Chromosome XIII History

This page lists all sequence and annotation changes that have been made to the Chromosome XIII systematic reference sequence since its intial release on 1996-07-31.

• The sequence of Chromosome XIII has been updated 13 times, affecting 16 features.
  
• The annotation of Chromosome XIII has been updated 32 times, affecting 70 features.
  
• Current and past versions can be obtained from SGD's Download site.

Sequence Changes

Date	Affected Features	Start Coordinate of Change	End Coordinate of Change	Type of Change	Old Sequence	New Sequence
2011-02-03	YMR290W-A	851740	851740	Substitution	G	A
		851734	851734	Substitution	G	A
	Nucleotide change(s) in the coding region of YMR290W-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 105-107 are now KKK rather than RKR. New 851700 TAAAGCTAATATTGAAAAAAAAAAAAAAAAAAAAAAGAAAAAGCAAATAAAAAATTTTCA 851759 ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| Old 851699 TAAAGCTAATATTGAAAAAAAAAAAAAAAAAAAAAGGAAAAGGCAAATAAAAAATTTTCA 851758 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YMR299C	864682	864682	Substitution	G	T
	Nucleotide change(s) in the coding region of DYN3/YMR299C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 223 is now Lysine rather than Threonine. New 864660 TCGGTATTAATATCTCACTGCGTTTGACCATTTCAATATGATCTTTCATATCTCTATCTT 864719 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old 864659 TCGGTATTAATATCTCACTGCGTGTGACCATTTCAATATGATCTTTCATATCTCTATCTT 864718 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YMR317W	908172	908183	Substitution	TCAGTGAGTTCG	GTAATTAGTTCA
		908194	908201	Substitution	CGTCAACA	GGGCAACG
		908216	908216	Substitution	T	C
	Nucleotide change(s) in the coding region of YMR317W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 271-279 are now VISSEASWA rather than SVSSEASSS. New 908160 CGGCAACGTCTAGCGTAATTAGTTCAGAAGCTTCATGGGCAACGTCTAGCTCAGTGAGCTCGGAAGCTCC 908229 |||||||||||||| | | ||||| |||||||||| | |||| |||||||||||||| ||||||||||| Old 908158 CGGCAACGTCTAGCTCAGTGAGTTCGGAAGCTTCATCGTCAACATCTAGCTCAGTGAGTTCGGAAGCTCC 908227 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YMR262W	794225	794225	Substitution	G	C
	Nucleotide change(s) in the coding region of YMR262W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 167 is now Cysteine rather than Tryptophan. New 794220 ATTTTGCCGACTGGCAAGGCACACAAGCAAGCCCATCTCTATACACGATGTAAAGTGCCA 794279 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 794219 ATTTTGGCGACTGGCAAGGCACACAAGCAAGCCCATCTCTATACACGATGTAAAGTGCCA 794278 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YMR008C, YMR009W	283468	283468	Insertion		G
	A single nucleotide was inserted in the intergenic region between ORFs PLB1/YMR008C and ADI1/YMR009W. New 283440 GAAATATCGGAGTCTTGCTATTGTTCAGGGCTTTGCCGGTGCGTAAATAATAGGCTGAAG 283499 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old 283440 GAAATATCGGAGTCTTGCTATTGTTCAGG-CTTTGCCGGTGCGTAAATAATAGGCTGAAG 283498 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YML131W, YML132W	9542	9542	Deletion	T
	A single nucleotide was deleted from the intergenic region between ORFs COS3/YML132W and YML131W. New 9531 TTTTTTTTTTT-GCCTTCTTCATACTTTTACTCCTGCTTTTATTACTCTAAATTTCATTTTTATTTATTC 9599 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 9531 TTTTTTTTTTTTGCCTTCTTCATACTTTTACTCCTGCTTTTATTACTCTAAATTTCATTTTTATTTATTC 9600 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YMRCtau3, YMRWdelta20	808976	808976	Substitution	A	T
	A single nucleotide substitution was made in the intergenic region between LTRs YMRCtau3 and YMRWdelta20. New 808920 TGATTTGCGCAACGCAGATACAGATTTTACTTTATTCTTCGTGCCTAAAATGGACCATCGTTTCACTTAC 808989 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 808919 TGATTTGCGCAACGCAGATACAGATTTTACTTTATTCTTCGTGCCTAAAATGGACCAACGTTTCACTTAC 808988 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YML121W, YML122C	26602	26602	Insertion		T
	A single nucleotide was inserted in the intergenic region between ORFs YML122C and GTR1/YML121W. New 26580 TTTTATTGAATCTTTTTTTTTTTGTAAGAAAATTAAGGTTTATTAGGCAGAGTATACCGA 26639 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 26581 TTTTATTGAATCTTTTTTTTTT-GTAAGAAAATTAAGGTTTATTAGGCAGAGTATACCGA 26639 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YMR315W-A, YMR316W	904639	904639	Insertion		G
	A single nucleotide was inserted in the intergenic region between ORFs YMR315W-A and DIA1/YMR316W. New 904620 TTCTTTTTTTTGGCGCAGCAAGGGACAATGGTCCCTTTTTGAGAAAATGTTGTAGGCTTG 904679 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 904619 TTCTTTTTTTTGGCGCAGCAA-GGACAATGGTCCCTTTTTGAGAAAATGTTGTAGGCTTG 904677 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2004-02-28	YMR268W-A, YMR269W	804684	804684	Deletion	C
	Deleted C at 804684 and moved YMR269W start 208 bp upstream from 804663 (old YMR269W start) to 804455 (YMR268W-A start) based on Brachat et al. 2003. This resulted in the merge of YMR268W-A, which was added in June 2003 based on Kessler et al. 2003, into YMR269W. As a result of this sequence correction and locus merge, the YMR269W protein increases in size from 142 amino acids to 211 amino acids, and YMR268W-A is no longer considered a separate ORF. New: 181 AACCTGGATGTAAGCACTGATTCGAATAATGGCAGTATTAAATTTACTC-AAAATGAGGC 239 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old: 804635 AACCTGGATGTAAGCACTGATTCGAATAATGGCAGTATTAAATTTACTCCAAAATGAGGC 804694 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. SGD paper | PubMed | Full-Text Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. SGD paper | PubMed | Full-Text

Annotation Changes without sequence changes

Date	Affected Features
2014-11-19	ARS1304, ARS1307, ARS1307.5, ARS1308, ARS1309, ARS1312, ARS1316, ARS1320, ARS1323, ARS1325, ARS1327, ARS1329, ARS1330, ARS1332 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome XIII based on Liachko et al. 2013: ARS1304, ARS1307, ARS1307.5, ARS1308, ARS1309, ARS1312, ARS1316, ARS1320, ARS1323, ARS1325, ARS1327, ARS1329, ARS1330, ARS1332. Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. SGD paper | PubMed | Full-Text
2014-11-19	ARS1303, ARS1308, ARS1310, ARS1312, ARS1324, ARS1329, ARS1332 The chromosomal coordinates of the following ARS elements on Chromosome XIII were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1303, ARS1308, ARS1310, ARS1312, ARS1324, ARS1329, ARS1332. Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. SGD paper | PubMed | Full-Text
2014-11-19	ARS1307.5 ARS1307.5 was added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2. Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. SGD paper | PubMed | Full-Text
2014-11-19	ZOD1 ZOD1 was added to genome annotation and assigned chromosomal coordinates based on Guffanti et al. 2006 as part of SGD's genome annotation revision R64.2. Guffanti E, et al. (2006) Nucleosome Depletion Activates Poised RNA Polymerase III at Unconventional Transcription Sites in Saccharomyces cerevisiae. J Biol Chem 281(39):29155-64. SGD paper | PubMed | Full-Text
2014-11-19	ETC5 ETC5 was added to the genome annotation as a nuclear matrix attachment site based on Hiraga et al. 2012 as part of SGD's genome annotation revision R64.2. Hiraga SI, et al. (2012) FIIIC localizes budding yeast ETC sites to the nuclear periphery. Mol Biol Cell 23(14):2741-54. SGD paper | PubMed | Full-Text
2009-05-08	ARS1304, ARS1317, ARS1319, ARS1321, ARS1322, ARS1331, ARS1333, ARS1335 The following ARS elements on Chromosome 13 were added to the genome annotation based on Raveendranathan et al. 2006: ARS1304, ARS1317, ARS1319, ARS1321, ARS1322, ARS1331, ARS1333, and ARS1335. Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39. SGD paper | PubMed | Full-Text
2007-07-10	YMR242C The start of ORF RPL20A/YMR242C was moved 23 nt upstream, and the 5' end of the intron was moved 32 nt upstream, based on Miura et al. 2006, Zhang et al. 2007, and GenBank EF138821. The ORF had been annotated as 973 nt long with a 436-nt intron (178 aa), but is now 996 nt long with a 477-nt intron (172 aa). Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. SGD paper | PubMed | Full-Text Zhang Z, et al. (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9. SGD paper | PubMed | Full-Text | YFGdb
2007-07-10	YML036W The stop of ORF CGI121/YML036W was moved 82 nt downstream and an intron was added at relative coordinates 457..562 based on GenBank EF123129, Juneau et al. 2007, and Miura et al. 2006. The ORF had been annotated as 570 nt long (189 aa), but is now 652 nt in length with a 106-nt intron (181 aa). Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. SGD paper | PubMed | Full-Text Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7. SGD paper | PubMed | Full-Text
2007-07-10	snR78 Updated coordinates of snR78 based on GenBank AJ010801. Extended 3' end by 1 nt. Qu LH, et al. (1999) Seven novel methylation guide small nucleolar RNAs are processed from a common polycistronic transcript by Rat1p and RNase III in yeast. Mol Cell Biol 19(2):1144-58. SGD paper | PubMed | Full-Text
2006-10-05	snR86 This snoRNA gene, snR86, was identified by Torchet et al. Many thanks to Wayne Decatur and Dorota Piekna-Przybylska for alerting us to this new gene. Torchet C, et al. (2005) The complete set of H/ACA snoRNAs that guide rRNA pseudouridylations in Saccharomyces cerevisiae. RNA 11(6):928-38. SGD paper | PubMed | Full-Text
2006-09-07	ARS1303, ARS1305, ARS1307, ARS1308, ARS1309, ARS1310, ARS1312, ARS1316, ARS1320, ARS1323, ARS1324, ARS1325, ARS1327, ARS1328, ARS1329, ARS1330, ARS1332 The following new ARS elements on Chromosome XIII were added to SGD based on Nieduszynski et al. 2006: ARS1303, ARS1305, ARS1307, ARS1308, ARS1309, ARS1310, ARS1312, ARS1316, ARS1320, ARS1323, ARS1324, ARS1325, ARS1327, ARS1328, ARS1329, ARS1330, ARS1332. Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. SGD paper | PubMed | Full-Text | Web Supplement
2006-05-10	YMR059W The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported their proposal., so the start codon for SEN15/YMR059W was moved 60 nt (20 amino acids) downstream. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2006-01-24	snR85 New snoRNA added to genome annotation (GenBank accession # AY679773). Schattner P, et al. (2004) Genome-wide searching for pseudouridylation guide snoRNAs: analysis of the Saccharomyces cerevisiae genome. Nucleic Acids Res 32(14):4281-96. SGD paper | PubMed | Full-Text
2006-01-24	RNA170 ncRNA added based on work published by Olivas et al. Olivas WM, et al. (1997) Analysis of the yeast genome: identification of new non-coding and small ORF-containing RNAs. Nucleic Acids Res 25(22):4619-25. SGD paper | PubMed | Full-Text
2004-10-12	CEN13 The coordinates of this centromere were updated to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. 2001, and Espelin et al. 2003. Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60. SGD paper | PubMed | Full-Text Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68. SGD paper | PubMed | Full-Text
2004-04-01	snR83 Start and stop coordinates updated per McCutcheon & Eddy 2004. McCutcheon JP and Eddy SR (2004) Detailed correction to: Computational identification of noncoding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res. 31:4119-4128, 2003. SGD paper | PubMed | Full-Text
2004-01-30	YML017W Based on analyses of homology and synteny in Ashbya gossypii, followed by verification using 5' RACE, Brachat et al. (2003) proposed an intron and 5' extension for PSP2/YML017W. The updated ORF is in the same frame with the start codon shifted 407 bp upstream and a 362-bp intron at relative coordinates 5-366; the protein has a 15-residue extension at the N-terminus. GenBank Accession AY245793. Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. SGD paper | PubMed | Full-Text
2003-09-27	YMR242C Based on the alignment of orthologs in related Saccharomyces species, Cliften et al. proposed an intron and new 5' exon for RPL20A/YMR242C. The resulting ORF is in the same frame, but has an altered N-terminus and is 2 residues shorter. This change was reviewed and accepted by SGD curators. Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2003-09-22	YMR191W Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YMR191W be moved 255 nt (85 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Insertions and deletions in S. paradoxus, S. mikatae and S. bayanus relative to the S. cerevisiae sequence create frameshifts between the upstream and downstream ATGs; 4) a BLAST to the NCBI non redundant (nr) dataset indicates that the first 85 aa of S. cerevisiae Ymr191wp do not have significant homology to any other sequences. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2003-09-22	YML107C Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YML107C be moved 156 nt (52 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) In S. paradoxus and S. mikatae, the original upstream start is not conserved, and there are frameshifts between the two ATGs. The upstream start codon is conserved in S. bayanus, but there are frameshifts between the two ATGs. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2003-09-22	YMR214W Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for SCJ1/YMR214W be moved 81 nt (27 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Insertions and deletions in S. paradoxus, S. mikatae and S. bayanus relative to the S. cerevisiae sequence create frameshifts between the upstream and downstream ATGs; 4) Mori et al. demonstrate that a beta-galactosidase fusion is expressed when fused immediately downstream of Met28, but not when fused downstream of Met1; 5) an NCBI BLAST against the non-redundant dataset shows that there are many DnaJ-related proteins from various species with strong sequence similarity to SCJ1 beginning around amino acid 50 (C-terminal to the predicted Met28), with no strong similarity before amino acid 50. Mori K, et al. (1998) Palindrome with spacer of one nucleotide is characteristic of the cis-acting unfolded protein response element in Saccharomyces cerevisiae. J Biol Chem 273(16):9912-20. SGD paper | PubMed | Full-Text Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. SGD paper | PubMed | Full-Text | Comments & Errata Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. SGD paper | PubMed | Full-Text | Web Supplement
2003-09-09	TEL13L, TEL13R The chromosomal locations for TEL13L, TEL13L-TR1, TEL13L-TR2, TEL13L-XC, TEL13L-XR, TEL13L-YP, TEL13R, TEL13R-TR, TEL13R-XC, and TEL13R-XR were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).
2003-07-29	YML100W-A, YML133W-A, YML133W-B, YMR001C-A, YMR105W-A, YMR182W-A, YMR242W-A, YMR272W-A, YMR272W-B, YMR315W-A Thanks to Kumar et al. for providing the coordinates of the following ORFs: YML100W-A, YML133W-B, YMR105W-A, YMR242W-A, YMR272W-A, YMR272W-B, YMR315W-A, YMR182W-A, YMR001C-A, and YML133W-A. Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63. SGD paper | PubMed | Full-Text | YFGdb | Comments & Errata
2003-07-29	YML054C-A, YMR030W-A, YMR141W-A, YMR230W-A, YMR268W-A, YMR307C-A Thanks to Kessler et al. for providing the coordinates of the following Chromosome XIII ORFs: YML054C-A, YMR030W-A, YMR141W-A, YMR268W-A, YMR307C-A, and YMR230W-A. Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. SGD paper | PubMed | Full-Text
2003-07-29	YMR194C-B Thanks to Brachat et al. for providing the coordinates of YMR194C-B. Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. SGD paper | PubMed | Full-Text
2003-07-29	YML031C-A The ORF YML032C-A was included in the original annotation of Chromosome XIII, but was later withdrawn and was deleted from SGD on August 23, 1999. On the recommendation of MIPS, this ORF has subsequently added back to the genome annotation, but with a new name (YML031C-A). Thanks to MIPS for providing the coordinates of YML031C-A. SGD (2007) Information without a citation in SGD
2003-07-29	YMR013C-A, YMR175W-A, YMR247W-A Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XIII ORFs: YMR013C-A, YMR175W-A, and YMR247W-A. Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9. SGD paper | PubMed | Full-Text Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. SGD paper | PubMed | Full-Text | YFGdb Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. SGD paper | PubMed | Full-Text | Web Supplement | YFGdb
2003-03-06	snR83 Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8. McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28. SGD paper | PubMed | Full-Text
2003-01-07	YML032C The start site of RAD52/YML032C has been moved 99 nt downstream from 214029 to 213930. Chromosomal coordinates change from old:214029-212515 to new:213930-212515. Relative coordinates change from old:1-1515 to new:1-1416. In S. paradoxus, S. bayanus, and S. mikatae, the first in-frame ATG aligns with the third start codon in S. cerevisiae. This change is also supported by the following evidence: (1) mutational analysis by the Rothstein lab (A. Antunez de Mayolo, M. Lisby, N. Erdeniz); (2) additional sequence analysis done by Tanja Thybo Frederiksen in Uffe Mortensen's lab; (3) mRNA analysis described in Adzuma et al. Adzuma K, et al. (1984) Primary structure of the RAD52 gene in Saccharomyces cerevisiae. Mol Cell Biol 4(12):2735-44. SGD paper | PubMed | Full-Text