGAAATTAATCTGACTTACTTTTACTTAATTGTGTTCTTTCCAAATT 1032595 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 1032523 GTTATAGTAAGGACACTTCAGTGAGAAATTAATCTGACTTACTTTTACTTAATTGTGTTCTTTCCAAATT 1032592 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR447C, YLR448W | 1028607 | 1028607 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs VMA6/YLR447C and RPL6B/YLR448W.
New 1028577 TAACCTGGACTTGCCGTGCTAAGTCGGCCTTCTAGGCTGCGCTTCCGTTCAGCATCGTTT 1028636 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 1028574 TAACCTGGACTTGCCGTGCTAAGTCGGCCTTCTA-GCTGCGCTTCCGTTCAGCATCGTTT 1028632 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. |