Chromosome XIV History

This page lists all sequence and annotation changes that have been made to the Chromosome XIV systematic reference sequence since its intial release on 1996-07-31.

• The sequence of Chromosome XIV has been updated 43 times, affecting 41 features.
  
• The annotation of Chromosome XIV has been updated 33 times, affecting 59 features.
  
• Current and past versions can be obtained from SGD's Download site.

Sequence Changes

Date	Affected Features	Start Coordinate of Change	End Coordinate of Change	Type of Change	Old Sequence	New Sequence
2011-02-03	YNL008C	618198	618198	Deletion	G
	A single C nucleotide was deleted within ORF YNL008C, altering its coding sequence. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 7 amino acids longer. New 618178 AAAAGCTAAATACATCTC-TGTTATGGAGCAATTGCTTAACATGTTGCAATATATTTGTA 618236 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 618180 AAAAGCTAAATACATCTCGTGTTATGGAGCAATTGCTTAACATGTTGCAATATATTTGTA 618239 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL243W	189081	189081	Substitution	CG	GC
	Nucleotide change(s) in the coding region of SLA2/YNL243W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 344 is now Alanine rather than Arginine. New 189059 ATCCCCACTGCCACTGGTGCAGCTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAG 189118 ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 189060 ATCCCCACTGCCACTGGTGCACGTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAG 189119 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL175C	307728	307728	Substitution	T	G
	Nucleotide change(s) in the coding region of NOP13/YNL175C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 296 is now Alanine rather than Glutamic Acid. New 307678 ATTCGCAATGGCCTTCCGGCAATTTTTCTACAACTTTTATCCTTTAATGCATTAGTAGAT 307737 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 307680 ATTCGCAATGGCCTTCCGGCAATTTTTCTACAACTTTTATCCTTTAATTCATTAGTAGAT 307739 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL176C	306231	306231	Substitution	C	A
	Nucleotide change(s) in the coding region of YNL176C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 251 is now Phenylalanine rather than Cysteine. New 306178 GAAAGCGATGAACTGTAAAACGATGTGGAAGTATTCCGACTGGAACTTGGGAATGTGGTA 306237 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Old 306180 GAAAGCGATGAACTGTAAAACGATGTGGAAGTATTCCGACTGGAACTTGGGCATGTGGTA 306239 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL271C	132573	132573	Substitution	T	C
	Nucleotide change(s) in the coding region of BNI1/YNL271C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 938 is now Alanine rather than Threonine. New 132539 TGGAAATATCATTACTTTCCATTTGGATTTCAGCCAAAGCCCGCCTTAGGTCATTTAGTT 132598 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 132540 TGGAAATATCATTACTTTCCATTTGGATTTCAGTCAAAGCCCGCCTTAGGTCATTTAGTT 132599 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL177C	304165	304165	Substitution	G	T
	Nucleotide change(s) in the coding region of MRPL22/YNL177C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 151 is now Leucine rather than Phenylalanine. New 304138 CTAGTACTTCAATTTCTCTTTTTGTTAACTTTAGCTTGTAACGTTCGCTAGAATTTGGTA 304197 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 304140 CTAGTACTTCAATTTCTCTTTTTGTGAACTTTAGCTTGTAACGTTCGCTAGAATTTGGTA 304199 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL193W	274732	274732	Substitution	G	C
	Nucleotide change(s) in the coding region of YNL193W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 122 is now Leucine rather than Valine. New 274679 GCAATACGTGAAAATGGATGATATGCCTGATCTTTCCAATTTGGTGTTATCTCTGCCACA 274738 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Old 274680 GCAATACGTGAAAATGGATGATATGCCTGATCTTTCCAATTTGGTGTTATCTGTGCCACA 274739 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL172W	315278	315278	Substitution	T	G
	Nucleotide change(s) in the coding region of APC1/YNL172W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1547 is now Methionine rather than Isoleucine. New 315238 CCACATCCCTTACAAGAATTGAAGCATTTCTGGAGCATGGCTGTAGAGCCTCGTTGCCTT 315297 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Old 315240 CCACATCCCTTACAAGAATTGAAGCATTTCTGGAGCATTGCTGTAGAGCCTCGTTGCCTT 315299 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL327W	25775	25775	Substitution	G	A
	Nucleotide change(s) in the coding region of EGT2/YNL327W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 577 is now Threonine rather than Alanine. New 25741 CCAGTTTATCATCCGGCCCATTTGTTTCAAACACAACGGTTGCCTCTGGGTCTTATATTC 25800 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old 25740 CCAGTTTATCATCCGGCCCATTTGTTTCAAACACAGCGGTTGCCTCTGGGTCTTATATTC 25799 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL192W	278945	278945	Substitution	T	G
	Nucleotide change(s) in the coding region of CHS1/YNL192W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 815 is now Valine rather than Phenylalanine. New 278939 TCCTAGTCTTTAGAATTCTCACTGTTTCTATTGCACTGGCATACCATTCAGCATTTAATG 278998 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 278940 TCCTATTCTTTAGAATTCTCACTGTTTCTATTGCACTGGCATACCATTCAGCATTTAATG 278999 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL186W	290429	290429	Substitution	T	G
	Nucleotide change(s) in the coding region of UBP10/YNL186W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 310 is now Glutamic Acid rather than Aspartic Acid. New 290398 GGAGAGGAGGAGGAAGAAGAGGAAGAAGAGCTGAAACATAAATCTAGGTCAATCACCCCT 290457 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old 290400 GGAGAGGAGGAGGAAGAAGAGGAAGAAGATCTGAAACATAAATCTAGGTCAATCACCCCT 290459 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL181W	299120	299120	Substitution	C	G
	Nucleotide change(s) in the coding region of YNL181W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 262 is now Alanine rather than Proline. New 299098 AAAACCAAAAGACGAATGGCGCTGAAAGAACAGGAAAAAATGTTACCATTACTATGGTTC 299157 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 299100 AAAACCAAAAGACGAATGGCCCTGAAAGAACAGGAAAAAATGTTACCATTACTATGGTTC 299159 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL271C, YNL272C	129279	129279	Deletion	A
	A single nucleotide deletion was made in the intergenic region between ORFs SEC2/YNL272C and BNI1/YNL271C. New 129240 TAAACGAGAGCCATGTTTTAAAGGTGCTTCAGCGAACGC-GAAATACAAGTTCCGGGTAG 129298 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old 129240 TAAACGAGAGCCATGTTTTAAAGGTGCTTCAGCGAACGCAGAAATACAAGTTCCGGGTAG 129299 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNR055C, YNR056C	731363	731363	Insertion		C
	A single nucleotide insertion was made in the intergenic region between ORFs HOL1/YNR055C and BIO5/YNR056C. New 731337 GTAAAATGGCTTTATGTGTTCTGATCTTATAATGAATCGTAATCGAAATCCACATATTTC 731396 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 731339 GTAAAATGGCTTTATGTGTTCTGAT-TTATAATGAATCGTAATCGAAATCCACATATTTC 731397 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNR053C	721794	721794	Insertion		A
	A single nucleotide insertion was made within the intron of ORF NOG2/YNR053C. New 721737 GACGTTCCTTTGACAAATGTTTGACCCAAGCTGCCTACTTGTAAAGTTAGAATTGAAAAAAAAAAACCTT 721806 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 721740 GACGTTCCTTTGACAAATGTTTGACCCAAGCTGCCTACTTGTAAAGTTAGAATTG-AAAAAAAAAACCTT 721808 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNR070W	766524	766524	Substitution	C	T
	A single nucleotide substitution was made within ORF PDR18/YNR070W. Note that the protein sequence was not changed. New 766497 ATTAGACTTTGCACTATTAGAGGTTTTCTAAGGATTTACGGTGATAAGTCATACACCGTT 766556 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 766498 ATTAGACTTTGCACTATTAGAGGTTTCCTAAGGATTTACGGTGATAAGTCATACACCGTT 766557 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL128W	383566	383566	Substitution	A	G
	A single nucleotide substitution was made within ORF TEP1/YNL128W. Note that the protein sequence was not changed. New 383518 CAGATTACTTTCAAGTAGAGAGGTTAAAGAGAGACGAAATGCTTGGGACAACCATAAGCT 383577 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 383520 CAGATTACTTTCAAGTAGAGAGGTTAAAGAGAGACGAAATGCTTGGAACAACCATAAGCT 383579 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL133C, tF(GAA)N	374744	374744	Substitution	T	C
		374768	374768	Substitution	A	C
		374810	374810	Substitution	A	C
	Three separate single nucleotide substitutions were made in the intergenic region between ORF FYV6/YNL133C and tRNA tF(GAA)N. New 374698 TATAACAGAGCCCACAGTCTTTTGTTGGAACCGCTTTCTCTAGGCTTCGATGGACTTACA 374757 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 374700 TATAACAGAGCCCACAGTCTTTTGTTGGAACCGCTTTCTCTAGGTTTCGATGGACTTACA 374759 New 374758 TCTAATTGCACATTCTCGTGCGTTTAAACGTCATTTTTCCCTCAGATTGGCAGTGCATCA 374817 |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| Old 374760 TCTAATTGAACATTCTCGTGCGTTTAAACGTCATTTTTCCCTCAGATTGGAAGTGCATCA 374819 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL141W, YNL142W	359024	359024	Substitution	C	T
	A single nucleotide substitution was made in the intergenic region between ORFs MEP2/YNL142W and AAH1/YNL141W. New 358978 TTATGTTTAATCTTTATGTAACGCTTCATTTAATAATTTTATTTTTAATATTTGATATAT 359037 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 358980 TTATGTTTAATCTTTATGTAACGCTTCATTTAATAATTTTATTTCTAATATTTGATATAT 359039 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL173C, YNL175C	308753	308753	Substitution	G	C
	A single nucleotide substitution was made in the intergenic region between NOP13/YNL175C and MDG1/YNL173C. New 308698 CATCTATGCTCATCGCAATTTTTTCTTTCAGACTGAAAAATTTCAGGTTTTTGCATTTCA 308757 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Old 308700 CATCTATGCTCATCGCAATTTTTTCTTTCAGACTGAAAAATTTCAGGTTTTTGGATTTCA 308759 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL327W, YNL328C	23471	23471	Insertion		C
	A single nucleotide insertion was made in the intergenic region between ORFs MDJ2/YNL328C and EGT2/YNL327W. New 23461 GGCAGTAATGCCATAACGAAGATCAATAGTGTATGGGATGTTGGATATGTCGTTTCCCTG 23520 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 23461 GGCAGTAATGC-ATAACGAAGATCAATAGTGTATGGGATGTTGGATATGTCGTTTCCCTG 23519 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL307C, YNL308C	56227	56227	Deletion	A
	A single nucleotide deletion was made in the intergenic region between ORFs KRI1/YNL308C and MCK1/YNL307C. New 56221 AAAAAAA-TTAGGAACATAAAATAAAAAATAAAGAAGAAATTGAAGGAGTGACTGGATAA 56279 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Old 56220 AAAAAAAATTAGGAACATAAAATAAAAAATAAAGAAGAAATTGAAGGAGTGACTGGATAA 56279 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL187W, YNL188W	287983	287983	Deletion	A
	A single nucleotide deletion was made in the intergenic region between ORFs KAR1/YNL188W and SWT21/YNL187W. New 287939 CGAGTATCCACGACTAGGAGAATCACCATATATCAATATGACA-GACGACTTCAGAATGG 287997 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 287940 CGAGTATCCACGACTAGGAGAATCACCATATATCAATATGACAAGACGACTTCAGAATGG 287999 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YNL192W, YNL193W	276356	276356	Substitution	A	G
	A single nucleotide substitution was made in the intergenic region between ORFs YNL193W and CHS1/YNL192W. New 276299 ATTGATTTTAATATATATCTCGGGTTCATTTTTTACGTCGGTACTCCAAAGGATCAGAACACTTACATTT 276368 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 276300 ATTGATTTTAATATATATCTCGGGTTCATTTTTTACGTCGGTACTCCAAAGGATCAAAACACTTACATTT 276369 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2010-01-05	YNL083W	472581	472581	Substitution	T	G
		472585	472585	Substitution	C	GG
	SAL1 contains a frameshift mutation (the sal1-1 allele) in certain laboratory strains, including S288C. The sal1-1 frameshift mutation results in the encoding of missense amino acids starting with the 403rd codon, and truncates the protein to 494 amino acids from its "wild-type" length in other strains of 545 amino acids. The annotation of SAL1 was altered in SGD in February 2004 away from the sal1-1 allele after sequence comparisons to related fungi (Belenkiy et al. 2000; Brachat et al. 2003). Dimitrov et al. (2009) sequenced the SAL1 gene from strains BY4716 and S288C, and discovered that these strains do both indeed contain the sal1-1 allele despite the previous annotation change in SGD. The correct annotation of SAL1 has now been reinstated in SGD. Belenkiy R, et al. (2000) The yeast mitochondrial transport proteins: new sequences and consensus residues, lack of direct relation between consensus residues and transmembrane helices, expression patterns of the transport protein genes, and protein-protein interactions with other proteins. Biochim Biophys Acta 1467(1):207-18. SGD paper | PubMed | Full-Text Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. SGD paper | PubMed | Full-Text Chen XJ (2004) Sal1p, a calcium-dependent carrier protein that suppresses an essential cellular function associated With the Aac2 isoform of ADP/ATP translocase in Saccharomyces cerevisiae. Genetics 167(2):607-17. SGD paper | PubMed | Full-Text Smith CP and Thorsness PE (2008) The Molecular Basis for Relative Physiological Functionality of the ADP/ATP Carrier Isoforms in Saccharomyces cerevisiae. Genetics 179(3):1285-99. SGD paper | PubMed | Full-Text Dimitrov LN, et al. (2009) Polymorphisms in multiple genes contribute to the spontaneous mitochondrial genome instability of Saccharomyces cerevisiae S288C strains. Genetics 183(1):365-83. SGD paper | PubMed | Full-Text
2006-11-09	YNL103W	429061	429061	Substitution	G	C
		429057	429058	Substitution	CG	GC
	The systematic sequence is being updated within the ORF YNL103W with the following three transversions: C to G at chromosomal coordinate 429057, G to C at 429058, and G to C at 429061. These are nucleotide positions 1321, 1322, and 1325 within ORF YNL103W, changing amino acids 441 and 442 from Arg-Gly to Ala-Ala. Thanks to Phil Robinson in Roger Kornberg's lab for alerting SGD to these sequencing errors. New: 1311 GGCTGAAACTGCTGCGCCAACTACCTTATCAACGTCGCCTTCGTTCAATGAGCACGGTGTAGTAGCAGAG 1380 |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old: 429047 GGCTGAAACTCGTGGGCCAACTACCTTATCAACGTCGCCTTCGTTCAATGAGCACGGTGTAGTAGCAGAG 429116
2005-11-07	YNL304W	60402	60402	Insertion		C
	Based on the automated comparison of closely related Saccharomyces species, Kellis et al. and Cliften et al. suggested that the start site for YPT11/YNL304W be moved 185 nt upstream. This change required a sequencing error in the reference strain. SGD confirmed a sequencing error in this position, and the systematic sequence has been updated accordingly. As a consequence of this sequence change, YPT11/YN304W was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 355 to 417 amino acids. New: 60367 CACCGATACGGACTAACGAATCCAATTGGGAAGCTGCTTCGCCAGCGAGTGCTGCATCTT 60426 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old: 60367 CACCGATACGGACTAACGAATCCAATTGGGAAGCTG-TTCGCCAGCGAGTGCTGCATCTT 60425 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2005-11-03	YNL299W	68349	68349	Insertion		C
	Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the stop site for TRF5/YNL299W be moved 50 nt downstream. The insertion of a single C nt was confirmed in S. cerevisiae strains BMA38, BY4741, LMA210 (Jon Houseley, personal communication) and S288C (SGD). The systematic sequence has been updated accordingly. As a consequence of this sequence change, TRF5/YNL299W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 625 to 642 amino acids. New: 68328 GATCAAAAAGGAAGAGATACCCCTTCGGGACAAGATGAGAAATCACCACTGGAAACT 68384 |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old: 68328 GATCAAAAAGGAAGAGATACCC-TTCGGGACAAGATGAGAAATCACCACTGGAAACT 68383 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata
2004-07-22	YNL064C, YNL065W	505515	505515	Insertion		C
	The work of Kellis et al. proposed an indel that would shorten the YNL065W reading frame. Sequencing of S288C by SGD confirmed the current sequence for YNL065W, but an error in the intergenic region between YNL065W and YNL064C was identified. This insertion does not affect any coding features. New: ATTAATTGGCATTCTTCAATTTGATAGACACTTATCCCTGCATATTTTTTTTATAAACAG ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old: 505479 ATTAATTGGCATTCTTCAATTTGATAGACACTTATCC-TGCATATTTTTTTTATAAACAG 505537 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata
2004-02-19	YNL208W	254767	254767	Insertion		G
		254927	254927	Insertion		G
	Kellis et al. predicted and confirmed the insertion of two nucleotides. As a consequence of this sequence change, YNL208W was shortened at the 3' end, altering the C-terminus and decreasing the predicted protein from 204 to 199 amino acids. New: AAGGTGGACACAACAACCATCACCGTCAGGACAATAACAACAATAACGGTGGATTTGGCG ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 254739 AAGGTGGACACAACAACCATCACCGTCAG-ACAATAACAACAATAACGGTGGATTTGGCG 254797 New: AAGGATTCGGTGGTCCAAATCCTCAAGAATTCGGCGGGCCAGGTGGCCAAGGATTCGGTG ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 254891 AAGGATTCGGTGGTCCAAATCCTCAAGAATTCGGCGG-CCAGGTGGCCAAGGATTCGGTG 254949 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata
2004-02-18	YNL083W	472580	472580	Substitution	G	C
		471764	471764	Substitution	G	A
		472576	472576	Substitution	G	T
		472581	472581	Deletion	G
	Brachat et al. 2003 predicted the extension of the 3' end of YNL083W based on the automated comparison of related fungi. Belenkiy et al. 2000 had previously confirmed the sequence change in strain CG379. The sequence is available in GenBank (accession number AF419344). As a consequence, YNL083W was extended in the 3' end, increasing the size of the predicted protein from 494 amino acids to 545 amino acids. This C-terminal extension is also conserved in S. bayanus, S. mikatae, S. paradoxus, and S. kluyveri. New: GAACTTAATCATGAACTTTCAAATGAAAAGATGAACAAATTCTCGAGGTTTTTTGAATGG |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 471734 GAACTTAATCATGAACTTTCAAATGAAAAGGTGAACAAATTCTCGAGGTTTTTTGAATGG 471793 New: GTGGGC-TCAGATTATTTTACAGAGGTGTCACAGTCGGTATAGTGGGCATATTTCCCTA | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 472574 GGGGGGGTCAGATTATTTTACAGAGGTGTCACAGTCGGTATAGTGGGCATATTTCCCTA 472633 Belenkiy R, et al. (2000) The yeast mitochondrial transport proteins: new sequences and consensus residues, lack of direct relation between consensus residues and transmembrane helices, expression patterns of the transport protein genes, and protein-protein interactions with other proteins. Biochim Biophys Acta 1467(1):207-18. SGD paper | PubMed | Full-Text Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. SGD paper | PubMed | Full-Text
2004-02-18	YNL195C	271649	271649	Insertion		G
	Kellis et al. predicted and confirmed the insertion of a single G nt. As a consequence of this sequence change, YNL195C was extended at the 3' end, altering the C-terminus and increasing the predicted protein from 243 to 261 amino acids. New: TTGTGCCGATCACCCACACCGTAGGCGTAGGTTTCCTTTTCCTCAGTTTCCTGATTGAAT |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 271626 TTGTGCCGATCACCCACACCGTAG-CGTAGGTTTCCTTTTCCTCAGTTTCCTGATTGAAT 271684 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata
1998-11-10	YNL180C	299726	299726	Deletion	AT
	An AT dinucleotide at chromosomal coordinates 299726-299727 within YNL180C was removed. This corresponds to relative coordinates 171-172, and causes a frameshift. The protein is now annotated as 331 amino acids in length. Old: 299701 TTGGTTTAGCTTGCTTGTTGTGATGATATTATTTGAGGCAATTTTACTACCTTTGCTTTT 299760 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| New: 299701 TTGGTTTAGCTTGCTTGTTGTGATGAT--TATTTGAGGCAATTTTACTACCTTTGCTTTT 299758
1997-07-27	YNL051W, YNL052W	532300	532300	Insertion		G
	A single G was inserted after the G at 532300 in the intergenic region between COX5A/YNL052W and COG5/YNL051W. New: 532260 ACGAAAGTGAATATCTTATTACATTATAAGTGTATCCATGGGCATCCGCCCAATACAATG 532319 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old: 532260 ACGAAAGTGAATATCTTATTACATTATAAGTGTATCCATGG-CATCCGCCCAATACAATG 532318
1997-07-27	YNL059C, YNL061W	512412	512412	Insertion		G
	A single G was inserted after the G at 512412 in the intergenic region between NOP2/YNL061W and ARP5/YNL059C. New: 512401 ACAAACGTAGTGGCATCATGTTAGCATAGTTTTCTCTCTCTAATCTTTCTCTGTCTACAT 512460 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Old: 512401 ACAAACGTAGTG-CATCATGTTAGCATAGTTTTCTCTCTCTAATCTTTCTCTGTCTACAT 512459

Annotation Changes without sequence changes

Date	Affected Features
2014-11-19	ARS1411, ARS1412, ARS1414, ARS1419, ARS1420, ARS1421, ARS1424 The chromosomal coordinates of the following ARS elements on Chromosome XIV were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1411, ARS1412, ARS1414, ARS1419, ARS1420, ARS1421, ARS1424. Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. SGD paper | PubMed | Full-Text
2014-11-19	ARS1405, ARS1406, ARS1407, ARS1411, ARS1414, ARS1415, ARS1419, ARS1420, ARS1421, ARS1422, ARS1424, ARS1426, ARS1427 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome XIV based on Liachko et al. 2013: ARS1405, ARS1406, ARS1407, ARS1411, ARS1414, ARS1415, ARS1419, ARS1420, ARS1421, ARS1422, ARS1424, ARS1426, ARS1427. Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. SGD paper | PubMed | Full-Text
2013-02-15	YNL054W-B YNL054W-B was changed from pseudogene to transposable_element_gene. It had been erroneously annotated as a pseudogene based on Kim et al. 1998 which stated that a single nucleotide insertion "would likely render [it] nonfunctional". Lawler et al. 2001 later showed that the insertion was a +1 translational frameshift. Kim JM, et al. (1998) Transposable elements and genome organization: a comprehensive survey of retrotransposons revealed by the complete Saccharomyces cerevisiae genome sequence. Genome Res 8(5):464-78. SGD paper | PubMed | Full-Text Lawler JF Jr, et al. (2001) Frameshift signal transplantation and the unambiguous analysis of mutations in the yeast retrotransposon Ty1 Gag-Pol overlap region. J Virol 75(15):6769-75. SGD paper | PubMed | Full-Text
2009-05-06	ARS1409, ARS1410, ARS1416, ARS1423, ARS1425 The following ARS elements on Chromosome XIV were added to the genome annotation based on Raveendranathan et al. 2006: ARS1409, ARS1410, ARS1416, ARS1423, and ARS1425. Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39. SGD paper | PubMed | Full-Text
2007-09-06	YNL147W The 3' end of the intron within LSM7/YNL147W was moved 24 nt upstream, from chromosomal coordinate 351079 to 351055, based on Miura et al. 2006. Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. SGD paper | PubMed | Full-Text
2007-07-09	YNL004W The start of ORF HRB1/YNL004W was moved 417 nt upstream and an intron was added at relative coordinates 31..372 based on GenBank EF123128, Juneau et al. 2007, and Zhang et al. 2007. The ORF had been annotated as 1290 nt long, but is now 1707 nt in length. Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7. SGD paper | PubMed | Full-Text Zhang Z, et al. (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9. SGD paper | PubMed | Full-Text | YFGdb
2007-04-04	YNL066W SUN4/YNL066W mRNA contains an intron in the 5' untranslated region (UTR). Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. SGD paper | PubMed | Full-Text Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7. SGD paper | PubMed | Full-Text
2006-09-07	ARS1405, ARS1406, ARS1407, ARS1415, ARS1417, ARS1419, ARS1420, ARS1421, ARS1422, ARS1424, ARS1426, ARS1427 The following new ARS elements on Chromosome XIV were added to SGD based on Nieduszynski et al. 2006: ARS1405, ARS1406, ARS1407, ARS1415, ARS1417, ARS1419, ARS1420, ARS1421, ARS1422, ARS1424, ARS1426, ARS1427. Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. SGD paper | PubMed | Full-Text | Web Supplement
2006-09-07	ARS1411, ARS1412, ARS1414 The coordinates of the following ARS elements on Chromosome XIV were updated based on Nieduszynski et al. 2006: ARS1411, ARS1412, ARS1414. Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. SGD paper | PubMed | Full-Text | Web Supplement
2006-05-10	YNL310C The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for ZIM17/YNL310C be moved 93 nt (31 amino acids) downstream. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2006-05-10	YNL202W The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for SPS19/YNL202W was moved 9 nt (3 amino acids) downstream. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2004-10-18	ARS1411, ARS1412, ARS1413, ARS1414 ARS1411, ARS1412, ARS1413, and ARS1414 were added to SGD based on Friedman et al., and Raghuraman et al. Friedman KL, et al. (1996) Multiple determinants controlling activation of yeast replication origins late in S phase. Genes Dev 10(13):1595-607. SGD paper | PubMed | Full-Text Raghuraman MK, et al. (2001) Replication dynamics of the yeast genome. Science 294(5540):115-21. SGD paper | PubMed | Full-Text
2004-10-12	CEN14 The coordinates of this centromere were updated to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. 2001, and Espelin et al. 2003. Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60. SGD paper | PubMed | Full-Text Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68. SGD paper | PubMed | Full-Text
2004-04-21	YNL082W Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PMS1/YNL082W be moved 93 nt downstream. This suggestion was reviewed by SGD curators and incorporated. Evidence supporting this change includes: 1) This is the predicted start methionine in S. bayanus, S. paradoxus and S. mikatae; 2) The proposed start methionine is conserved in the S. kluyveri, S. castellii, and S. kudriavzevii sequences published by Cliften et al. 3) DNA sequence conservation begins abruptly at this ATG. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2004-02-04	snR19 Start moved 100 bp downstream from 230771 to 230671. See GenBank M17205, Z71497, and Z71498.
2004-02-03	YNL130C Start moved 328 bp downstream based on sequence conservation in other Saccharomyces species. In addition, the 5' splice site for the existing intron moved 349 bp downstream. There is no change to Exon 2. Hjelmstad RH and Bell RM (1990) The sn-1,2-diacylglycerol cholinephosphotransferase of Saccharomyces cerevisiae. Nucleotide sequence, transcriptional mapping, and gene product analysis of the CPT1 gene. J Biol Chem 265(3):1755-64. SGD paper | PubMed | Full-Text Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. SGD paper | PubMed | Full-Text