Difference between revisions of "Chromosome XIII History"
(→Sequence Changes) |
|||
Line 189: | Line 189: | ||
'''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br> | '''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br> | ||
[https://www.yeastgenome.org/reference/S000073671 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] | [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br> | [https://www.yeastgenome.org/reference/S000073671 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] | [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br> | ||
+ | |||
+ | |} | ||
+ | |||
+ | <br><br> | ||
+ | |||
+ | =Annotation Changes ''without sequence changes''= | ||
+ | {| border="1" style="border-collapse:collapse; width:90%" cellpadding="6" | ||
+ | ! Date !! Affected Features | ||
+ | |- | ||
+ | | 2014-11-19 | ||
+ | | [https://www.yeastgenome.org/locus/ARS1304 ARS1304], [https://www.yeastgenome.org/locus/ARS1307 ARS1307], [https://www.yeastgenome.org/locus/ARS1307.5 ARS1307.5], [https://www.yeastgenome.org/locus/ARS1308 ARS1308], [https://www.yeastgenome.org/locus/ARS1309 ARS1309], [https://www.yeastgenome.org/locus/ARS1312 ARS1312], [https://www.yeastgenome.org/locus/ARS1316 ARS1316], [https://www.yeastgenome.org/locus/ARS1320 ARS1320], [https://www.yeastgenome.org/locus/ARS1323 ARS1323], [https://www.yeastgenome.org/locus/ARS1325 ARS1325], [https://www.yeastgenome.org/locus/ARS1327 ARS1327], [https://www.yeastgenome.org/locus/ARS1329 ARS1329], [https://www.yeastgenome.org/locus/ARS1330 ARS1330], [https://www.yeastgenome.org/locus/ARS1332 ARS1332] <br> | ||
+ | As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome XIII based on Liachko et al. 2013: ARS1304, ARS1307, ARS1307.5, ARS1308, ARS1309, ARS1312, ARS1316, ARS1320, ARS1323, ARS1325, ARS1327, ARS1329, ARS1330, ARS1332. <br> <br> | ||
+ | '''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text] | ||
+ | |- | ||
+ | | 2014-11-19 | ||
+ | | [https://www.yeastgenome.org/locus/ARS1303 ARS1303], [https://www.yeastgenome.org/locus/ARS1308 ARS1308], [https://www.yeastgenome.org/locus/ARS1310 ARS1310], [https://www.yeastgenome.org/locus/ARS1312 ARS1312], [https://www.yeastgenome.org/locus/ARS1324 ARS1324], [https://www.yeastgenome.org/locus/ARS1329 ARS1329], [https://www.yeastgenome.org/locus/ARS1332 ARS1332] <br> | ||
+ | The chromosomal coordinates of the following ARS elements on Chromosome XIII were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1303, ARS1308, ARS1310, ARS1312, ARS1324, ARS1329, ARS1332. <br> <br> | ||
+ | '''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text] | ||
+ | |- | ||
+ | | 2014-11-19 | ||
+ | | [https://www.yeastgenome.org/locus/ARS1307.5 ARS1307.5] <br> | ||
+ | ARS1307.5 was added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2. <br> <br> | ||
+ | '''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text] | ||
+ | |- | ||
+ | | 2014-11-19 | ||
+ | | [https://www.yeastgenome.org/locus/ZOD1 ZOD1] <br> | ||
+ | ZOD1 was added to genome annotation and assigned chromosomal coordinates based on Guffanti et al. 2006 as part of SGD's genome annotation revision R64.2. <br> <br> | ||
+ | '''Guffanti E, et al.''' (2006) Nucleosome Depletion Activates Poised RNA Polymerase III at Unconventional Transcription Sites in Saccharomyces cerevisiae. J Biol Chem 281(39):29155-64. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000117010 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16816405 PubMed] | [http://www.jbc.org/content/281/39/29155.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2014-11-19 | ||
+ | | [https://www.yeastgenome.org/locus/ETC5 ETC5] <br> | ||
+ | ETC5 was added to the genome annotation as a nuclear matrix attachment site based on Hiraga et al. 2012 as part of SGD's genome annotation revision R64.2. <br> <br> | ||
+ | '''Hiraga SI, et al.''' (2012) FIIIC localizes budding yeast ETC sites to the nuclear periphery. Mol Biol Cell 23(14):2741-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000149071 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/22496415 PubMed] | [https://www.molbiolcell.org/doi/10.1091/mbc.e11-04-0365 Full-Text]<br> | ||
+ | |- | ||
+ | | 2009-05-08 | ||
+ | | [https://www.yeastgenome.org/locus/ARS1304 ARS1304], [https://www.yeastgenome.org/locus/ARS1317 ARS1317], [https://www.yeastgenome.org/locus/ARS1319 ARS1319], [https://www.yeastgenome.org/locus/ARS1321 ARS1321], [https://www.yeastgenome.org/locus/ARS1322 ARS1322], [https://www.yeastgenome.org/locus/ARS1331 ARS1331], [https://www.yeastgenome.org/locus/ARS1333 ARS1333], [https://www.yeastgenome.org/locus/ARS1335 ARS1335] <br> | ||
+ | The following ARS elements on Chromosome 13 were added to the genome annotation based on Raveendranathan et al. 2006: ARS1304, ARS1317, ARS1319, ARS1321, ARS1322, ARS1331, ARS1333, and ARS1335. <br> <br> | ||
+ | '''Raveendranathan M, et al.''' (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000117571 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16888628 PubMed] | [https://www.embopress.org/cgi/doi/10.1038/sj.emboj.7601251 Full-Text]<br> | ||
+ | |- | ||
+ | | 2007-07-10 | ||
+ | | [https://www.yeastgenome.org/locus/YMR242C YMR242C] <br> | ||
+ | The start of ORF RPL20A/YMR242C was moved 23 nt upstream, and the 5' end of the intron was moved 32 nt upstream, based on Miura et al. 2006, Zhang et al. 2007, and GenBank EF138821. The ORF had been annotated as 973 nt long with a 436-nt intron (178 aa), but is now 996 nt long with a 477-nt intron (172 aa). <br> <br> | ||
+ | '''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br> | ||
+ | '''Zhang Z, et al.''' (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000121920 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17351133 PubMed] | [https://genome.cshlp.org/content/17/4/503 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=17351133&db=pmid YFGdb]<br> | ||
+ | |- | ||
+ | | 2007-07-10 | ||
+ | | [https://www.yeastgenome.org/locus/YML036W YML036W] <br> | ||
+ | The stop of ORF CGI121/YML036W was moved 82 nt downstream and an intron was added at relative coordinates 457..562 based on GenBank EF123129, Juneau et al. 2007, and Miura et al. 2006. The ORF had been annotated as 570 nt long (189 aa), but is now 652 nt in length with a 106-nt intron (181 aa). <br> <br> | ||
+ | '''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br> | ||
+ | '''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000120506 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17244705 PubMed] | [https://www.pnas.org/content/104/5/1522.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2007-07-10 | ||
+ | | [https://www.yeastgenome.org/locus/snR78 snR78] <br> | ||
+ | Updated coordinates of snR78 based on GenBank AJ010801. Extended 3' end by 1 nt. <br> <br> | ||
+ | '''Qu LH, et al.''' (1999) Seven novel methylation guide small nucleolar RNAs are processed from a common polycistronic transcript by Rat1p and RNase III in yeast. Mol Cell Biol 19(2):1144-58. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000041297 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9891049 PubMed] | [https://mcb.asm.org/content/19/2/1144 Full-Text] <br> | ||
+ | |- | ||
+ | | 2006-10-05 | ||
+ | | [https://www.yeastgenome.org/locus/snR86 snR86] <br> | ||
+ | This snoRNA gene, snR86, was identified by Torchet et al. Many thanks to Wayne Decatur and Dorota Piekna-Przybylska for alerting us to this new gene. <br> <br> | ||
+ | '''Torchet C, et al.''' (2005) The complete set of H/ACA snoRNAs that guide rRNA pseudouridylations in Saccharomyces cerevisiae. RNA 11(6):928-38. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000081894 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/15923376 PubMed] | [https://rnajournal.cshlp.org/content/11/6/928.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2006-09-07 | ||
+ | | [https://www.yeastgenome.org/locus/ARS1303 ARS1303], [https://www.yeastgenome.org/locus/ARS1305 ARS1305], [https://www.yeastgenome.org/locus/ARS1307 ARS1307], [https://www.yeastgenome.org/locus/ARS1308 ARS1308], [https://www.yeastgenome.org/locus/ARS1309 ARS1309], [https://www.yeastgenome.org/locus/ARS1310 ARS1310], [https://www.yeastgenome.org/locus/ARS1312 ARS1312], [https://www.yeastgenome.org/locus/ARS1316 ARS1316], [https://www.yeastgenome.org/locus/ARS1320 ARS1320], [https://www.yeastgenome.org/locus/ARS1323 ARS1323], [https://www.yeastgenome.org/locus/ARS1324 ARS1324], [https://www.yeastgenome.org/locus/ARS1325 ARS1325], [https://www.yeastgenome.org/locus/ARS1327 ARS1327], [https://www.yeastgenome.org/locus/ARS1328 ARS1328], [https://www.yeastgenome.org/locus/ARS1329 ARS1329], [https://www.yeastgenome.org/locus/ARS1330 ARS1330], [https://www.yeastgenome.org/locus/ARS1332 ARS1332] <br> | ||
+ | The following new ARS elements on Chromosome XIII were added to SGD based on Nieduszynski et al. 2006: ARS1303, ARS1305, ARS1307, ARS1308, ARS1309, ARS1310, ARS1312, ARS1316, ARS1320, ARS1323, ARS1324, ARS1325, ARS1327, ARS1328, ARS1329, ARS1330, ARS1332. <br> <br> | ||
+ | '''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000117321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] | [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br> | ||
+ | |- | ||
+ | | 2006-05-10 | ||
+ | | [https://www.yeastgenome.org/locus/YMR059W YMR059W] <br> | ||
+ | The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported their proposal., so the start codon for SEN15/YMR059W was moved 60 nt (20 amino acids) downstream. <br> <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br> |
Revision as of 10:42, 2 October 2019
This page lists all sequence and annotation changes that have been made to the Chromosome XIII systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome XIII has been updated 13 times, affecting 16 features.
- The annotation of Chromosome XIII has been updated 32 times, affecting 70 features.
- Current and past versions can be obtained from SGD's Download site.
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YMR290W-A | 851740 | 851740 | Substitution | G | A |
851734 | 851734 | Substitution | G | A | ||
Nucleotide change(s) in the coding region of YMR290W-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 105-107 are now KKK rather than RKR.
New 851700 TAAAGCTAATATTGAAAAAAAAAAAAAAAAAAAAAAGAAAAAGCAAATAAAAAATTTTCA 851759 ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| Old 851699 TAAAGCTAATATTGAAAAAAAAAAAAAAAAAAAAAGGAAAAGGCAAATAAAAAATTTTCA 851758 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YMR299C | 864682 | 864682 | Substitution | G | T |
Nucleotide change(s) in the coding region of DYN3/YMR299C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 223 is now Lysine rather than Threonine.
New 864660 TCGGTATTAATATCTCACTGCGTTTGACCATTTCAATATGATCTTTCATATCTCTATCTT 864719 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old 864659 TCGGTATTAATATCTCACTGCGTGTGACCATTTCAATATGATCTTTCATATCTCTATCTT 864718 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YMR317W | 908172 | 908183 | Substitution | TCAGTGAGTTCG | GTAATTAGTTCA |
908194 | 908201 | Substitution | CGTCAACA | GGGCAACG | ||
908216 | 908216 | Substitution | T | C | ||
Nucleotide change(s) in the coding region of YMR317W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 271-279 are now VISSEASWA rather than SVSSEASSS.
New 908160 CGGCAACGTCTAGCGTAATTAGTTCAGAAGCTTCATGGGCAACGTCTAGCTCAGTGAGCTCGGAAGCTCC 908229 |||||||||||||| | | ||||| |||||||||| | |||| |||||||||||||| ||||||||||| Old 908158 CGGCAACGTCTAGCTCAGTGAGTTCGGAAGCTTCATCGTCAACATCTAGCTCAGTGAGTTCGGAAGCTCC 908227 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YMR262W | 794225 | 794225 | Substitution | G | C |
Nucleotide change(s) in the coding region of YMR262W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 167 is now Cysteine rather than Tryptophan.
New 794220 ATTTTGCCGACTGGCAAGGCACACAAGCAAGCCCATCTCTATACACGATGTAAAGTGCCA 794279 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 794219 ATTTTGGCGACTGGCAAGGCACACAAGCAAGCCCATCTCTATACACGATGTAAAGTGCCA 794278 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YMR008C, YMR009W | 283468 | 283468 | Insertion | G | |
A single nucleotide was inserted in the intergenic region between ORFs PLB1/YMR008C and ADI1/YMR009W.
New 283440 GAAATATCGGAGTCTTGCTATTGTTCAGGGCTTTGCCGGTGCGTAAATAATAGGCTGAAG 283499 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old 283440 GAAATATCGGAGTCTTGCTATTGTTCAGG-CTTTGCCGGTGCGTAAATAATAGGCTGAAG 283498 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YML131W, YML132W | 9542 | 9542 | Deletion | T | |
A single nucleotide was deleted from the intergenic region between ORFs COS3/YML132W and YML131W.
New 9531 TTTTTTTTTTT-GCCTTCTTCATACTTTTACTCCTGCTTTTATTACTCTAAATTTCATTTTTATTTATTC 9599 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 9531 TTTTTTTTTTTTGCCTTCTTCATACTTTTACTCCTGCTTTTATTACTCTAAATTTCATTTTTATTTATTC 9600 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YMRCtau3, YMRWdelta20 | 808976 | 808976 | Substitution | A | T |
A single nucleotide substitution was made in the intergenic region between LTRs YMRCtau3 and YMRWdelta20.
New 808920 TGATTTGCGCAACGCAGATACAGATTTTACTTTATTCTTCGTGCCTAAAATGGACCATCGTTTCACTTAC 808989 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 808919 TGATTTGCGCAACGCAGATACAGATTTTACTTTATTCTTCGTGCCTAAAATGGACCAACGTTTCACTTAC 808988 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YML121W, YML122C | 26602 | 26602 | Insertion | T | |
A single nucleotide was inserted in the intergenic region between ORFs YML122C and GTR1/YML121W.
New 26580 TTTTATTGAATCTTTTTTTTTTTGTAAGAAAATTAAGGTTTATTAGGCAGAGTATACCGA 26639 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 26581 TTTTATTGAATCTTTTTTTTTT-GTAAGAAAATTAAGGTTTATTAGGCAGAGTATACCGA 26639 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YMR315W-A, YMR316W | 904639 | 904639 | Insertion | G | |
A single nucleotide was inserted in the intergenic region between ORFs YMR315W-A and DIA1/YMR316W.
New 904620 TTCTTTTTTTTGGCGCAGCAAGGGACAATGGTCCCTTTTTGAGAAAATGTTGTAGGCTTG 904679 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 904619 TTCTTTTTTTTGGCGCAGCAA-GGACAATGGTCCCTTTTTGAGAAAATGTTGTAGGCTTG 904677 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2004-02-28 | YMR268W-A, YMR269W | 804684 | 804684 | Deletion | C | |
Deleted C at 804684 and moved YMR269W start 208 bp upstream from 804663 (old YMR269W start) to 804455 (YMR268W-A start) based on Brachat et al. 2003. This resulted in the merge of YMR268W-A, which was added in June 2003 based on Kessler et al. 2003, into YMR269W. As a result of this sequence correction and locus merge, the YMR269W protein increases in size from 142 amino acids to 211 amino acids, and YMR268W-A is no longer considered a separate ORF.
New: 181 AACCTGGATGTAAGCACTGATTCGAATAATGGCAGTATTAAATTTACTC-AAAATGAGGC 239 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old: 804635 AACCTGGATGTAAGCACTGATTCGAATAATGGCAGTATTAAATTTACTCCAAAATGAGGC 804694 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. |
Annotation Changes without sequence changes
Date | Affected Features |
---|---|
2014-11-19 | ARS1304, ARS1307, ARS1307.5, ARS1308, ARS1309, ARS1312, ARS1316, ARS1320, ARS1323, ARS1325, ARS1327, ARS1329, ARS1330, ARS1332 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome XIII based on Liachko et al. 2013: ARS1304, ARS1307, ARS1307.5, ARS1308, ARS1309, ARS1312, ARS1316, ARS1320, ARS1323, ARS1325, ARS1327, ARS1329, ARS1330, ARS1332. |
2014-11-19 | ARS1303, ARS1308, ARS1310, ARS1312, ARS1324, ARS1329, ARS1332 The chromosomal coordinates of the following ARS elements on Chromosome XIII were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1303, ARS1308, ARS1310, ARS1312, ARS1324, ARS1329, ARS1332. |
2014-11-19 | ARS1307.5 ARS1307.5 was added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2. |
2014-11-19 | ZOD1 ZOD1 was added to genome annotation and assigned chromosomal coordinates based on Guffanti et al. 2006 as part of SGD's genome annotation revision R64.2. |
2014-11-19 | ETC5 ETC5 was added to the genome annotation as a nuclear matrix attachment site based on Hiraga et al. 2012 as part of SGD's genome annotation revision R64.2. |
2009-05-08 | ARS1304, ARS1317, ARS1319, ARS1321, ARS1322, ARS1331, ARS1333, ARS1335 The following ARS elements on Chromosome 13 were added to the genome annotation based on Raveendranathan et al. 2006: ARS1304, ARS1317, ARS1319, ARS1321, ARS1322, ARS1331, ARS1333, and ARS1335. |
2007-07-10 | YMR242C The start of ORF RPL20A/YMR242C was moved 23 nt upstream, and the 5' end of the intron was moved 32 nt upstream, based on Miura et al. 2006, Zhang et al. 2007, and GenBank EF138821. The ORF had been annotated as 973 nt long with a 436-nt intron (178 aa), but is now 996 nt long with a 477-nt intron (172 aa). |
2007-07-10 | YML036W The stop of ORF CGI121/YML036W was moved 82 nt downstream and an intron was added at relative coordinates 457..562 based on GenBank EF123129, Juneau et al. 2007, and Miura et al. 2006. The ORF had been annotated as 570 nt long (189 aa), but is now 652 nt in length with a 106-nt intron (181 aa). |
2007-07-10 | snR78 Updated coordinates of snR78 based on GenBank AJ010801. Extended 3' end by 1 nt. |
2006-10-05 | snR86 This snoRNA gene, snR86, was identified by Torchet et al. Many thanks to Wayne Decatur and Dorota Piekna-Przybylska for alerting us to this new gene. |
2006-09-07 | ARS1303, ARS1305, ARS1307, ARS1308, ARS1309, ARS1310, ARS1312, ARS1316, ARS1320, ARS1323, ARS1324, ARS1325, ARS1327, ARS1328, ARS1329, ARS1330, ARS1332 The following new ARS elements on Chromosome XIII were added to SGD based on Nieduszynski et al. 2006: ARS1303, ARS1305, ARS1307, ARS1308, ARS1309, ARS1310, ARS1312, ARS1316, ARS1320, ARS1323, ARS1324, ARS1325, ARS1327, ARS1328, ARS1329, ARS1330, ARS1332. |
2006-05-10 | YMR059W The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported their proposal., so the start codon for SEN15/YMR059W was moved 60 nt (20 amino acids) downstream. |