Chromosome XII History
This page lists all sequence and annotation changes that have been made to the Chromosome XII systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome XII has been updated 28 times, affecting 34 features.
- The annotation of Chromosome XII has been updated 38 times, affecting 94 features.
- Current and past versions can be obtained from SGD's Download site.
Contents
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YLR407W | 933639 | 933639 | Insertion | G | |
A single G nucleotide was inserted within the ORF YLR407W near its 3' end, altering its coding sequence. The start and vast majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now one amino acid shorter.
New 933597 AATGCAGGCTGGACGGAAACGAGAAAGTGGGCTAATGCTGCCAAGGGCATGCCATGACTG 933656 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 933596 AATGCAGGCTGGACGGAAACGAGAAAGTGGGCTAATGCTGCCAA-GGCATGCCATGACTG 933654 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR402W | 924691 | 924691 | Insertion | G | |
A single G nucleotide was inserted within the ORF YLR402W near its 5' end, necessitating a change in annotation to a downstream start codon. The sequence change makes the longer version of the protein no longer possible in the reference sequence. The stop and reading frame remain the same, but the annotated protein is now 108 amino acids shorter, less than half its original size.
New: 924657 TTAAGTCTCTTCATCCCGTGTACTATTACCCGACAGGTTTCTGCGGCATGTTCTGTGGAA 924716 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old: 924657 TTAAGTCTCTTCATCCCGTGTACTATTACCCGACA-GTTTCTGCGGCATGTTCTGTGGAA 924715 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLL054C | 32902 | 32902 | Insertion | A | |
A single nucleotide was inserted very near the 3' end of ORF YLL054C, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 74 amino acids longer.
New 32881 AATTGTGGATTGTTTAATTTTGATGTGAACGAAAAGGACTTATCCCTTCCCATACCCCAT 32940 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 32881 AATTGTGGATTGTTTAATTTTG-TGTGAACGAAAAGGACTTATCCCTTCCCATACCCCAT 32939 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. |