Difference between revisions of "Chromosome XI History"
(→Annotation Changes without sequence changes) |
|||
Line 1,053: | Line 1,053: | ||
{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6" | {| border="1" style="border-collapse:collapse; width:90%" cellpadding="6" | ||
! Date !! Affected Features | ! Date !! Affected Features | ||
+ | |- | ||
+ | |2021-04-21 | ||
+ | |[https://www.yeastgenome.org/locus/S000303811 YKL104W-A]<br> | ||
+ | New ORF | ||
+ | *coordinates 245032..245286 | ||
+ | :[https://www.yeastgenome.org/reference/S000217202 He et al 2018] PMID:29897761 | ||
|- | |- | ||
| 2014-11-19 | | 2014-11-19 |
Revision as of 14:58, 21 April 2022
This page lists all sequence and annotation changes that have been made to the Chromosome XI systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome XI has been updated 79 times, affecting 53 features.
- The annotation of Chromosome XI has been updated 39 times, affecting 55 features.
- Current and past versions can be obtained from SGD's Download site.
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YKL198C | 68315 | 68315 | Deletion | C | |
69325 | 69326 | Substitution | TG | CT | ||
69494 | 69494 | Deletion | G | |||
69501 | 69501 | Insertion | C | |||
Five nucleotide changes were made within the ORF PTK1/YKL198C, altering its coding sequence: one single insertion, two single deletions, and two substitutions. The start and majority of the reading frame remain the same, but a small section of the annotated protein sequence is now different, the C-terminus has changed, and the annotated protein is now 13 amino acids longer.
New 68277 GACCAAGCTGTTGACAATGTTCAGATGGTGATGCAC-TACCCTGTGCGGGGAGTGGCCAC 68335 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 68279 GACCAAGCTGTTGACAATGTTCAGATGGTGATGCACCTACCCTGTGCGGGGAGTGGCCAC 68338 New 69296 TACAAAACTTTTCTGCTAGGGCCACGCTGCGCCAGCCCGATTTTTGTATCATCGCGAACA 69355 |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Old 69299 TACAAAACTTTTCTGCTAGGGCCACGTGGCGCCAGCCCGATTTTTGTATCATCGCGAACA 69358 New 69476 TGATAAACTCCTTTG-AGCAGCGCTTGTAGAATTTCTCGGGCGTTTCATTATAGATCATA 69534 ||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| Old 69479 TGATAAACTCCTTTGGAGCAGCG-TTGTAGAATTTCTCGGGCGTTTCATTATAGATCATA 69537 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL157W | 158179 | 158179 | Deletion | G | |
A single G nucleotide was deleted within ORF APE2/YKL157W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids longer.
New 158153 CTATTACTTCGAAAGCGCAGT-GGGTTAACAGAGACCGTGATGTCGTCAACAAGTATTTG 158211 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 158158 CTATTACTTCGAAAGCGCAGTGGGGTTAACAGAGACCGTGATGTCGTCAACAAGTATTTG 158217 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR028W | 496923 | 496923 | Insertion | G | |
A single G nucleotide was inserted within the ORF SAP190/YKR028W near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 65 amino acids shorter.
New 497254 ATATCAAGCGATGAAGAAGACTCCGAAGATGAAGATGAAGAGAATGATATGGGCAATGAG 497313 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Old 496897 ATATCAAGCGATGAAGAAGACTCCGAA-ATGAAGATGAAGAGAATGATATGGGCAATGAG 496955 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL129C | 197105 | 197106 | Substitution | CG | GC |
199353 | 199353 | Insertion | T | |||
199359 | 199359 | Insertion | T | |||
199377 | 199378 | Substitution | AT | TA | ||
199368 | 199368 | Insertion | T | |||
Three nucleotides were inserted within the ORF MYO3/YKL129C, and a dinucleotide substitution was also made in the same region, altering the MYO3 coding sequence. A silent dinucleotide substitution was also made within the ORF. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
New 197091 TGTGCAGCGGTAGCTGCCAAAGATAACGGATTCACAGGTTTTTGCGAAGGGAGAGGTTGC 197150 ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 197090 TGTGCAGCGGTAGCTCGCAAAGATAACGGATTCACAGGTTTTTGCGAAGGGAGAGGTTGC 197149 New 199311 ACTAAACCAATGGTTCTCATAGCCTCTAACGTGCCTTCGTAATCTTTTACGTCATCAATT 199370 |||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| Old 199310 ACTAAACCAATGGTTCTCATAGCCTCTAACGTGCCTTCGTAATC-TTTACG-CATCAATT 199367 New 199371 GTATCTGCAGTAGTACAGCCAGCCGCAGCAGTGTAAATATATTGCTCAGGCATTTGCACA 199430 | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 199368 G-ATCTGCAGATGTACAGCCAGCCGCAGCAGTGTAAATATATTGCTCAGGCATTTGCACA 199426 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR012C | 463468 | 463468 | Substitution | G | T |
463435 | 463435 | Substitution | G | T | ||
Nucleotide change(s) in the coding region of YKR012C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 98 is now Lysine rather than Glutamine, and residue 109 is now Lysine rather than Glutamine.
New 463774 CTCTATATGTAATGTTTTTGAAACATAGACGTCGTTCAAAGGCAATGCTTTTGATCTTTG 463833 |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| Old 463417 CTCTATATGTAATGTTTTGGAAACATAGACGTCGTTCAAAGGCAATGCTTTGGATCTTTG 463476 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL134C | 190415 | 190415 | Insertion | T | |
190409 | 190409 | Insertion | T | |||
190408 | 190408 | Insertion | T | |||
190405 | 190405 | Insertion | G | |||
190404 | 190404 | Insertion | T | |||
190397 | 190397 | Insertion | A | |||
189367 | 189367 | Insertion | T | |||
189339 | 189339 | Deletion | A | |||
Six single nucleotides were inserted near the middle of ORF OCT1/YKL134C, and one nucleotide was inserted and another deleted near its 3' end, altering the OCT1 coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein is now one amino acid longer and two separate small sections of the protein sequence are now different.
New 189292 CTCGAAAAGGGCGTACCAGATTTTAGAAGCTATCGTCCTATC-AAATAAGTAGCTGTAAT 189350 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 189297 CTCGAAAAGGGCGTACCAGATTTTAGAAGCTATCGTCCTATCAAAATAAGTAGCTGTAAT 189356 New 189351 AAGTTGCCCCGTATCCAAATAAATGGCCGAATCTTCCACACCAATTACTCTGATCGTCCA 189410 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 189357 AAGTTGCCCCG-ATCCAAATAAATGGCCGAATCTTCCACACCAATTACTCTGATCGTCCA 189415 New 190371 TTAACGTCAAAATAAAATCTTGAACATCTTTCGGATTCTTTGCCATTTTACCTTCCAATT 190430 |||||||||||||||||||||| ||||||| | ||| | |||||| |||||||||||||| Old 190376 TTAACGTCAAAATAAAATCTTG-ACATCTT-C-GAT-C-TTGCCA-TTTACCTTCCAATT 190429 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR036C | 509993 | 509994 | Substitution | CG | GC |
Nucleotide change(s) in the coding region of CAF4/YKR036C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 94-95 are now QR rather than HG.
New 510334 GTTGGGTAGCGGGTATCGCTGCTCATCTAAATGAGCAAGTATTCTGAAAGTTGTTGCAGA 510393 ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 509976 GTTGGGTAGCGGGTATCCGTGCTCATCTAAATGAGCAAGTATTCTGAAAGTTGTTGCAGA 510035 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL133C | 192315 | 192316 | Substitution | AT | TA |
Nucleotide change(s) in the coding region of YKL133C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 252 is now Tyrosine rather than Isoleucine.
New 192291 TCTTTTAGAGTTTAAATGCATTTGGTAGTCAGGTTTGGATTTACCAATAAATGGTAGACC 192350 ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 192290 TCTTTTAGAGTTTAAATGCATTTGGATGTCAGGTTTGGATTTACCAATAAATGGTAGACC 192349 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL023W | 393438 | 393439 | Substitution | CG | GC |
Nucleotide change(s) in the coding region of YKL023W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 25-26 are now QQ rather than HE.
New 393754 GATGACAGTATTGATAGCCAAAAAAGATGCGTCACGGATCAGCAGGCCTACTCTAATTGG 393813 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 393397 GATGACAGTATTGATAGCCAAAAAAGATGCGTCACGGATCACGAGGCCTACTCTAATTGG 393456 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL221W | 7131 | 7132 | Substitution | CG | GC |
Nucleotide change(s) in the coding region of MCH2/YKL221W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 342 is now Alanine rather than Arginine.
New 7090 GGCCATGTGGATACCTTGTAAAAATTTGGCCACTGCGATAGCTTTTGGATTATTGGTTGG 7149 |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 7091 GGCCATGTGGATACCTTGTAAAAATTTGGCCACTGCGATACGTTTTGGATTATTGGTTGG 7150 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR090W | 610650 | 610650 | Substitution | C | G |
Nucleotide change(s) in the coding region of PXL1/YKR090W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 688 is now Serine rather than Threonine.
New 610964 CATGGAAGCTCTCTTGAAGGAAGGTATCGACAATGCTACATCAAGCAATGATAAGAACAA 611023 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 610606 CATGGAAGCTCTCTTGAAGGAAGGTATCGACAATGCTACATCAACCAATGATAAGAACAA 610665 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL101W | 253006 | 253007 | Substitution | AT | TA |
Nucleotide change(s) in the coding region of HSL1/YKL101W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1482 is now Threonine rather than Serine.
New 253354 AATGCATCTACGGTAATTACTGTAAAAAAAAGAAGCAAACATTCAAACACAAGTTCCAAT 253413 |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Old 252998 AATGCATCATCGGTAATTACTGTAAAAAAAAGAAGCAAACATTCAAACACAAGTTCCAAT 253057 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR008W | 453012 | 453012 | Substitution | T | A |
Nucleotide change(s) in the coding region of RSC4/YKR008W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 390 is now Lysine rather than Isoleucine.
New 453334 ACTGAACCCAAACAACTTCAAAAAGTTAATAGCCAAACCGGAAACAGTGCAATCCGAAGT 453393 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old 452977 ACTGAACCCAAACAACTTCAAAAAGTTAATAGCCATACCGGAAACAGTGCAATCCGAAGT 453036 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL065C | 316656 | 316656 | Substitution | C | T |
Nucleotide change(s) in the coding region of YET1/YKL065C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 16 is now Methionine rather than Valine.
New 316964 TACGGATCCGGAATGGCAAAGGCAAAACGAAGATGAAGAGCATTACCATCTCAACAGTGA 317023 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 316608 TACGGATCCGGAATGGCAAAGGCAAAACGAAGATGAAGAGCATTACCACCTCAACAGTGA 316667 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR021W | 479596 | 479596 | Substitution | C | T |
A single nucleotide substitution was made within ORF ALY1/YKR021W. Note that the protein sequence was not affected.
New 479914 TAACTCTTTGTCACCTCATACCTTCATATCTGATTTGTTTACAAAAACATTCAGTAATAG 479973 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old 479557 TAACTCTTTGTCACCTCATACCTTCATATCTGATTTGTTCACAAAAACATTCAGTAATAG 479616 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | TEL11L, TEL11L-XC | 395 | 395 | Deletion | A | |
A single nucleotide deletion was made within TEL11L, specifically within X element core sequence TEL11L-XC.
New 361 CACATATACTTACCCTACCACTCTAATCCCACCA-CACATCACATGCCATACTCACCTTC 419 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 361 CACATATACTTACCCTACCACTCTAATCCCACCAACACATCACATGCCATACTCACCTTC 420 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR096W, YKR097W | 630275 | 630275 | Insertion | T | |
630274 | 630274 | Insertion | T | |||
630168 | 630168 | Insertion | G | |||
630159 | 630159 | Insertion | C | |||
Four nucleotides were inserted within the intergenic region between ORFs YKR096W and PCK1/YKR097W.
New 630504 GCACTTGGGCAGAGCCCCCACCCAGGGCCTTGTCGGAAAAAATCGGAATATCCCACACGA 630563 |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| Old 630146 GCACTTGGGCAGAG-CCCCACCCA-GGCCTTGTCGGAAAAAATCGGAATATCCCACACGA 630203 New 630624 TACATCTCTTTTCTTTTTTTGACTCACAATAGGAAAAAACCGAGCTTCCTTTCATCCGGC 630683 ||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| Old 630264 TACATCTCTTT-C-TTTTTTGACTCACAATAGGAAAAAACCGAGCTTCCTTTCATCCGGC 630321 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL041W, YKL042W | 359604 | 359604 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs SPC42/YKL042W and VPS24/YKL041W.
New 359914 ATCGCTTTTGACGATATAGTACTAGCAATCTGCGGTTCCAATGGAATGGCGTAAACGCAT 359973 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 359558 ATCGCTTTTGACGATATAGTACTAGCAATCTGCGGTTCCAATGGAAT-GCGTAAACGCAT 359616 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR094C | 618236 | 618237 | Substitution | GA | AG |
A dinucleotide substitution was made within the intron of ORF RPL40B/YKR094C.
New 618574 TAAACTCAGAAGCTTGCCGCAGGTAATAGTTTTTCTCAATTGCTACTTGTTTAATAAATT 618633 |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 618216 TAAACTCAGAAGCTTGCCGCGAGTAATAGTTTTTCTCAATTGCTACTTGTTTAATAAATT 618275 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL055C | 335190 | 335190 | Substitution | C | T |
A single nucleotide substitution was made within ORF OAR1/YKL055C. Note that the protein sequence was not affected.
New 335504 TGGTTCCATTTCTGCAGCTAAAACTTCTGTAAATCTGGACAGTGCGGCTTTAGAGGCGGA 335563 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 335148 TGGTTCCATTTCTGCAGCTAAAACTTCTGTAAATCTGGACAGCGCGGCTTTAGAGGCGGA 335207 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL042W, YKL043W | 357929 | 357929 | Substitution | T | C |
A single nucleotide substitution was made in the intergenic region between ORFs PHD1/YKL043W and SPC42/YKL042W.
New 358244 GCGTCGTGGTTGGTGAACCTGGTACAAAATAAATAAAAAAACACCTGCTAAAAAATATCA 358303 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 357888 GCGTCGTGGTTGGTGAACCTGGTACAAAATAAATAAAAAAATACCTGCTAAAAAATATCA 357947 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR009C, YKRCdelta8 | 457775 | 457775 | Substitution | C | T |
A single nucleotide substitution was made in the intergenic region between ORF FOX2/YKR009C and Ty1 LTR YKRCdelta8.
New 458084 CTCTTCATACATATAAATGTTGCAATAAAAATCAACTAATATCTATGTTGTCATATTGAG 458143 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 457727 CTCTTCATACATATAAATGTTGCAATAAAAATCAACTAATATCTATGTCGTCATATTGAG 457786 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL128C, YKL129C | 200382 | 200382 | Insertion | GTTTACCTTTAGTTAGAAAAGCGAT GGAGCTAGCATCTTGCTACTATATA ATAGTTGTTCAAGATCGTAGGTCTG CCTGCCGAGTGATTAGGGGAGGCTA CTGAAGTTTGTTTTAATGTACCGGT TACATTTTCTTGTACGAAAGTATAT GAAGGGGGCTTATTACTTCCAAGCC TATATTTTCTGTGGCATCGATTAGT ATAGTATAAAAGAGGGAGTGGACAT AGCGGTGAAAACTATACAAGAATAA AAAAGGAACTAAGAACCCTTTGCAT TCATATAATTTCACATATGCATTTT TTATTTTATACTCAAATGTATGTTC TCACCTAGCTTGAGAAAGCGATGAT CA | |
A 352-nucleotide insertion was made in the intergenic region between ORFs MYO3/YKL129C and PMU1/YKL128C.
New 200331 TTTCCTTTTTCGGTAAAGCTCTTCCCGAGGTTTATTATATAAATGCAAATCGATCA 200386 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 200327 TTTCCTTTTTCGGTAAAGCTCTTCCCGAGGTTTATTATATAAATGCAAATCGATCA 200382 New 200387 GTTTACCTTTAGTTAGAAAAGCGATGGAGCTAGCATCTTGCTACTATATAATAGT 200441 New 200442 TGTTCAAGATCGTAGGTCTGCCTGCCGAGTGATTAGGGGAGGCTACTGAAGTTTGTTTTA 200501 New 200502 ATGTACCGGTTACATTTTCTTGTACGAAAGTATATGAAGGGGGCTTATTACTTCCAAGCC 200561 New 200562 TATATTTTCTGTGGCATCGATTAGTATAGTATAAAAGAGGGAGTGGACATAGCGGTGAAA 200621 New 200622 ACTATACAAGAATAAAAAAGGAACTAAGAACCCTTTGCATTCATATAATTTCACATATGC 200681 New 200682 ATTTTTTATTTTATACTCAAATGTATGTTCTCACCTAGCTTGAGAAAGCGATGATCA 200738 New 200739 AAGTGAAAGGTTCAACCATTTCTCAAAGTGCTTAACACATTATTTGAAAAGAAAG 200793 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 200383 AAGTGAAAGGTTCAACCATTTCTCAAAGTGCTTAACACATTATTTGAAAAGAAAG 200437 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL104C, YKL105C | 242811 | 242811 | Substitution | T | A |
A single nucleotide substitution was made in the intergenic region between ORFs YKL105C and GFA1/YKL104C.
New 243154 AAGGAGAAGTGATAGTAGAAAGACGGATGGGAGGCTGGGGGACGAAGAGAAAGTAAAAGG 243213 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 242798 AAGGAGAAGTGATTGTAGAAAGACGGATGGGAGGCTGGGGGACGAAGAGAAAGTAAAAGG 242857 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL219W, YKL220C | 14462 | 14462 | Insertion | GG | |
12941 | 12941 | Deletion | G | |||
A single nucleotide deletion and a dinucleotide insertion were made in the intergenic region between ORFs FRE2/YKL220C and COS9/YKL219W.
New 12900 TATCCGAACAGTAAACGTTTGTCCGTAGTCATCGTGACTG-TTGACGTATTAACTGCAAG 12958 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old 12901 TATCCGAACAGTAAACGTTTGTCCGTAGTCATCGTGACTGGTTGACGTATTAACTGCAAG 12960 New 14449 CGCCCGCTTGGCGGCTTTTTCTTTCCGACTATATAAATGCAAATAGTCAGAAGTTGTAAC 14508 |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 14451 CGCCCGCTTGGC--CTTTTTCTTTCCGACTATATAAATGCAAATAGTCAGAAGTTGTAAC 14508 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL216W, YKL217W | 24801 | 24801 | Deletion | G | |
A single nucleotide deletion was made within the intergenic region between ORFs JEN1/YKL217W and URA1/YKL216W.
New 24779 TGAGGTCATTCCCTAACCTTGG-ATCCAAGTCAATCTGGTATCTTCCCACCCTAAATAGT 24837 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 24779 TGAGGTCATTCCCTAACCTTGGGATCCAAGTCAATCTGGTATCTTCCCACCCTAAATAGT 24838 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL198C, YKL201C | 67956 | 67956 | Deletion | A | |
A single nucleotide deletion was made within the intergenic region between ORFs MNN4/YKL201C and PTK1/YKL198C.
New 67918 CGTGCACCGCATCAAATTTTCTCGGAGGATTCTTTGC-GCCGGTTTTCATTTTCTTCCAC 67976 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 67919 CGTGCACCGCATCAAATTTTCTCGGAGGATTCTTTGCAGCCGGTTTTCATTTTCTTCCAC 67978 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL197C, YKL198C | 70683 | 70683 | Deletion | A | |
70487 | 70487 | Deletion | A | |||
Two separate single nucleotide deletions were made in the intergenic region between ORFs PTK1/YKL198C and PEX1/YKL197C.
New 70435 AAAAAAGCGTATAGGTGCTAAGAAGAATTAAGTATCAAAAGGTAGCAGG-CATTTATGTT 70493 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 70438 AAAAAAGCGTATAGGTGCTAAGAAGAATTAAGTATCAAAAGGTAGCAGGACATTTATGTT 70497 New 70664 TAATAAGCAACGTGC-GCCGCATTTTTTGCCCTTTAAAGGGAAACGCGCTTTGTTCTTTT 70722 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 70668 TAATAAGCAACGTGCAGCCGCATTTTTTGCCCTTTAAAGGGAAACGCGCTTTGTTCTTTT 70727 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL156W | 158690 | 158690 | Insertion | A | |
A single nucleotide insertion was made within the intron of ORF RPS27A/YKL156W.
New 158642 GCAACTGGACCAGTGAATAGAACAATACATATAGATAAGTCGCAAAAAGAAAAGAATACA 158701 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 158648 GCAACTGGACCAGTGAATAGAACAATACATATAGATAAGTCGC-AAAAGAAAAGAATACA 158706 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2008-06-03 | YKL052C | 340150 | 340150 | Substitution | A | T |
Greg Prelich's lab demonstrated a sequence error at coordinate 340150 on Chromosome XI within ASK1/YKL052C: on Watson strand the A should be a T. This is nucleotide 41 of the Crick strand ASK1/YKL052C, and changes Val14 to Asp. The error was verified in S288C-derivative strain FY4.
New: 50 ATTTCTTGATCAAGTTTTTCCAATGTTTCCTCTTTGCTTGCAGAATCCAT 1 ||||||||| |||||||||||||||||||||||||||||||||||||||| Old: 340141 ATTTCTTGAACAAGTTTTTCCAATGTTTCCTCTTTGCTTGCAGAATCCAT 340190 Prelich G (2008) | ||||||
2005-12-15 | YKL137W | 185979 | 185979 | Deletion | A | |
185988 | 185988 | Deletion | A | |||
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. (2003) suggest that the start site for YKL137W be moved 26 nt upstream. SGD has confirmed the deletion of the A at 185979 and the deletion of the A at 185988. As a consequence, YKL137W was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 103 amino acids to 111 amino acids.
New: ATGGAGCAAAACAAAGA-TCCGCAGA-TGATCTCGAAACATAGTTCTAGGCTACCTATAT ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| Old: 185962 ATGGAGCAAAACAAAGAATCCGCAGAATGATCTCGAAACATAGTTCTAGGCTACCTATAT 186021 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2005-12-15 | YKL099C | 255410 | 255410 | Insertion | A | |
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. (2003) suggest that the stop site for YKL099C be moved 19 nt upstream. SGD has confirmed the insertion of an A after the A at 255410. As a consequence, YKL099C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 256 amino acids to 250 amino acids.
New: CTAACGTTTCCGTTGTTTCTTCCATTTAAATGAAATTTTTCCTGAAGAGTCTACGATTTT ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old: 255366 CTAACGTTTCCGTTGTTTCTTCCATTTAAATGAAATTTTTCCTGA-GAGTCTACGATTTT 255424 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2005-12-14 | YKL039W | 363802 | 363802 | Insertion | G | |
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. (2003) suggest that the stop site for PTM1/YKL039W be moved 25 nt upstream. SGD has confirmed the insertion of a G after the G at 363802. As a consequence, YKL039W was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 531 amino acids to 523 amino acids.
New: AGAAGGACACGATAATGTAAATAACCATAGCCAAGGCCACGGGCCAGTGTCTCCCTCTCC ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old: 363768 AGAAGGACACGATAATGTAAATAACCATAGCCAAG-CCACGGGCCAGTGTCTCCCTCTCC 3638264 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2005-12-01 | YKR058W | 552522 | 552522 | Deletion | A | |
552426 | 552426 | Insertion | G | |||
Based on the automated comparison of related fungi, Cliften et al. (2003) and Brachat et al. (2003) suggest that the start site for GLG1/YKR058W be moved 409 nt upstream. SGD has confirmed the insertion of a G after the G at 522426 and the deletion of the A at 552522. As a consequence, YKR058W was extended at the 5' end, altering the N-terminus and increasing the size the predicted protein from 480 amino acids to 616 amino acids.
New: GCGTACTAGTGTGATGGGAATGTATAAGAAGCTGGCTATTGCCACATTGCTCTATTCCGC |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old: 552393 GCGTACTAGTGTGATGGGAATGTATAAGAAGCTG-CTATTGCCACATTGCTCTATTCCGC 552451 and New: TAGAGGAAGCAGGCAAAAAA-GGCGACATTGAAACATGC |||||||||||||||||||| |||||||||||||||||| Old: 552502 TAGAGGAAGCAGGCAAAAAAAGGCGACATTGAAACATGC 552540 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. | ||||||
2004-07-23 | YKR091W | 611279 | 611279 | Insertion | G | |
The works of Kellis et al. 2003 and Cliften et al. 2003 predicted a single nucleotide insertion upstream of SRL3/YKR091W. SGD resequenced this region and found that a single G nucleotide was necessary to correct the reference sequence. As a consequence of this change, SRL3/YKR091W was extended at the 5' end, altering the N-terminus without changing the translation frame, and increasing the size of the predicted protein from 152 to 246 amino acids.
New: 611256 GATACTGAATCTAACAGCCTTCTGGCGACGCCGGCAAGGAAATATTTCAAAACTTCAATA 611315 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Old: 611256 GATACTGAATCTAACAGCCTTCTG-CGACGCCGGCAAGGAAATATTTCAAAACTTCAATA 611314 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-07-23 | YKR087C | 603776 | 603776 | Insertion | T | |
The work of Kellis et al. 2003 predicted a single nucleotide insertion upstream of OMA1/YKR087C. SGD resequenced this region and found that a single T nucleotide after the G at chromosomal coordinate 603776 was necessary to correct the reference sequence. As a consequence of this change, OMA1/YKR087C was extended at the 5' end, altering the N-terminus without changing the translation frame for most of the protein, and increasing the size of the predicted protein from 314 to 345 amino acids.
New: 603735 CCATTATTAAATCGACGATATGAAGGACCATTGTCATAGCGGTAACATCGCGTTAACTGA 603794 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old: 603735 CCATTATTAAATCGACGATATGAAGGACCATTGTCATAGCGG-AACATCGCGTTAACTGA 603793 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-02-13 | YKL207W | 48828 | 48828 | Insertion | G | |
Brachat et al. 2003 predicted and confirmed the insertion of a single G nucleotide after the G at chromosomal coordinate 48828 in YKL207W. As a consequence of this sequence change, YKL207W was extended at the 3' end, increasing the size of the predicted protein from 260 amino acids to 282 amino acids.
New: 48774 ATTGGGTTAAACGATCAGGACATGGGTATTCAGGCCGGGATAGGTGGCCCTCAGGGCCCC 48833 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Old: 48774 ATTGGGTTAAACGATCAGGACATGGGTATTCAGGCCGGGATAGGTGGCCCTCAGG-CCCC 48832 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. | ||||||
2004-02-13 | YKL203C | 58941 | 58941 | Insertion | CCG | |
Insertion of three nucleotides was confirmed by sequencing genomic DNA from BY4743 (which is derived from S288C). This is in agreement with GenBank accession X71416, which is the sequence of YKL203C from JK9-3da. Personal communication from Vik Anand (vik@ucla.edu).
New: 58925 CCAAACCCCAGGCAGCGCCGGCAGCCAAAGGCGCCATTGCCTTCTTCACTTCGGGTTTTG 58984 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Old: 58925 CCAAACCCCAGGCAGCG---GCAGCCAAAGGCGCCATTGCCTTCTTCACTTCGGGTTTTG 58981 | ||||||
2004-02-12 | YKL033W-A | 374308 | 374308 | Insertion | G | |
Brachat et al. 2003 predicted and confirmed the insertion of a single G nucleotide after the G at chromosomal coordinate 374308 in YKL033W-A. As a consequence of this sequence change, YKL033W-A was extended at the 3' end, increasing the size of the predicted protein from 60 amino acids to 236 amino acids.
New: 374277 TGAAGATTAAATTGCAAGGGCTTCCGGGACCGGAAGCAGGAAAAAGGGTGATCGAACACT 374336 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Old: 374277 TGAAGATTAAATTGCAAGGGCTTCCGGGACCG-AAGCAGGAAAAAGGGTGATCGAACACT 374335 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. | ||||||
2004-02-11 | YKR056W | 550828 | 550828 | Insertion | A | |
Brachat et al. 2003 predicted and confirmed the insertion of a single A nucleotide after the A at chromosomal coordinate 550828 in YKR056W. As a consequence of this sequence change, YKR056W was extended in the 3' end, increasing the size of the predicted protein from 617 to 639 amino acids.
New: 550798 GAATTATTCCTAAAGCAATTAGCCGCATATAATCCAGCCAAGATTATTTACATATCGTGT 550857 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old: 550798 GAATTATTCCTAAAGCAATTAGCCGCATATA-TCCAGCCAAGATTATTTACATATCGTGT 550856 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. | ||||||
2004-02-11 | YKR099C-A, YKR100C | 638899 | 638899 | Insertion | G | |
Brachat et al. 2003 predicted and confirmed the insertion of a single G nucleotide after the G at 638899 in YKR100C. As a consequence of this sequence change, YKR099C-A was merged into YKR100C. YKR100C was extended in the 3' end, increasing the size of the predicted protein from 241 amino acids to 355 amino acids.
New: 638861 AATGTTACCATTTAAAAACGAGGATGAAGCTCTCCTTGGGTAATACGAACCAAAGTCCTG 638920 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old: 638861 AATGTTACCATTTAAAAACGAGGATGAAGCTCTCCTTGG-TAATACGAACCAAAGTCCTG 638919 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. | ||||||
2003-01-10 | YKL049C | 346324 | 346324 | Substitution | G | C |
The G inserted after the G at 346324 three days ago was changed to a C.
Old: 346321 CTGGAAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAAC 346380 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| New: 346321 CTGCAAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAAC 346380 | ||||||
2003-01-08 | YKL198C, YKL199C | 69156 | 69156 | Deletion | G | |
Due to the deletion of the G at coordinate 69156 on Chromosome XI, YKL198C and YKL199C have been merged into one single ORF - PTK1/YKL198C - encoding a protein of 649 amino acids (1950 nucleotides). The new start and stop coordinates of PTK1/YKL198C are 70219 and 68270, respectively. The names YKT9 and YKL199C are being retained as aliases. This sequence change was verified in FY1679 (S288c derivative strain) background by SGD. We thank Gerard Manning (gerard-manning@sugen.com) for reporting this sequence error on Chromosome XI to SGD.
Old: 69121 TCTTGACAGGGCTGGACAGGTCGTGTGGATCCGTGGTGGTACCAGTCTGAGATACCAAAA 69180 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| New: 69121 TCTTGACAGGGCTGGACAGGTCGTGTGGATCCGTG-TGGTACCAGTCTGAGATACCAAAA 69179 | ||||||
2003-01-07 | YKL049C | 346324 | 346324 | Insertion | G | |
Due to the insertion of a G after the G at 346324, the coordinates of CSE4/YKL049C have been changed from 346130-345717 to 346406-345717, extending the ORF from 414 bp in length to 690 bp. This sequence change was verified in FY1679 (S288c derivative strain) background by SGD. Thanks to Sam Stoler, Judith Sharp, Vivian Measday, Sue Biggins, and Kelcy Newell for reporting this sequence error on Chromosome XI to SGD.
Old: 346321 CCTG-AAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAA 346379 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| New: 346320 CCTGGAAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAA 346379 Stoler S, et al. (1995) A mutation in CSE4, an essential gene encoding a novel chromatin-associated protein in yeast, causes chromosome nondisjunction and cell cycle arrest at mitosis. Genes Dev 9(5):573-86. | ||||||
2001-05-31 | YKL201C, YKL202W | 64287 | 64287 | Substitution | T | C |
SGD received a direct notification from MIPS about the following sequence change. The nucleotide at coordinate 64287 was changed from T to C, altering translation of YKL202W by changing amino acid 157 from a Phe (TTT) to a Ser (TCT). This change also affects overlapping ORF MNN4/YKL201C. Note that this is the exact reciprocal of the sequence change made to this nucleotide on 1998-11-10.
Old: 64261 TTTTTCTTTTCTTCTTCTTCCTTCTTTTTCTTTTCCTCTTCTTCCTTCTTCTTCTTCTCC 64320 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| New: 64261 TTTTTCTTTTCTTCTTCTTCCTTCTTCTTCTTTTCCTCTTCTTCCTTCTTCTTCTTCTCC 64320 | ||||||
2011-02-03 | YKL200C, YKL201C | 66685 | 66685 | Deletion | T | |
66715 | 66715 | Deletion | T | |||
65922 | 65922 | Deletion | A | |||
66278 | 66278 | Deletion | T | |||
66298 | 66298 | Insertion | G | |||
66725 | 66725 | Deletion | T | |||
MIPS made sequence corrections in the area covering YKL200C that resulted in its subsumption into MNN4/YKL201C, which now encompasses both ORFs plus additional sequence (coordinates 67463-63927). The old coordinates for YKL200C were 67113-65917, and for YKL201C were 65546-63927.
Deletion of the A at 65922 Old: 65871 GGGCATTTGCAAGTCGAAATCGTTATCCCAAAGGGAAAGCCATTCCATTG 65940 ||||||||||||||||||||||||||||||| |||||||||||||||||| New: 65869 GGGCATTTGCAAGTCGAAATCGTTATCCCAA-GGGAAAGCCATTCCATTG 65937 Deletion of the T at 66278, insertion of a G after the G at 66298 Old: 66231 CTAACTCTTCAATTTTTTTGGAGGCATTCGAACTTGAAATCCGAAGGG-A 66299 ||||||||||||||||||||||||||| |||||||||||||||||||| | New: 66228 CTAACTCTTCAATTTTTTTGGAGGCAT-CGAACTTGAAATCCGAAGGGGA 66296 Deletion of the T at 66685, deletion of the T at 66715 Old: 66650 GTATTAAATCTTAAATCCCTTAGGAGAGCCATGCCCGTCTGGAGTTGAAT 66719 ||||||||||||||| ||||||||||||||||||||||||||||| |||| New: 66647 GTATTAAATCTTAAA-CCCTTAGGAGAGCCATGCCCGTCTGGAGT-GAAT 66714 Deletion of the T at 66725 Old: 66720 AGCTTTGGAACAATGCTTTTTTAGTTCCTTTGAGTCTTTGATTCTGTCCT 66769 ||||| |||||||||||||||||||||||||||||||||||||||||||| New: 66715 AGCTT-GGAACAATGCTTTTTTAGTTCCTTTGAGTCTTTGATTCTGTCCT 66763 Odani T, et al. (1996) Cloning and analysis of the MNN4 gene required for phosphorylation of N-linked oligosaccharides in Saccharomyces cerevisiae. Glycobiology 6(8):805-10. | ||||||
1999-03-12 | YKL201C, YKL202W | 64287 | 64287 | Substitution | C | T |
MIPS made a correction to YKL202W, that also affects overlapping ORF MNN4/YKL201C: the C at chromosomal coordinate 64287 was changed to a T.
Old: 64261 TTTTTCTTTTCTTCTTCTTCCTTCTTCTTCTTTTCCTCTTCTTCCTTCTTCTTCTTCTCC 64320 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| New: 64261 TTTTTCTTTTCTTCTTCTTCCTTCTTTTTCTTTTCCTCTTCTTCCTTCTTCTTCTTCTCC 64320 | ||||||
1999-03-12 | YKL201C | 67457 | 67457 | Insertion | T | |
65761 | 65761 | Deletion | T | |||
65689 | 65689 | Deletion | A | |||
MIPS made corrections in the area covering MNN4/YKL201C which resulted in the removal of YKL200C. MNN4/YKL201C now encompasses both ORFs plus additional sequence (coordinates 67463-63927). The old coordinates for YKL200C were 67113-65917, and for YKL201C were 65546-63927.
Deletion of the A at 65689 Old: 65651 TATAAGAATTCAAGTAATCCCTACTAGGGGCAGAAGTGACTAGCTAGACC 65700 |||||||||||||||||||||||||||||||||||||| ||||||||||| New: 65651 TATAAGAATTCAAGTAATCCCTACTAGGGGCAGAAGTG-CTAGCTAGACC 65699 Deletion of the T at 65761 Old: 65751 TATTGTTTTTTACCGTTACCGTTAATTCTTACTGTCAAGGAGTCGCTGAC 65800 |||||||||| ||||||||||||||||||||||||||||||||||||||| New: 65750 TATTGTTTTT-ACCGTTACCGTTAATTCTTACTGTCAAGGAGTCGCTGAC 65798 Insertion of a T after the T at 67457 Old: 67440 GTGAAGTTTAGATGATAT-CGCTGAAGCATAACTAATTAGTTTATTTGTG 67488 |||||||||||||||||| ||||||||||||||||||||||||||||||| New: 67434 GTGAAGTTTAGATGATATTCGCTGAAGCATAACTAATTAGTTTATTTGTG 67483 Odani T, et al. (1996) Cloning and analysis of the MNN4 gene required for phosphorylation of N-linked oligosaccharides in Saccharomyces cerevisiae. Glycobiology 6(8):805-10. | ||||||
1999-03-12 | YKL198C, YKL199C | 69101 | 69101 | Insertion | G | |
68863 | 68863 | Insertion | C | |||
MIPS made corrections in the area covering PTK1/YKL198C and YKT9/YKL199C.
Insertion of a C after the C at 68861 Old: 68819 CTAGCCAAGTGATACTCCATTCCCGGCCCCGGGCGGTAATTGC-GCGATTGCGGAATGCG 68877 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| New: 68814 CTAGCCAAGTGATACTCCATTCCCGGCCCCGGGCGGTAATTGCCGCGATTGCGGAATGCG 68873 Insertion of a G after the G at 69100 Old: 69058 TTCTTGGAGTCGTAGAACATGACCTCCGGGGGAGCATACGGCG-CGAGCCGATCATCCCT 69116 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| New: 69054 TTCTTGGAGTCGTAGAACATGACCTCCGGGGGAGCATACGGCGGCGAGCCGATCATCCCT 69113 |
Annotation Changes without sequence changes
Date | Affected Features |
---|---|
2021-04-21 | YKL104W-A New ORF
|
2014-11-19 | ARS1103, ARS1106, ARS1125 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome XI based on Liachko et al. 2013: ARS1103, ARS1125, ARS1106. |
2014-11-19 | ARS1106, ARS1120, ARS1125 The chromosomal coordinates of the following ARS elements on Chromosome XI were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1125, ARS1106, ARS1120. |
2009-05-06 | ARS1102, ARS1104, ARS1115 The following ARS elements on Chromosome XI were added to the genome annotation based on Raveendranathan et al. 2006: ARS1102, ARS1104, and ARS1115. |
2009-02-20 | YKR101W The annotated translation start of SIR1/YKR101W was moved 24 aa (72 nt) downstream based on Gallagher et al. 2009. The old chromosomal coordinates were 640106-642142, and are now 640178-642142. |
2007-09-05 | YKR005C The start of ORF YKR005C was moved upstream 303 nt from 449507 to 449810, and an intron was added at new relative coordinates 148-216, based on Miura et al. 2006. |
2007-04-04 | YKL186C MTR2/YKL186C mRNA contains an intron in the 5' untranslated region (UTR); however, Miura et al. also detected an unspliced form that was more prevalent than the spliced version. |
2007-04-04 | YKL150W MCR1/YKL150W mRNA contains an intron in the 5' untranslated region (UTR); however, Miura et al. also detected an unspliced form that was more prevalent than the spliced version. |
2006-10-03 | ARS1125, ARS1126, ARS1127 The following ARS elements on Chromosome XI were added to the genome annotation based on Nieduszynski et al. 2006: ARS1125/ARS1104.5, ARS1126/ARS1106.3, ARS1127/ARS1106.7. |
2006-09-08 | ARS1103, ARS1106, ARS1109, ARS1112, ARS1113, ARS1114, ARS1116, ARS1118, ARS1120, ARS1123 The following new ARS elements on Chromosome XI were added to SGD based on Nieduszynski et al. 2006: ARS1103, ARS1106, ARS1109, ARS1112, ARS1113, ARS1114, ARS1116, ARS1118, ARS1120, ARS1123. |
2006-05-08 | YKL168C The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., and so the start site for KKQ8/YKL168C was moved 30 nt (10 codons) downstream. |
2006-05-08 | YKR036C The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for CAF4/YKR036C was moved 48 nt (16 codons) downstream. |
2006-05-08 | YKL207W The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for YKL207W was moved 87 nt (29 codons) downstream. |
2006-03-02 | snR87 New snoRNA published by Davis and Ares. |
2005-11-17 | YKL023C-A YKL065W-A Based on genome sequence comparisons among six Saccharomyces species, Cliften et al. 2003 suggested that the following ORFs be added to the annotation of Chromosome XI: YKL065W-A and YKL023C-A. |
2005-11-03 | YKR042W The work of Zhang and Dietrich 2005 confirmed the suggestion from Kellis et al. 2003 that the start site of UTH1/YKR042W be moved 255 nt downstream from 518914 to 519169. This annotation change results in a predicted protein of 365 aa, as opposed to the previously annotated 450 aa. |
2004-10-12 | CEN11 The orientation of this centromere was reversed (from Watson to Crick) and its coordinates expanded to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. (2001) and Espelin et al. (2003). |
2004-03-08 | YKR004C, YKR004C-A The small ORF YKR004C-A was added based on Kessler et al. 2003. However, Brachat et al. 2003 demonstrated that this ORF is actually an exon of YKR004C. Based on this information, YKR004C-A has been merged into YKR004C. |
2004-02-09 | YKL157W, YKL158W In July 2003, YKL158W was mistakenly added back to SGD as an independent ORF. This annotation mistake has been corrected, and YKL158W has again been "merged" into YKL157W. |
2004-01-29 | YKR095W-A The coordinates for Exon1 and the intron have changed. The 5' end of Exon1 has been moved 210 bp downstream, and the size of the intron has been reduced from 300 bp to 75 bp. Note that there is no change to Exon2. |
2003-09-27 | YKR004C Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 5' exon for ECM9/YKR004C. Brachat et al. confirmed this intron using 5' RACE. The resulting ORF is in the same frame, but has an 85-residue extension at the N-terminus. This change was reviewed and accepted by SGD curators. |
2003-09-22 | YKR006C Based on the automated comparison of closely related Saccharomyces species by Kellis et al. 2003, the translation start site for MRPL13/YKR006C was moved 33 nt (11 codons) downstream. Evidence supporting this change includes: 1) The upstream ATG is not conserved in 3 related Saccharomyces species; 2) The reading frame is conserved only after the 2nd ATG; 3) Although the amino terminus contains a mitochondrial targeting sequence (Grohmann et al. 1994), this protein is still predicted to be targeted to the mitochondrion even if it uses the proposed start methionine (http://www.mips.biochem.mpg.de/cgi-bin/proj/medgen/mitofilter). |
2003-09-22 | YKL195W Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YKL195W be moved 72 nt (24 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-22 | YKR038C Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YKR038C be moved 105 nt (35 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Although there is an upstream ATG in S. paradoxus, an insertion causes a frame shift between this ATG and the predicted start site; 4) Sequence comparison to the nr dataset shows there is no sequence similarity between S. cerevisiae and other species between the first and second ATG; the sequence similarities begin after the 2nd ATG. |
2003-09-22 | YKR045C Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YKR045C be moved 24 nt (8 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-09 | TEL11L, TEL11R The chromosomal locations for TEL11R-TR, TEL11R-XR, TEL11R-XC, TEL11R, TEL11L-TR, TEL11L-XR, TEL11L-XC, and TEL11L were generously provided by Ed Louis and Dave Barton (University of Leicester, UK). |
2003-08-07 | YKR099C-A The chromosomal coordinates of ORF YKR099C-A were shifted 1 nucleotide downstream, from 638723-638532 to 638722-638531. Note that the sequence remains unchanged. |
2003-07-29 | YKR099C-A Thanks to MIPS for providing the coordinates of YKL158W. |
2003-07-29 | YKR095W-A Thanks to Brachat et al and Cliften et al. for providing the coordinates of YKR095W-A. |
2003-07-29 | YKL096C-B, YKL156C-A, YKR075W-A Thanks to Kumar et al. for providing the coordinates of the following Chromosome XI ORFs: YKL096C-B, YKR075W-A, and YKL156C-A. |
2003-07-29 | YKL183C-A, YKR004C-A Thanks to Kessler et al. for providing the coordinates of the following Chromosome XI ORFs: YKL183C-A and YKR004C-A. |
2003-07-29 | YKL100W-A, YKL145W-A, YKR099C-A Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XI ORFs: YKL100W-A, YKL145W-A, and YKR099C-A. |
2003-07-29 | YKL068W-A Thanks to Brachat et al. for providing the coordinates of YKL068W-A. |
2001-03-14 | YKL003W-A This ORF was initially added to SGD on 2001-02-26 based on homology (Blandin et al.), but was subsequently deleted because it is contained within DID4/YKL002W (Mark Hochstrasser, personal communication; Amerik et al.). |
2001-03-09 | snR42 Changed from W -> C: old start coord: 558652; old stop coord: 559002 new start coord: 559002; new stop coord: 558652 References: 1. Ni et al. (1996) Cell 86(5):823-834 2. snoRNA Database: http://www.bio.umass.edu/biochem/rna-sequence/Yeast_snoRNA_Database/snoRNA_DataB ase.html 3. Personal communication: Dr. Eric Steinmetz Dept. of Biomolecular Chemistry University of Wisconsin 1300 University Ave. Madison, WI 53706 |
2000-12-01 | YKL199C The start site of YKL199C was moved 276 nucleotides upstream, increasing the size of the ORF from 564 nt to 840 nt, and the size of the predicted protein from 187 amino acids to 279 aa. |
2000-08-11 | YKL096W-A Old name: YKL097W-A; new name: YKL096W-A; date: 11/1998; old coord: ChrXI 258895 259173; SGDID: S0001956; Name changed due to nomenclature. |
2000-07-22 | YKL002W The start site of YKL002W was moved 243 bp upstream, and a 68-bp intron was added at relative coordinates 61-128. |
2000-07-14 | YKL157W, YKL158W YKL157W and YKL158W were merged into a single ORF, designated YKL157W, based on evidence published by Davis et al. 2000 demonstrating the presence of an intron between these two ORFs. |
1998-05-21 | YKL033W-A, YKL053C-A, YKL162C-A The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. |