Difference between revisions of "Chromosome XII History"
(→Annotation Changes without sequence changes) |
(→Annotation Changes without sequence changes) |
||
Line 610: | Line 610: | ||
'''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br> | '''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br> | ||
[https://www.yeastgenome.org/reference/S000073671 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] | [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br> | [https://www.yeastgenome.org/reference/S000073671 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] | [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2003-07-29 | ||
+ | | [https://www.yeastgenome.org/locus/YLR307C-A YLR307C-A] <br> | ||
+ | Thanks to Brachat et al. for providing the coordinates of YLR307C-A.<br><br> | ||
+ | '''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br> | ||
+ | |- | ||
+ | | 2003-07-29 | ||
+ | | [https://www.yeastgenome.org/locus/YLR154W-F YLR154W-F], [https://www.yeastgenome.org/locus/YLR163W-A YLR163W-A], [https://www.yeastgenome.org/locus/YLR361C-A YLR361C-A], [https://www.yeastgenome.org/locus/YLR364C-A YLR364C-A] <br> | ||
+ | Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XII ORFs: YLR154W-F, YLR163W-A, YLR361C-A, and YLR364C-A.<br><br> | ||
+ | '''Basrai MA, et al.''' (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000042214 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10490641 PubMed] | [https://mcb.asm.org/content/19/10/7041.long Full-Text] <br> | ||
+ | '''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br> | ||
+ | '''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073672 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] | [https://genome.cshlp.org/content/12/8/1210.long Full-Text] | [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br> | ||
+ | |- | ||
+ | | 2001-03-09 | ||
+ | | [https://www.yeastgenome.org/locus/snR79 snR79] <br> | ||
+ | Changed from W -> C: old start coord: 348428; old stop coord: 348511 new start coord: 348511; new stop coord: 348428 (Eric Steinmetz, personal communication; Qu et al.)<br><br> | ||
+ | '''Qu LH, et al.''' (1999) Seven novel methylation guide small nucleolar RNAs are processed from a common polycistronic transcript by Rat1p and RNase III in yeast. Mol Cell Biol 19(2):1144-58. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000041297 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9891049 PubMed] | [https://mcb.asm.org/content/19/2/1144 Full-Text] <br> | ||
+ | |- | ||
+ | | 2000-08-11 | ||
+ | | [https://www.yeastgenome.org/locus/YLR337C YLR337C] <br> | ||
+ | Old name: YLR337W; new name: YLR337C; date: 2/10/2000; old coord: ChrXII; SGDID: Unknown; old change found in mips.<br><br>' | ||
+ | |- | ||
+ | | 2000-07-22 | ||
+ | | [https://www.yeastgenome.org/locus/YLR316C YLR316C] <br> | ||
+ | The start site of YLR316C was moved 601 nucleotides upstream, and at the same time two separate introns were added at new relative coordinates 110-177 and 230-285. ''The chromosomal coordinates for the coding region have changed from 765755-765264 to 766357-766249..766180-766129..766072-765265.''<br><br> | ||
+ | |- | ||
+ | | 2000-07-14 | ||
+ | | [https://www.yeastgenome.org/locus/YLR211C YLR211C] <br> | ||
+ | The start site of YLR211C was moved 317 nucleotides upstream, and at the same time an intron was added at relative coordinates 19-77. ''The old chromosomal coordinates of the coding sequence were 564213-563791, and the new chromosomal coordinates of the coding sequence are now 564531-564514..564454-563792.''<br><br> | ||
+ | |- | ||
+ | | 2000-07-14 | ||
+ | | [https://www.yeastgenome.org/locus/YLR093C YLR093C] <br> | ||
+ | The start site of YLR093C was moved 147 nucleotides upstream, and at the same time an intron was added at relative coordinates 17-157. ''The chromosomal coordinates for the coding region have changed from 327268-326513 to 327416-327401..327259-326514.''<br><br> | ||
+ | |- | ||
+ | | 1999-07-17 | ||
+ | | [https://www.yeastgenome.org/locus/YLR362W YLR362W] <br> | ||
+ | The start site of YLR362W was moved 63 nucleotides downstream.<br><br> | ||
+ | |- | ||
+ | | 1999-07-17 | ||
+ | | [https://www.yeastgenome.org/locus/YLR406C YLR406C] <br> | ||
+ | The intron of YLR406C was moved 2 nucleotides downstream, changing the relative coordinates of the coding sequence from 1-55..405-691 to 1-57..407-691, and amino acid 19 from lysine to arginine.<br><br> | ||
+ | |- | ||
+ | | 1998-05-21 | ||
+ | | [https://www.yeastgenome.org/locus/YLL018C-A YLL018C-A], [https://www.yeastgenome.org/locus/YLR262C-A YLR262C-A] <br> | ||
+ | The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. <br><br> | ||
+ | The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.<br><br> | ||
+ | '''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br> | ||
+ | |- | ||
+ | | 1997-07-30 | ||
+ | | [https://www.yeastgenome.org/locus/YLR390W-A YLR390W-A], [https://www.yeastgenome.org/locus/YLR391W YLR391W] <br> | ||
+ | YLR391W was an ORF that was named in the original sequence of Chromosome XII. Since it was completely contained in a larger ORF with a better codon bias, it was deleted from SGD and GenBank in favor of the larger ORF, YLR391W-A.<br><br> |
Revision as of 09:57, 2 October 2019
This page lists all sequence and annotation changes that have been made to the Chromosome XII systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome XII has been updated 28 times, affecting 34 features.
- The annotation of Chromosome XII has been updated 38 times, affecting 94 features.
- Current and past versions can be obtained from SGD's Download site.
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YLR407W | 933639 | 933639 | Insertion | G | |
A single G nucleotide was inserted within the ORF YLR407W near its 3' end, altering its coding sequence. The start and vast majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now one amino acid shorter.
New 933597 AATGCAGGCTGGACGGAAACGAGAAAGTGGGCTAATGCTGCCAAGGGCATGCCATGACTG 933656 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 933596 AATGCAGGCTGGACGGAAACGAGAAAGTGGGCTAATGCTGCCAA-GGCATGCCATGACTG 933654 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR402W | 924691 | 924691 | Insertion | G | |
A single G nucleotide was inserted within the ORF YLR402W near its 5' end, necessitating a change in annotation to a downstream start codon. The sequence change makes the longer version of the protein no longer possible in the reference sequence. The stop and reading frame remain the same, but the annotated protein is now 108 amino acids shorter, less than half its original size.
New: 924657 TTAAGTCTCTTCATCCCGTGTACTATTACCCGACAGGTTTCTGCGGCATGTTCTGTGGAA 924716 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old: 924657 TTAAGTCTCTTCATCCCGTGTACTATTACCCGACA-GTTTCTGCGGCATGTTCTGTGGAA 924715 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLL054C | 32902 | 32902 | Insertion | A | |
A single nucleotide was inserted very near the 3' end of ORF YLL054C, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 74 amino acids longer.
New 32881 AATTGTGGATTGTTTAATTTTGATGTGAACGAAAAGGACTTATCCCTTCCCATACCCCAT 32940 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 32881 AATTGTGGATTGTTTAATTTTG-TGTGAACGAAAAGGACTTATCCCTTCCCATACCCCAT 32939 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR313C | 760764 | 760764 | Insertion | CC | |
A GG dinucleotide was inserted within the ORF SPH1/YLR313C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 131 amino acids shorter.
New 760738 CTTGAACATCATTCAAAATGCCCTGCCTGCCATAGGAAGAACAACCATTGATTTACTCTC 760797 ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 760740 CTTGAACATCATTCAAAATGCCCTG--TGCCATAGGAAGAACAACCATTGATTTACTCTC 760797 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR314C | 762846 | 762846 | Substitution | A | T |
Nucleotide change(s) in the coding region of CDC3/YLR314C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 431 is now Glutamine rather than Leucine.
New 762828 TGTAAAGTTTTTTCTTCTTGTTGTTTAGATATTGGATCGAACTCTTTGAAAACTGAATTATCTTGCTTAA 762897 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Old 762828 TGTAAAGTTTTTTCTTCTAGTTGTTTAGATATTGGATCGAACTCTTTGAAAACTGAATTATCTTGCTTAA 762897 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR318W | 767026 | 767027 | Substitution | TC | CT |
Nucleotide change(s) in the coding region of EST2/YLR318W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 162 is now Alanine rather than Valine.
New 766978 AAATCGTGGGTAACAGATGTAACGAACCTCATCTGCCGCCCAAATGGGCTCAACGATCATCCTCATCATC 767047 |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old 766978 AAATCGTGGGTAACAGATGTAACGAACCTCATCTGCCGCCCAAATGGGTCCAACGATCATCCTCATCATC 767047 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR024C, YLR025W | 193483 | 193483 | Substitution | A | C |
A single nucleotide substitution was made in the intergenic region between ORFs UBR2/YLR024C and SNF7/YLR025W.
New 193439 ATTGAAAGTATGAATGCGTTGATTATTGGGTTTCTCCCCACAGCTGTACATTGACGATGC 193498 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 193440 ATTGAAAGTATGAATGCGTTGATTATTGGGTTTCTCCCCACAGATGTACATTGACGATGC 193499 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR023C, YLR024C | 187423 | 187423 | Deletion | A | |
187394 | 187394 | Deletion | A | |||
Two separate single nucleotide deletions were made in the intergenic region between ORFs IZH3/YLR023C and UBR2/YLR024C.
New 187381 ACCTTATCCATCAA-CACTTTCTCCATTTCCTGCAGGGTAAAA-AGAAAAGTGAAGTCAC 187438 |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| Old 187380 ACCTTATCCATCAAACACTTTCTCCATTTCCTGCAGGGTAAAAAAGAAAAGTGAAGTCAC 187439 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR412C-A, YLR412W | 949230 | 949230 | Insertion | C | |
A single nucleotide insertion was made in the intergenic region bewteen ORFs BER1/YLR412W and YLR412C-A.
New 949197 TCATTCACTACATAGTACTTTATAACTAAACTGTAACCTTTCAGGGCATCGTAACCTGAC 949256 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 949195 TCATTCACTACATAGTACTTTATAACTAAACTGTAA-CTTTCAGGGCATCGTAACCTGAC 949253 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR346C, YLR347C | 822958 | 822958 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs YLR346C and KAP95/YLR347C.
New 822948 TCAGCAGGTGCGGCTGTGCCTTTTCACTTTCAGCTAAGATGTTTGCAAGCAAGAATTAACAGATAAGCCG 823017 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 822948 TCAGCAGGTGC-GCTGTGCCTTTTCACTTTCAGCTAAGATGTTTGCAAGCAAGAATTAACAGATAAGCCG 823016 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR451W, YLR452C | 1038769 | 1038769 | Deletion | C | |
A single nucleotide deletion was made in the intergenic region between ORFs LEU3/YLR451W and SST2/YLR452C.
New 1038716 TTTTAATGAATGAATTTGCGTTCAATCCCAAGGTTTAAAGTCCTTTTCTTTTTTTG-CGTAATGTTTACT 1038784 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 1038713 TTTTAATGAATGAATTTGCGTTCAATCCCAAGGTTTAAAGTCCTTTTCTTTTTTTGCCGTAATGTTTACT 1038782 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR449W, YLR450W | 1032533 | 1032533 | Deletion | G | |
A single nucleotide deletion was made in the intergenic region between ORFs FPR4/YLR449W and HMG2/YLR450W.
New 1032527 GTTATAGTAA-GACACTTCAGTGAGAAATTAATCTGACTTACTTTTACTTAATTGTGTTCTTTCCAAATT 1032595 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 1032523 GTTATAGTAAGGACACTTCAGTGAGAAATTAATCTGACTTACTTTTACTTAATTGTGTTCTTTCCAAATT 1032592 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR447C, YLR448W | 1028607 | 1028607 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs VMA6/YLR447C and RPL6B/YLR448W.
New 1028577 TAACCTGGACTTGCCGTGCTAAGTCGGCCTTCTAGGCTGCGCTTCCGTTCAGCATCGTTT 1028636 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 1028574 TAACCTGGACTTGCCGTGCTAAGTCGGCCTTCTA-GCTGCGCTTCCGTTCAGCATCGTTT 1028632 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR024C | 192416 | 192416 | Substitution | C | T |
A single nucleotide substitution was made within ORF UBR2/YLR024C. Note that the protein sequence was not changed.
New 192359 TCTTCTAAAGCCTTCGTTATTGAGATTGCATATTCAACCGGTGTATTCAAAATTCTTGTTATTGTAGATG 192428 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 192360 TCTTCTAAAGCCTTCGTTATTGAGATTGCATATTCAACCGGTGTATTCAAAATTCTCGTTATTGTAGATG 192429 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR034C | 210771 | 210771 | Substitution | A | T |
A single nucleotide substitution was made within ORF SMF3/YLR034C. Note that the protein sequence was not changed.
New 210719 ATGAACAACCATCAACTTTCTATTTGCGGTAAAATAAATTAAAGGAGCGGATACGATTGGTAAAATTAAG 210788 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 210720 ATGAACAACCATCAACTTTCTATTTGCGGTAAAATAAATTAAAGGAGCGGAAACGATTGGTAAAATTAAG 210789 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR162W-A, YLR163C | 491154 | 491154 | Deletion | C | |
A single nucleotide deletion was made in the intergenic region between ORFs RRT15/YLR162W-A and MAS1/YLR163C.
New 491099 TGAAGAGGTAGGTACATATTCATTGGCAGATATTCTACAATGCAATTATTATGA-CCAATCACACAGTAT 491167 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 491100 TGAAGAGGTAGGTACATATTCATTGGCAGATATTCTACAATGCAATTATTATGACCCAATCACACAGTAT 491169 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR378C, YLR380W | 878171 | 878171 | Deletion | G | |
A single nucleotide deletion was made in the intergenic region between ORFs SEC61/YLR378C and CSR1/YLR380W.
New 878158 AAATCTTGGCACTT-GTCACTTACGCTCCTTTAAACAAAATCAAACATACAAATATACGG 878216 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 878157 AAATCTTGGCACTTGGTCACTTACGCTCCTTTAAACAAAATCAAACATACAAATATACGG 878216 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR277C, YLR278C | 699963 | 699963 | Substitution | G | A |
A single nucleotide substitution was made in the intergenic region between ORFs YSH1/YLR277C and YLR278C.
New 699948 AAAAAAAAAAAAAAGGAATGAGTTTGTACATACTATTATATTAATGTAGTATCACGTTAAAAAGCCGTAG 700017 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 699950 AAAAAAAAAAAAAGGGAATGAGTTTGTACATACTATTATATTAATGTAGTATCACGTTAAAAAGCCGTAG 700019 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR309C | 750224 | 750224 | Substitution | C | T |
A single nucleotide substitution was made within ORF IMH1/YLR309C. Note that the protein sequence was not changed.
New 750178 TCACTAAATTGTTTAACTTGTTCCTCCAAGTAACTCACAGTTTTTTCCTTTTGTTTATAA 750237 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 750180 TCACTAAATTGTTTAACTTGTTCCTCCAAGTAACTCACAGTTTTCTCCTTTTGTTTATAA 750239 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2006-01-09 | YLR401C | 922648 | 922648 | Insertion | G | |
Based on the automated comparison of related fungi, Kellis et al. and Brachat et al. suggest that the stop site for YLR401C be moved 176 nt downstream. SGD confirmed the insertion of a single G nt. and have updated the systematic sequence accordingly. As a consequence of this sequence change, DUS3/YLR401C was extended on the 3' end, altering the C-terminus and increasing the size of the predicted protein from 609 to 668 amino acids.
New: 922634 ACAAATACCCATGGGGACATACCTATGAAAAA 922665 ||||||||||||||| |||||||||||||||| Old: 922634 ACAAATACCCATGGG-ACATACCTATGAAAAA 922664 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-02-05 | YLR205C | 553633 | 553633 | Insertion | C | |
553548 | 553548 | Insertion | G | |||
Brachat et al. 2003 predicted and confirmed the insertion of two nucleotides in Chromosome XII - a G after the G at 553548, and a C after the C at 553633. As a consequence of these sequence changes, HMX1/YLR205C was extended at the 5' end, increasing the size of the protein from 273 amino acids to 317 amino acids.
New: ACATAATAGTACGCCAGAATACCCTGTCTGTATATAAAGCCATGTCTCATGGCGATGGCC ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Old: 553498 ACATAATAGTACGCCAGAATACCCTGTCTGTATATAAAGCCATGTCTCATG-CGATGGCC 553556 New: CTGTTTGCTAGCGCCCCCACGTCAGTGGGTGAGGGTATGATTGTATTGCTACTGTCCTCC ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old: 553617 CTGTTTGCTAGCGCCCC-ACGTCAGTGGGTGAGGGTATGATTGTATTGCTACTGTCCTCC 553675 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. | ||||||
2004-02-04 | YLR389C | 899751 | 899751 | Insertion | T | |
Brachat et al. 2003 predicted and confirmed the insertion of a single T nucleotide in YLR389C. As a consequence of this sequence change, YLR389C was extended at the 3' end, increasing the size of the predicted protein from 988 amino acids to 1027 amino acids.
Query: GCTCTTTGTTTTCCACTTGAGATTTCAAATGTAGAATCAACTTCGATGCGTTCTCGCTCA ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 899741 GCTCTTTGTTT-CCACTTGAGATTTCAAATGTAGAATCAACTTCGATGCGTTCTCGCTCA 899799 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. | ||||||
2004-02-04 | YLR312C-B, YLR313C | 760763 | 760764 | Deletion | CC | |
Roemer et al confirmed the deletion of two C nucleotides in SPH1/YLR313C in an S288C strain background. As a consequence of this sequence change, SPH1/YLR313C was extended at the 3' and merged with an adjacent ORF, YLR312C-B, that was in the same frame. This change increased the size of the Sph1p from 530 amino acids to 661 amino acids. Roemer et al also confirmed other laboratory strain backgrounds, such as W303-derived strains, do have the additional two nucleotides and encode the shorter protein.
New: CTTGAACAATTTTGATTTAGAGGCTTGAACATCATTCAAAATGCCCTG--TGCCATAGGA |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 760715 CTTGAACAATTTTGATTTAGAGGCTTGAACATCATTCAAAATGCCCTGCCTGCCATAGGA 760774 Roemer T, et al. (1998) The Spa2-related protein, Sph1p, is important for polarized growth in yeast. J Cell Sci 111 ( Pt 4)():479-94. | ||||||
2001-06-12 | YLR312W-A | 759511 | 759511 | Insertion | C | |
Inserted one C nucleotide after the C at chromosomal coordinate 759511. This insertion is in the intron of YLR312W-A and therefore does not affect YLR312W-A translation.
Old: 759481 TGGAAAATAGCATGATGTTTATATCGCGTTC-TTGCGGAGACCCGTTACTGCTTTGAACT 759539 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| New: 759481 TGGAAAATAGCATGATGTTTATATCGCGTTCCTTGCGGAGACCCGTTACTGCTTTGAACT 759540 Kitakawa M, et al. (1997) Identification and characterization of the genes for mitochondrial ribosomal proteins of Saccharomyces cerevisiae. Eur J Biochem 245(2):449-56. | ||||||
1997-07-30 | YLR028C | 199680 | 199680 | Insertion | T | |
A single T nucleotide was inserted before the T at chromosomal coordinate 199680 within the ORF ADE16/YLR028C. At the same time this sequence change was made, the stop site for YLR028C was moved downstream 110 nucleotides.
New: 199649 CTTTACACCAGACTGCACAGCTCTATAAACGTTGTCTGGGAAGGGAAAGAACGCATCGGA 199708 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Old: 199649 CTTTACACCAGACTGCACAGCTCTATAAACGT-GTCTGGGAAGGGAAAGAACGCATCGGA 199707 Note that this ORF is on the Crick strand, which is complementary to the sequence shown above. |
Annotation Changes without sequence changes
Date | Affected Features |
---|---|
2014-11-19 | ARS1206, ARS1208, ARS1211, ARS1212, ARS1215, ARS1216, ARS1217, ARS1218, ARS1220, ARS1223, ARS1226, ARS1232, ARS1233, ARS1235, ARS1238 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome XII based on Liachko et al. 2013: ARS1206, ARS1208, ARS1211, ARS1212, ARS1212.5, ARS1216, ARS1217, ARS1218, ARS1220, ARS1223, ARS1226, ARS1238, ARS1232, ARS1233, ARS1235. |
2014-11-19 | ARS1212, ARS1213, ARS1215, ARS1218, ARS1220, ARS1226, ARS1234 The chromosomal coordinates of the following ARS elements on Chromosome XII were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1212, ARS1213, ARS1215, ARS1218, ARS1220, ARS1226, ARS1234. |
2014-11-19 | ARS1210, ARS1212.5, ARS1235 The following new ARS elements on Chromosome XII were added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1210, ARS1212.5, ARS1235. |
2009-05-08 | ARS1202, ARS1207, ARS1214, ARS1219, ARS1221, ARS1228, ARS1230 The following ARS elements on Chromosome 12 were added to the genome annotation based on Raveendranathan et al. 2006: ARS1202, ARS1207, ARS1214, ARS1219, ARS1221, ARS1228, and ARS1230. |
2007-05-10 | snR34 Updated coordinates of snR34 based on Samarsky et al. 1995 and GenBank L33802. Old coordinates were 898987..899536 (550 nt); new coordinates are 899180..899382 (203 nt). |
2007-05-09 | snR30 Updated coordinates of snR30 based on GenBank Z73200, Z73199. Moved 3' end downstream 5 nt. |
2007-04-04 | YLR388W RPS29A/YLR388W mRNA contains an intron in the 5' untranslated region (UTR). |
2007-04-04 | YLR367W RPS22B/YLR367W mRNA contains an intron in the 5' untranslated region (UTR). |
2007-04-04 | YLR333C RPS25B/YLR333C mRNA contains an intron in the 5' untranslated region (UTR). |
2007-04-03 | YLRWdelta24 YLRCdelta24, a Ty1 LTR on Chromosome XII, was mistakenly annotated on the wrong strand (i.e., on Crick instead of Watson). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YLRWdelta24 and is annotated on the Watson strand. The name YLRCdelta24 is being retained as an alias. |
2007-02-06 | ARS1200-1, ARS1200-2 The rDNA ARS, as two copies ARS1200-1 and ARS1200-2, is being added to the genome annotation based on Miller & Kowalski 1993. |
2006-10-03 | YLR312W-A Based on N-terminal sequencing by Kitakawa et al., the intron and first exon have been removed from the annotation of MRPL15/YLR312W-A. The newly annotated start codon is located 97 nt downstream of the originally annotated start, within what was previously annotated as intron sequence. Special Thanks to Ivo Pedruzzi and the team at Swiss-Prot for bringing this change to our attention. |
2006-10-02 | ARS1238 ARS1238, also known as ARS1227.5, was added to the genome annotation based on Nieduszynski et al. 2006. |
2006-09-08 | ARS1206, ARS1209, ARS1211, ARS1212, ARS1213, ARS1215,ARS1216, ARS1217, ARS1218, ARS1220, ARS1223, ARS1226, ARS1232, ARS1233, ARS1234 The following new ARS elements on Chromosome XII were added to SGD based on Nieduszynski et al. 2006: ARS1206, ARS1209, ARS1211, ARS1212, ARS1213, ARS1215, ARS1216, ARS1217, ARS1218, ARS1220, ARS1223, ARS1226, ARS1232, ARS1233, ARS1234. |
2006-04-13 | ARS1208 ARS1208, also known as "CEN12 ARS", was added to the genome annotation for Chromosome XII at coordinates 150946-151388 based on Wyrick et al. 2001 and Gammie & Rose 1995. |
2005-11-17 | YLR146W-A Based on genome sequence comparisons among six Saccharomyces species, Cliften et al. 2003 suggested that a new ORF, YLR146W-A, be added to the S. cerevisiae genome annotation. |
2004-10-12 | CEN12 The orientation of this centromere was reversed (from Watson to Crick) to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. and Espelin et al. |
2004-02-03 | YLR445W Based on analyses of homology and synteny in Ashbya gossypii, Brachat et al. proposed an intron and 3' extension for YLR445W. The resulting ORF is in the same frame with the stop codon shifted 244 bp downstream; the protein has a 54-residue extension at the C-terminus. |
2003-09-27 | YLR054C Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 5' exon for YLR054C. The resulting ORF is in the same frame, but has a 212-residue extension at the N-terminus. |
2003-09-27 | YLR199C Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 5' exon for YLR054C. The resulting ORF is in the same frame, but has a 212-residue extension at the N-terminus. |
2003-09-22 | YLR027C The start site for AAT2/YLR027C was moved 42 nt (14 codons) downstream based on automated comparison of closely related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The first ATG is not conserved in the related species; 4) Sequencing of the entire protein reported the following sequence in the amino terminus: SATLFNNIELL (Cronin VB, et al.). |
2003-09-22 | YLR012C The automated comparison of closely related Saccharomyces species suggests that the start site for YLR012C be moved 69 nt (23 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The first ATG and the translation frame are not conserved in the related species. |
2003-09-22 | YLR435W Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for TSR2/YLR435W be moved 132 nt (44 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Although S. paradoxus, S. mikatae, and S. bayanus have upstream ATGs, there are insertions and deletions which cause frame shifts in between the first and second ATGs; 4) Protein sequence comparison with the nr dataset show there are no sequence similarities between the first and second ATG. All hits occur after the 2nd ATG. |
2003-09-09 | TEL12L, TEL12R The chromosomal locations for TEL12R, TEL12R-TR1, TEL12R-TR2, TEL12R-XC, TEL12R-XR, TEL12R-YP1, TEL12R-YP2, TEL12L-YP2, TEL12L-TR2, TEL12L-XC, TEL12L-XR, TEL12L-YP1, TEL12L-TR3, TEL12L-TR1, and TEL12L were generously provided by Ed Louis and Dave Barton (University of Leicester, UK). |
2003-07-29 | YLR264C-A Thanks to MIPS for providing the coordinates of YLR264C-A. |
2003-07-29 | YLL019W-A, YLL066W-A, YLL066W-B, YLL067W-A, YLR120W-A, YLR154W-A, YLR154W-E, YLR157W-D, YLR157W-E, YLR286W-A, YLR299C-A, YLR347W-A, YLR399W-A, YLR406C-A, YLR437C-A, YLR466C-A, YLR466C-B, YLR467C-A Thanks to Kumar et al. for providing the coordinates of the following Chromosome XII ORFs: YLL019W-A, YLL066W-A, YLL066W-B, YLL067W-A, YLR406C-A, YLR437C-A, YLR466C-A, YLR466C-B, YLR467C-A, YLR120W-A, YLR154W-A, YLR154W-E, YLR157W-D, YLR157W-E, YLR286W-A, YLR299C-A, YLR347W-A, and YLR399W-A. |
2003-07-29 | YLL006W-A, YLR154C-G, YLR154C-H, YLR154W-B, YLR156C-A, YLR157C-C, YLR159C-A, YLR162W-A, YLR222C-A, YLR285C-A, YLR312C-B,, YLR342W-A, YLR412C-A Thanks to Kessler et al. for providing the coordinates of the following Chromosome XII ORFs: YLR285C-A, YLR312C-B, YLR342W-A, YLR412C-A, YLL006W-A, YLR154C-G, YLR154C-H, YLR154W-B, YLR156C-A, YLR157C-C, YLR159C-A, YLR162W-A, and YLR222C-A. |
2003-07-29 | YLR307C-A Thanks to Brachat et al. for providing the coordinates of YLR307C-A. |
2003-07-29 | YLR154W-F, YLR163W-A, YLR361C-A, YLR364C-A Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XII ORFs: YLR154W-F, YLR163W-A, YLR361C-A, and YLR364C-A. |
2001-03-09 | snR79 Changed from W -> C: old start coord: 348428; old stop coord: 348511 new start coord: 348511; new stop coord: 348428 (Eric Steinmetz, personal communication; Qu et al.) |
2000-08-11 | YLR337C Old name: YLR337W; new name: YLR337C; date: 2/10/2000; old coord: ChrXII; SGDID: Unknown; old change found in mips. |
2000-07-22 | YLR316C The start site of YLR316C was moved 601 nucleotides upstream, and at the same time two separate introns were added at new relative coordinates 110-177 and 230-285. The chromosomal coordinates for the coding region have changed from 765755-765264 to 766357-766249..766180-766129..766072-765265. |
2000-07-14 | YLR211C The start site of YLR211C was moved 317 nucleotides upstream, and at the same time an intron was added at relative coordinates 19-77. The old chromosomal coordinates of the coding sequence were 564213-563791, and the new chromosomal coordinates of the coding sequence are now 564531-564514..564454-563792. |
2000-07-14 | YLR093C The start site of YLR093C was moved 147 nucleotides upstream, and at the same time an intron was added at relative coordinates 17-157. The chromosomal coordinates for the coding region have changed from 327268-326513 to 327416-327401..327259-326514. |
1999-07-17 | YLR362W The start site of YLR362W was moved 63 nucleotides downstream. |
1999-07-17 | YLR406C The intron of YLR406C was moved 2 nucleotides downstream, changing the relative coordinates of the coding sequence from 1-55..405-691 to 1-57..407-691, and amino acid 19 from lysine to arginine. |
1998-05-21 | YLL018C-A, YLR262C-A The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. |
1997-07-30 | YLR390W-A, YLR391W YLR391W was an ORF that was named in the original sequence of Chromosome XII. Since it was completely contained in a larger ORF with a better codon bias, it was deleted from SGD and GenBank in favor of the larger ORF, YLR391W-A. |