Chromosome IX History
This page lists all sequence and annotation changes that have been made to the Chromosome IX systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome VII has been updated 9 times, affecting 12 features.
- The annotation of Chromosome VII has been updated 232 times, affecting 63 features.
- Current and past versions can be obtained from SGD's Download site.
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | tK(CUU)I | 300235 | 300235 | Insertion | G | |
A single nucleotide was inserted near the 3' end of tK(CUU)I, altering the coding sequence and making this tRNA one nucleotide longer.
New 300179 CGTCTCTAATGATTTAATTTTTCTATTGAATTGAAAATGGTAAAAAGATAGCCCTGTAGGGGGCTCGAAC 300248 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 300178 CGTCTCTAATGATTTAATTTTTCTATTGAATTGAAAATGGTAAAAAGATAGCCCTGTA-GGGGCTCGAAC 300246 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIL012W | 333321 | 333321 | Insertion | C | |
A single C nucleotide was inserted within the ORF YIL012W near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids shorter.
New 333299 TTGGCCTTATACGAGGCGTACTTCGCCTTGCGGGAAAAAAAATTTCTTTTGTAAGCGAGG 333358 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 333297 TTGGCCTTATACGAGGCGTACTTCG-CTTGCGGGAAAAAAAATTTCTTTTGTAAGCGAGG 333355 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIL123W | 128409 | 128409 | Insertion | CT | |
128403 | 128403 | Insertion | C | |||
Three nucleotides were inserted near the 5' end of ORF SIM1/YIL123W, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
New 128401 CTGCGGATAGCTCCGCTTCCATTGCTGTTTCATCTGCTGCCTTAGCCAAGAATGAGAAAA 128460 ||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 128401 CTG-GGATAG--CCGCTTCCATTGCTGTTTCATCTGCTGCCTTAGCCAAGAATGAGAAAA 128457 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIL083C | 203638 | 203638 | Substitution | A | C |
A single nucleotide substitution in the coding region of CAB2/YIL083C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 338 is now Serine rather than Isoleucine.
New 203631 CTCTTCAATGCTATGGTGTTTTTCATCCAAACGTACCCAATCTCCCTTTCTGTTTTCAGGGGATACGAAA 203700 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 203628 CTCTTCAATGATATGGTGTTTTTCATCCAAACGTACCCAATCTCCCTTTCTGTTTTCAGGGGATACGAAA 203697 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIR039C, YIRCdelta6 | 427189 | 427189 | Insertion | A | |
A single nucleotide was inserted in the intergenic region between YIRCdelta6 and YPS6/YIR039C.
New 427139 GGAAAAACGGCAACAGTATTTGTAAGCGCTTTCCAGTAAAATAACGAAAAAGAGAAAACTTCAGTACCAC 427208 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 427136 GGAAAAACGGCAACAGTATTTGTAAGCGCTTTCCAGTAAAATAACGAAAAAGAG-AAACTTCAGTACCAC 427204 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIL051C, YIL052C | 257479 | 257479 | Deletion | A | |
A single nucleotide was deleted in the intergenic region between ORFs RPL34B/YIL052C and MMF1/YIL051C.
New 257460 AAAGTAAAAATTCAAAAATTC-AAAAAAAAAAAAGCTGAAAGGAAAACACCCAAACAACA 257518 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 257458 AAAGTAAAAATTCAAAAATTCAAAAAAAAAAAAAGCTGAAAGGAAAACACCCAAACAACA 257517 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIR041W, YIR042C | 435029 | 435029 | Deletion | G | |
A single nucleotide was deleted in the intergenic region between PAU15/YIR041W and YIR042C.
New 434999 TGTGAGCCTTAGTAAGGTGAGAGCTACGCTTCCT-GGTTTAAATCAAAACCGAGAGCCCA 435057 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 434995 TGTGAGCCTTAGTAAGGTGAGAGCTACGCTTCCTGGGTTTAAATCAAAACCGAGAGCCCA 435054 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIL056W, tS(UGA)I | 249623 | 249623 | Deletion | T | |
A single nucleotide was deleted from the intergenic region between SUP17/tS(UGA)I and VHR1/YIL056W.
New 249601 GAAATCTTTCTACCGTCGTCTTCTC-TTTTTTTTTTTTTTACTATAAATCAATGTGCTCT 249659 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 249598 GAAATCTTTCTACCGTCGTCTTCTCTTTTTTTTTTTTTTTACTATAAATCAATGTGCTCT 249657 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. |
Annotation Changes without sequence changes
Date | Affected Features |
---|---|
2014-11-19 | ARS911, ARS912, ARS913, ARS914, ARS920, ARS922, ARS923 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome IX based on Liachko et al. 2013: ARS911, ARS912, ARS913, ARS923, ARS914, ARS920, ARS922. |
2014-11-19 | ARS909, ARS913, ARS914, ARS919, ARS922, ARS923 The chromosomal coordinates of the following ARS elements on Chromosome IX were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS909, ARS913, ARS923, ARS914, ARS919, ARS922. |
2014-11-19 | ARS907 ARS907 was added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2. |
2014-11-19 | YIR043C, YIR044C The annotations of YIR043C and YIR044C, which were previously annotated as adjacent pseudogenes, have been changed as part of SGD's genome annotation revision R64.2. They were merged into a single blocked reading frame, keeping the name YIR043C. YIR044C is being retained as an alias. |