Difference between revisions of "Chromosome XIII History"
(→Annotation Changes without sequence changes) |
(→Annotation Changes without sequence changes) |
||
| Line 339: | Line 339: | ||
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br> | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br> | ||
| + | |- | ||
| + | | 2003-09-09 | ||
| + | | [https://www.yeastgenome.org/locus/TEL13L TEL13L], [https://www.yeastgenome.org/locus/TEL13R TEL13R] <br> | ||
| + | The chromosomal locations for TEL13L, TEL13L-TR1, TEL13L-TR2, TEL13L-XC, TEL13L-XR, TEL13L-YP, TEL13R, TEL13R-TR, TEL13R-XC, and TEL13R-XR were generously provided by Ed Louis and Dave Barton (University of Leicester, UK). <br> <br> | ||
| + | |- | ||
| + | | 2003-07-29 | ||
| + | | [https://www.yeastgenome.org/locus/YML100W-A YML100W-A], [https://www.yeastgenome.org/locus/YML133W-A YML133W-A], [https://www.yeastgenome.org/locus/YML133W-B YML133W-B], [https://www.yeastgenome.org/locus/YMR001C-A YMR001C-A], [https://www.yeastgenome.org/locus/YMR105W-A YMR105W-A], [https://www.yeastgenome.org/locus/YMR182W-A YMR182W-A], [https://www.yeastgenome.org/locus/YMR242W-A YMR242W-A], [https://www.yeastgenome.org/locus/YMR272W-A YMR272W-A], [https://www.yeastgenome.org/locus/YMR272W-B YMR272W-B], [https://www.yeastgenome.org/locus/YMR315W-A YMR315W-A] <br> | ||
| + | Thanks to Kumar et al. for providing the coordinates of the following ORFs: YML100W-A, YML133W-B, YMR105W-A, YMR242W-A, YMR272W-A, YMR272W-B, YMR315W-A, YMR182W-A, YMR001C-A, and YML133W-A.<br> <br> | ||
| + | '''Kumar A, et al.''' (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000073673 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11753363 PubMed] | [https://www.nature.com/articles/nbt0102-58 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11753363&db=pmid YFGdb] | [https://www.yeastgenome.org/reference/S000141796 Comments & Errata] <br> | ||
| + | |- | ||
| + | | 2003-07-29 | ||
| + | | [https://www.yeastgenome.org/locus/YML054C-A YML054C-A], [https://www.yeastgenome.org/locus/YMR030W-A YMR030W-A], [https://www.yeastgenome.org/locus/YMR141W-A YMR141W-A], [https://www.yeastgenome.org/locus/YMR230W-A YMR230W-A], [https://www.yeastgenome.org/locus/YMR268W-A YMR268W-A], [https://www.yeastgenome.org/locus/YMR307C-A YMR307C-A] <br> | ||
| + | Thanks to Kessler et al. for providing the coordinates of the following Chromosome XIII ORFs: YML054C-A, YMR030W-A, YMR141W-A, YMR268W-A, YMR307C-A, and YMR230W-A.<br> <br> | ||
| + | '''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000073671 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] | [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br> | ||
| + | |- | ||
| + | | 2003-07-29 | ||
| + | | [https://www.yeastgenome.org/locus/YMR194C-B YMR194C-B] <br> | ||
| + | Thanks to Brachat et al. for providing the coordinates of YMR194C-B. <br> <br> | ||
| + | '''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br> | ||
| + | |- | ||
| + | | 2003-07-29 | ||
| + | | [https://www.yeastgenome.org/locus/YML031C-A YML031C-A] <br> | ||
| + | The ORF YML032C-A was included in the original annotation of Chromosome XIII, but was later withdrawn and was deleted from SGD on August 23, 1999. On the recommendation of MIPS, this ORF has subsequently added back to the genome annotation, but with a new name (YML031C-A). Thanks to MIPS for providing the coordinates of YML031C-A. <br> <br> | ||
| + | '''SGD (2007)''' Information without a citation in SGD <br> | ||
| + | |- | ||
| + | | 2003-07-29 | ||
| + | | [https://www.yeastgenome.org/locus/YMR013C-A YMR013C-A], [https://www.yeastgenome.org/locus/YMR175W-A YMR175W-A], [https://www.yeastgenome.org/locus/YMR247W-A YMR247W-A] <br> | ||
| + | Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XIII ORFs: YMR013C-A, YMR175W-A, and YMR247W-A.<br> <br> | ||
| + | '''Basrai MA, et al.''' (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000042214 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10490641 PubMed] | [https://mcb.asm.org/content/19/10/7041.long Full-Text] <br> | ||
| + | '''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br> | ||
| + | '''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000073672 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] | [https://genome.cshlp.org/content/12/8/1210.long Full-Text] | [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br> | ||
Revision as of 12:36, 2 October 2019
This page lists all sequence and annotation changes that have been made to the Chromosome XIII systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome XIII has been updated 13 times, affecting 16 features.
- The annotation of Chromosome XIII has been updated 32 times, affecting 70 features.
- Current and past versions can be obtained from SGD's Download site.
Sequence Changes
| Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
|---|---|---|---|---|---|---|
| 2011-02-03 | YMR290W-A | 851740 | 851740 | Substitution | G | A |
| 851734 | 851734 | Substitution | G | A | ||
Nucleotide change(s) in the coding region of YMR290W-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 105-107 are now KKK rather than RKR.
New 851700 TAAAGCTAATATTGAAAAAAAAAAAAAAAAAAAAAAGAAAAAGCAAATAAAAAATTTTCA 851759
||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||
Old 851699 TAAAGCTAATATTGAAAAAAAAAAAAAAAAAAAAAGGAAAAGGCAAATAAAAAATTTTCA 851758
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YMR299C | 864682 | 864682 | Substitution | G | T |
Nucleotide change(s) in the coding region of DYN3/YMR299C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 223 is now Lysine rather than Threonine.
New 864660 TCGGTATTAATATCTCACTGCGTTTGACCATTTCAATATGATCTTTCATATCTCTATCTT 864719
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old 864659 TCGGTATTAATATCTCACTGCGTGTGACCATTTCAATATGATCTTTCATATCTCTATCTT 864718
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YMR317W | 908172 | 908183 | Substitution | TCAGTGAGTTCG | GTAATTAGTTCA |
| 908194 | 908201 | Substitution | CGTCAACA | GGGCAACG | ||
| 908216 | 908216 | Substitution | T | C | ||
Nucleotide change(s) in the coding region of YMR317W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 271-279 are now VISSEASWA rather than SVSSEASSS.
New 908160 CGGCAACGTCTAGCGTAATTAGTTCAGAAGCTTCATGGGCAACGTCTAGCTCAGTGAGCTCGGAAGCTCC 908229
|||||||||||||| | | ||||| |||||||||| | |||| |||||||||||||| |||||||||||
Old 908158 CGGCAACGTCTAGCTCAGTGAGTTCGGAAGCTTCATCGTCAACATCTAGCTCAGTGAGTTCGGAAGCTCC 908227
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YMR262W | 794225 | 794225 | Substitution | G | C |
Nucleotide change(s) in the coding region of YMR262W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 167 is now Cysteine rather than Tryptophan.
New 794220 ATTTTGCCGACTGGCAAGGCACACAAGCAAGCCCATCTCTATACACGATGTAAAGTGCCA 794279
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Old 794219 ATTTTGGCGACTGGCAAGGCACACAAGCAAGCCCATCTCTATACACGATGTAAAGTGCCA 794278
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YMR008C, YMR009W | 283468 | 283468 | Insertion | G | |
A single nucleotide was inserted in the intergenic region between ORFs PLB1/YMR008C and ADI1/YMR009W.
New 283440 GAAATATCGGAGTCTTGCTATTGTTCAGGGCTTTGCCGGTGCGTAAATAATAGGCTGAAG 283499
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Old 283440 GAAATATCGGAGTCTTGCTATTGTTCAGG-CTTTGCCGGTGCGTAAATAATAGGCTGAAG 283498
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YML131W, YML132W | 9542 | 9542 | Deletion | T | |
A single nucleotide was deleted from the intergenic region between ORFs COS3/YML132W and YML131W.
New 9531 TTTTTTTTTTT-GCCTTCTTCATACTTTTACTCCTGCTTTTATTACTCTAAATTTCATTTTTATTTATTC 9599
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old 9531 TTTTTTTTTTTTGCCTTCTTCATACTTTTACTCCTGCTTTTATTACTCTAAATTTCATTTTTATTTATTC 9600
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YMRCtau3, YMRWdelta20 | 808976 | 808976 | Substitution | A | T |
A single nucleotide substitution was made in the intergenic region between LTRs YMRCtau3 and YMRWdelta20.
New 808920 TGATTTGCGCAACGCAGATACAGATTTTACTTTATTCTTCGTGCCTAAAATGGACCATCGTTTCACTTAC 808989
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old 808919 TGATTTGCGCAACGCAGATACAGATTTTACTTTATTCTTCGTGCCTAAAATGGACCAACGTTTCACTTAC 808988
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YML121W, YML122C | 26602 | 26602 | Insertion | T | |
A single nucleotide was inserted in the intergenic region between ORFs YML122C and GTR1/YML121W.
New 26580 TTTTATTGAATCTTTTTTTTTTTGTAAGAAAATTAAGGTTTATTAGGCAGAGTATACCGA 26639
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old 26581 TTTTATTGAATCTTTTTTTTTT-GTAAGAAAATTAAGGTTTATTAGGCAGAGTATACCGA 26639
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YMR315W-A, YMR316W | 904639 | 904639 | Insertion | G | |
A single nucleotide was inserted in the intergenic region between ORFs YMR315W-A and DIA1/YMR316W.
New 904620 TTCTTTTTTTTGGCGCAGCAAGGGACAATGGTCCCTTTTTGAGAAAATGTTGTAGGCTTG 904679
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Old 904619 TTCTTTTTTTTGGCGCAGCAA-GGACAATGGTCCCTTTTTGAGAAAATGTTGTAGGCTTG 904677
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2004-02-28 | YMR268W-A, YMR269W | 804684 | 804684 | Deletion | C | |
Deleted C at 804684 and moved YMR269W start 208 bp upstream from 804663 (old YMR269W start) to 804455 (YMR268W-A start) based on Brachat et al. 2003. This resulted in the merge of YMR268W-A, which was added in June 2003 based on Kessler et al. 2003, into YMR269W. As a result of this sequence correction and locus merge, the YMR269W protein increases in size from 142 amino acids to 211 amino acids, and YMR268W-A is no longer considered a separate ORF.
New: 181 AACCTGGATGTAAGCACTGATTCGAATAATGGCAGTATTAAATTTACTC-AAAATGAGGC 239
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old: 804635 AACCTGGATGTAAGCACTGATTCGAATAATGGCAGTATTAAATTTACTCCAAAATGAGGC 804694
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. | ||||||
Annotation Changes without sequence changes
| Date | Affected Features |
|---|---|
| 2014-11-19 | ARS1304, ARS1307, ARS1307.5, ARS1308, ARS1309, ARS1312, ARS1316, ARS1320, ARS1323, ARS1325, ARS1327, ARS1329, ARS1330, ARS1332 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome XIII based on Liachko et al. 2013: ARS1304, ARS1307, ARS1307.5, ARS1308, ARS1309, ARS1312, ARS1316, ARS1320, ARS1323, ARS1325, ARS1327, ARS1329, ARS1330, ARS1332. |
| 2014-11-19 | ARS1303, ARS1308, ARS1310, ARS1312, ARS1324, ARS1329, ARS1332 The chromosomal coordinates of the following ARS elements on Chromosome XIII were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1303, ARS1308, ARS1310, ARS1312, ARS1324, ARS1329, ARS1332. |
| 2014-11-19 | ARS1307.5 ARS1307.5 was added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2. |
| 2014-11-19 | ZOD1 ZOD1 was added to genome annotation and assigned chromosomal coordinates based on Guffanti et al. 2006 as part of SGD's genome annotation revision R64.2. |
| 2014-11-19 | ETC5 ETC5 was added to the genome annotation as a nuclear matrix attachment site based on Hiraga et al. 2012 as part of SGD's genome annotation revision R64.2. |
| 2009-05-08 | ARS1304, ARS1317, ARS1319, ARS1321, ARS1322, ARS1331, ARS1333, ARS1335 The following ARS elements on Chromosome 13 were added to the genome annotation based on Raveendranathan et al. 2006: ARS1304, ARS1317, ARS1319, ARS1321, ARS1322, ARS1331, ARS1333, and ARS1335. |
| 2007-07-10 | YMR242C The start of ORF RPL20A/YMR242C was moved 23 nt upstream, and the 5' end of the intron was moved 32 nt upstream, based on Miura et al. 2006, Zhang et al. 2007, and GenBank EF138821. The ORF had been annotated as 973 nt long with a 436-nt intron (178 aa), but is now 996 nt long with a 477-nt intron (172 aa). |
| 2007-07-10 | YML036W The stop of ORF CGI121/YML036W was moved 82 nt downstream and an intron was added at relative coordinates 457..562 based on GenBank EF123129, Juneau et al. 2007, and Miura et al. 2006. The ORF had been annotated as 570 nt long (189 aa), but is now 652 nt in length with a 106-nt intron (181 aa). |
| 2007-07-10 | snR78 Updated coordinates of snR78 based on GenBank AJ010801. Extended 3' end by 1 nt. |
| 2006-10-05 | snR86 This snoRNA gene, snR86, was identified by Torchet et al. Many thanks to Wayne Decatur and Dorota Piekna-Przybylska for alerting us to this new gene. |
| 2006-09-07 | ARS1303, ARS1305, ARS1307, ARS1308, ARS1309, ARS1310, ARS1312, ARS1316, ARS1320, ARS1323, ARS1324, ARS1325, ARS1327, ARS1328, ARS1329, ARS1330, ARS1332 The following new ARS elements on Chromosome XIII were added to SGD based on Nieduszynski et al. 2006: ARS1303, ARS1305, ARS1307, ARS1308, ARS1309, ARS1310, ARS1312, ARS1316, ARS1320, ARS1323, ARS1324, ARS1325, ARS1327, ARS1328, ARS1329, ARS1330, ARS1332. |
| 2006-05-10 | YMR059W The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported their proposal., so the start codon for SEN15/YMR059W was moved 60 nt (20 amino acids) downstream. |
| 2006-01-24 | snR85 New snoRNA added to genome annotation (GenBank accession # AY679773). |
| 2006-01-24 | RNA170 ncRNA added based on work published by Olivas et al. |
| 2004-10-12 | CEN13 The coordinates of this centromere were updated to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. 2001, and Espelin et al. 2003. |
| 2004-04-01 | snR83 Start and stop coordinates updated per McCutcheon & Eddy 2004. |
| 2004-01-30 | YML017W Based on analyses of homology and synteny in Ashbya gossypii, followed by verification using 5' RACE, Brachat et al. (2003) proposed an intron and 5' extension for PSP2/YML017W. The updated ORF is in the same frame with the start codon shifted 407 bp upstream and a 362-bp intron at relative coordinates 5-366; the protein has a 15-residue extension at the N-terminus. GenBank Accession AY245793. |
| 2003-09-27 | YMR242C Based on the alignment of orthologs in related Saccharomyces species, Cliften et al. proposed an intron and new 5' exon for RPL20A/YMR242C. The resulting ORF is in the same frame, but has an altered N-terminus and is 2 residues shorter. This change was reviewed and accepted by SGD curators. |
| 2003-09-22 | YMR191W Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YMR191W be moved 255 nt (85 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Insertions and deletions in S. paradoxus, S. mikatae and S. bayanus relative to the S. cerevisiae sequence create frameshifts between the upstream and downstream ATGs; 4) a BLAST to the NCBI non redundant (nr) dataset indicates that the first 85 aa of S. cerevisiae Ymr191wp do not have significant homology to any other sequences. |
| 2003-09-22 | YML107C Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YML107C be moved 156 nt (52 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) In S. paradoxus and S. mikatae, the original upstream start is not conserved, and there are frameshifts between the two ATGs. The upstream start codon is conserved in S. bayanus, but there are frameshifts between the two ATGs. |
| 2003-09-22 | YMR214W Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for SCJ1/YMR214W be moved 81 nt (27 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Insertions and deletions in S. paradoxus, S. mikatae and S. bayanus relative to the S. cerevisiae sequence create frameshifts between the upstream and downstream ATGs; 4) Mori et al. demonstrate that a beta-galactosidase fusion is expressed when fused immediately downstream of Met28, but not when fused downstream of Met1; 5) an NCBI BLAST against the non-redundant dataset shows that there are many DnaJ-related proteins from various species with strong sequence similarity to SCJ1 beginning around amino acid 50 (C-terminal to the predicted Met28), with no strong similarity before amino acid 50. |
| 2003-09-09 | TEL13L, TEL13R The chromosomal locations for TEL13L, TEL13L-TR1, TEL13L-TR2, TEL13L-XC, TEL13L-XR, TEL13L-YP, TEL13R, TEL13R-TR, TEL13R-XC, and TEL13R-XR were generously provided by Ed Louis and Dave Barton (University of Leicester, UK). |
| 2003-07-29 | YML100W-A, YML133W-A, YML133W-B, YMR001C-A, YMR105W-A, YMR182W-A, YMR242W-A, YMR272W-A, YMR272W-B, YMR315W-A Thanks to Kumar et al. for providing the coordinates of the following ORFs: YML100W-A, YML133W-B, YMR105W-A, YMR242W-A, YMR272W-A, YMR272W-B, YMR315W-A, YMR182W-A, YMR001C-A, and YML133W-A. |
| 2003-07-29 | YML054C-A, YMR030W-A, YMR141W-A, YMR230W-A, YMR268W-A, YMR307C-A Thanks to Kessler et al. for providing the coordinates of the following Chromosome XIII ORFs: YML054C-A, YMR030W-A, YMR141W-A, YMR268W-A, YMR307C-A, and YMR230W-A. |
| 2003-07-29 | YMR194C-B Thanks to Brachat et al. for providing the coordinates of YMR194C-B. |
| 2003-07-29 | YML031C-A The ORF YML032C-A was included in the original annotation of Chromosome XIII, but was later withdrawn and was deleted from SGD on August 23, 1999. On the recommendation of MIPS, this ORF has subsequently added back to the genome annotation, but with a new name (YML031C-A). Thanks to MIPS for providing the coordinates of YML031C-A. |
| 2003-07-29 | YMR013C-A, YMR175W-A, YMR247W-A Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XIII ORFs: YMR013C-A, YMR175W-A, and YMR247W-A. |