Chromosome XI History
This page lists all sequence and annotation changes that have been made to the Chromosome XI systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome XI has been updated 79 times, affecting 53 features.
- The annotation of Chromosome XI has been updated 39 times, affecting 55 features.
- Current and past versions can be obtained from SGD's Download site.
Contents
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YKL198C | 68315 | 68315 | Deletion | C | |
69325 | 69326 | Substitution | TG | CT | ||
69494 | 69494 | Deletion | G | |||
69501 | 69501 | Insertion | C | |||
Five nucleotide changes were made within the ORF PTK1/YKL198C, altering its coding sequence: one single insertion, two single deletions, and two substitutions. The start and majority of the reading frame remain the same, but a small section of the annotated protein sequence is now different, the C-terminus has changed, and the annotated protein is now 13 amino acids longer.
New 68277 GACCAAGCTGTTGACAATGTTCAGATGGTGATGCAC-TACCCTGTGCGGGGAGTGGCCAC 68335 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 68279 GACCAAGCTGTTGACAATGTTCAGATGGTGATGCACCTACCCTGTGCGGGGAGTGGCCAC 68338 New 69296 TACAAAACTTTTCTGCTAGGGCCACGCTGCGCCAGCCCGATTTTTGTATCATCGCGAACA 69355 |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Old 69299 TACAAAACTTTTCTGCTAGGGCCACGTGGCGCCAGCCCGATTTTTGTATCATCGCGAACA 69358 New 69476 TGATAAACTCCTTTG-AGCAGCGCTTGTAGAATTTCTCGGGCGTTTCATTATAGATCATA 69534 ||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| Old 69479 TGATAAACTCCTTTGGAGCAGCG-TTGTAGAATTTCTCGGGCGTTTCATTATAGATCATA 69537 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL157W | 158179 | 158179 | Deletion | G | |
A single G nucleotide was deleted within ORF APE2/YKL157W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids longer.
New 158153 CTATTACTTCGAAAGCGCAGT-GGGTTAACAGAGACCGTGATGTCGTCAACAAGTATTTG 158211 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 158158 CTATTACTTCGAAAGCGCAGTGGGGTTAACAGAGACCGTGATGTCGTCAACAAGTATTTG 158217 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR028W | 496923 | 496923 | Insertion | G | |
A single G nucleotide was inserted within the ORF SAP190/YKR028W near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 65 amino acids shorter.
New 497254 ATATCAAGCGATGAAGAAGACTCCGAAGATGAAGATGAAGAGAATGATATGGGCAATGAG 497313 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Old 496897 ATATCAAGCGATGAAGAAGACTCCGAA-ATGAAGATGAAGAGAATGATATGGGCAATGAG 496955 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL129C | 197105 | 197106 | Substitution | CG | GC |
199353 | 199353 | Insertion | T | |||
199359 | 199359 | Insertion | T | |||
199377 | 199378 | Substitution | AT | TA | ||
199368 | 199368 | Insertion | T | |||
Three nucleotides were inserted within the ORF MYO3/YKL129C, and a dinucleotide substitution was also made in the same region, altering the MYO3 coding sequence. A silent dinucleotide substitution was also made within the ORF. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
New 197091 TGTGCAGCGGTAGCTGCCAAAGATAACGGATTCACAGGTTTTTGCGAAGGGAGAGGTTGC 197150 ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 197090 TGTGCAGCGGTAGCTCGCAAAGATAACGGATTCACAGGTTTTTGCGAAGGGAGAGGTTGC 197149 New 199311 ACTAAACCAATGGTTCTCATAGCCTCTAACGTGCCTTCGTAATCTTTTACGTCATCAATT 199370 |||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| Old 199310 ACTAAACCAATGGTTCTCATAGCCTCTAACGTGCCTTCGTAATC-TTTACG-CATCAATT 199367 New 199371 GTATCTGCAGTAGTACAGCCAGCCGCAGCAGTGTAAATATATTGCTCAGGCATTTGCACA 199430 | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 199368 G-ATCTGCAGATGTACAGCCAGCCGCAGCAGTGTAAATATATTGCTCAGGCATTTGCACA 199426 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR012C | 463468 | 463468 | Substitution | G | T |
463435 | 463435 | Substitution | G | T | ||
Nucleotide change(s) in the coding region of YKR012C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 98 is now Lysine rather than Glutamine, and residue 109 is now Lysine rather than Glutamine.
New 463774 CTCTATATGTAATGTTTTTGAAACATAGACGTCGTTCAAAGGCAATGCTTTTGATCTTTG 463833 |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| Old 463417 CTCTATATGTAATGTTTTGGAAACATAGACGTCGTTCAAAGGCAATGCTTTGGATCTTTG 463476 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL134C | 190415 | 190415 | Insertion | T | |
190409 | 190409 | Insertion | T | |||
190408 | 190408 | Insertion | T | |||
190405 | 190405 | Insertion | G | |||
190404 | 190404 | Insertion | T | |||
190397 | 190397 | Insertion | A | |||
189367 | 189367 | Insertion | T | |||
189339 | 189339 | Deletion | A | |||
Six single nucleotides were inserted near the middle of ORF OCT1/YKL134C, and one nucleotide was inserted and another deleted near its 3' end, altering the OCT1 coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein is now one amino acid longer and two separate small sections of the protein sequence are now different.
New 189292 CTCGAAAAGGGCGTACCAGATTTTAGAAGCTATCGTCCTATC-AAATAAGTAGCTGTAAT 189350 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 189297 CTCGAAAAGGGCGTACCAGATTTTAGAAGCTATCGTCCTATCAAAATAAGTAGCTGTAAT 189356 New 189351 AAGTTGCCCCGTATCCAAATAAATGGCCGAATCTTCCACACCAATTACTCTGATCGTCCA 189410 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 189357 AAGTTGCCCCG-ATCCAAATAAATGGCCGAATCTTCCACACCAATTACTCTGATCGTCCA 189415 New 190371 TTAACGTCAAAATAAAATCTTGAACATCTTTCGGATTCTTTGCCATTTTACCTTCCAATT 190430 |||||||||||||||||||||| ||||||| | ||| | |||||| |||||||||||||| Old 190376 TTAACGTCAAAATAAAATCTTG-ACATCTT-C-GAT-C-TTGCCA-TTTACCTTCCAATT 190429 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR036C | 509993 | 509994 | Substitution | CG | GC |
Nucleotide change(s) in the coding region of CAF4/YKR036C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 94-95 are now QR rather than HG.
New 510334 GTTGGGTAGCGGGTATCGCTGCTCATCTAAATGAGCAAGTATTCTGAAAGTTGTTGCAGA 510393 ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 509976 GTTGGGTAGCGGGTATCCGTGCTCATCTAAATGAGCAAGTATTCTGAAAGTTGTTGCAGA 510035 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL133C | 192315 | 192316 | Substitution | AT | TA |
Nucleotide change(s) in the coding region of YKL133C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 252 is now Tyrosine rather than Isoleucine.
New 192291 TCTTTTAGAGTTTAAATGCATTTGGTAGTCAGGTTTGGATTTACCAATAAATGGTAGACC 192350 ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 192290 TCTTTTAGAGTTTAAATGCATTTGGATGTCAGGTTTGGATTTACCAATAAATGGTAGACC 192349 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL023W | 393438 | 393439 | Substitution | CG | GC |
Nucleotide change(s) in the coding region of YKL023W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 25-26 are now QQ rather than HE.
New 393754 GATGACAGTATTGATAGCCAAAAAAGATGCGTCACGGATCAGCAGGCCTACTCTAATTGG 393813 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 393397 GATGACAGTATTGATAGCCAAAAAAGATGCGTCACGGATCACGAGGCCTACTCTAATTGG 393456 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL221W | 7131 | 7132 | Substitution | CG | GC |
Nucleotide change(s) in the coding region of MCH2/YKL221W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 342 is now Alanine rather than Arginine.
New 7090 GGCCATGTGGATACCTTGTAAAAATTTGGCCACTGCGATAGCTTTTGGATTATTGGTTGG 7149 |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 7091 GGCCATGTGGATACCTTGTAAAAATTTGGCCACTGCGATACGTTTTGGATTATTGGTTGG 7150 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR090W | 610650 | 610650 | Substitution | C | G |
Nucleotide change(s) in the coding region of PXL1/YKR090W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 688 is now Serine rather than Threonine.
New 610964 CATGGAAGCTCTCTTGAAGGAAGGTATCGACAATGCTACATCAAGCAATGATAAGAACAA 611023 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 610606 CATGGAAGCTCTCTTGAAGGAAGGTATCGACAATGCTACATCAACCAATGATAAGAACAA 610665 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL101W | 253006 | 253007 | Substitution | AT | TA |
Nucleotide change(s) in the coding region of HSL1/YKL101W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1482 is now Threonine rather than Serine.
New 253354 AATGCATCTACGGTAATTACTGTAAAAAAAAGAAGCAAACATTCAAACACAAGTTCCAAT 253413 |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Old 252998 AATGCATCATCGGTAATTACTGTAAAAAAAAGAAGCAAACATTCAAACACAAGTTCCAAT 253057 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. |