Difference between revisions of "Chromosome IX History"
(→Annotation Changes without sequence changes) |
(→Annotation Changes without sequence changes) |
||
Line 371: | Line 371: | ||
| [https://www.yeastgenome.org/locus/ARS913 ARS913] <br> | | [https://www.yeastgenome.org/locus/ARS913 ARS913] <br> | ||
Courtesy of Prof. BiK Tye; based on Ph. D. thesis of Dr. Clarence Chan. <br><br> | Courtesy of Prof. BiK Tye; based on Ph. D. thesis of Dr. Clarence Chan. <br><br> | ||
+ | |||
+ | |- | ||
+ | | 1999-11-17 | ||
+ | | [https://www.yeastgenome.org/locus/YIL106W YIL106W] <br> | ||
+ | Spingola et al. 1999 identified an intron in YIL106W that was not previously annotated, and also identified a different start codon. The intron has been added, and the start shifted upstream. The old chromosomal coordinates for YIL106W were 166731-167441 (coding 1-711). The new chromosomal coordinates are 166412-167441 (coding 1-20..106-1030). <br><br> | ||
+ | '''Spingola M, et al.''' (1999) Genome-wide bioinformatic and molecular analysis of introns in Saccharomyces cerevisiae. RNA 5(2):221-34. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000064707 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10024174 PubMed] | [https://rnajournal.cshlp.org/content/5/2/221.long Full-Text] <br> | ||
+ | |||
+ | |- | ||
+ | | 1998-05-21 | ||
+ | | [https://www.yeastgenome.org/locus/YIR020W-A YIR020W-A] <br> | ||
+ | The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. | ||
+ | <br><br> | ||
+ | The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.<br><br> | ||
+ | '''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br> | ||
+ | |||
+ | |} |
Revision as of 14:30, 30 September 2019
This page lists all sequence and annotation changes that have been made to the Chromosome IX systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome VII has been updated 9 times, affecting 12 features.
- The annotation of Chromosome VII has been updated 232 times, affecting 63 features.
- Current and past versions can be obtained from SGD's Download site.
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | tK(CUU)I | 300235 | 300235 | Insertion | G | |
A single nucleotide was inserted near the 3' end of tK(CUU)I, altering the coding sequence and making this tRNA one nucleotide longer.
New 300179 CGTCTCTAATGATTTAATTTTTCTATTGAATTGAAAATGGTAAAAAGATAGCCCTGTAGGGGGCTCGAAC 300248 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 300178 CGTCTCTAATGATTTAATTTTTCTATTGAATTGAAAATGGTAAAAAGATAGCCCTGTA-GGGGCTCGAAC 300246 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIL012W | 333321 | 333321 | Insertion | C | |
A single C nucleotide was inserted within the ORF YIL012W near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids shorter.
New 333299 TTGGCCTTATACGAGGCGTACTTCGCCTTGCGGGAAAAAAAATTTCTTTTGTAAGCGAGG 333358 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 333297 TTGGCCTTATACGAGGCGTACTTCG-CTTGCGGGAAAAAAAATTTCTTTTGTAAGCGAGG 333355 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIL123W | 128409 | 128409 | Insertion | CT | |
128403 | 128403 | Insertion | C | |||
Three nucleotides were inserted near the 5' end of ORF SIM1/YIL123W, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
New 128401 CTGCGGATAGCTCCGCTTCCATTGCTGTTTCATCTGCTGCCTTAGCCAAGAATGAGAAAA 128460 ||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 128401 CTG-GGATAG--CCGCTTCCATTGCTGTTTCATCTGCTGCCTTAGCCAAGAATGAGAAAA 128457 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIL083C | 203638 | 203638 | Substitution | A | C |
A single nucleotide substitution in the coding region of CAB2/YIL083C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 338 is now Serine rather than Isoleucine.
New 203631 CTCTTCAATGCTATGGTGTTTTTCATCCAAACGTACCCAATCTCCCTTTCTGTTTTCAGGGGATACGAAA 203700 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 203628 CTCTTCAATGATATGGTGTTTTTCATCCAAACGTACCCAATCTCCCTTTCTGTTTTCAGGGGATACGAAA 203697 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIR039C, YIRCdelta6 | 427189 | 427189 | Insertion | A | |
A single nucleotide was inserted in the intergenic region between YIRCdelta6 and YPS6/YIR039C.
New 427139 GGAAAAACGGCAACAGTATTTGTAAGCGCTTTCCAGTAAAATAACGAAAAAGAGAAAACTTCAGTACCAC 427208 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 427136 GGAAAAACGGCAACAGTATTTGTAAGCGCTTTCCAGTAAAATAACGAAAAAGAG-AAACTTCAGTACCAC 427204 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIL051C, YIL052C | 257479 | 257479 | Deletion | A | |
A single nucleotide was deleted in the intergenic region between ORFs RPL34B/YIL052C and MMF1/YIL051C.
New 257460 AAAGTAAAAATTCAAAAATTC-AAAAAAAAAAAAGCTGAAAGGAAAACACCCAAACAACA 257518 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 257458 AAAGTAAAAATTCAAAAATTCAAAAAAAAAAAAAGCTGAAAGGAAAACACCCAAACAACA 257517 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIR041W, YIR042C | 435029 | 435029 | Deletion | G | |
A single nucleotide was deleted in the intergenic region between PAU15/YIR041W and YIR042C.
New 434999 TGTGAGCCTTAGTAAGGTGAGAGCTACGCTTCCT-GGTTTAAATCAAAACCGAGAGCCCA 435057 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 434995 TGTGAGCCTTAGTAAGGTGAGAGCTACGCTTCCTGGGTTTAAATCAAAACCGAGAGCCCA 435054 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIL056W, tS(UGA)I | 249623 | 249623 | Deletion | T | |
A single nucleotide was deleted from the intergenic region between SUP17/tS(UGA)I and VHR1/YIL056W.
New 249601 GAAATCTTTCTACCGTCGTCTTCTC-TTTTTTTTTTTTTTACTATAAATCAATGTGCTCT 249659 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 249598 GAAATCTTTCTACCGTCGTCTTCTCTTTTTTTTTTTTTTTACTATAAATCAATGTGCTCT 249657 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. |
Annotation Changes without sequence changes
Date | Affected Features |
---|---|
2014-11-19 | ARS911, ARS912, ARS913, ARS914, ARS920, ARS922, ARS923 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome IX based on Liachko et al. 2013: ARS911, ARS912, ARS913, ARS923, ARS914, ARS920, ARS922. |
2014-11-19 | ARS909, ARS913, ARS914, ARS919, ARS922, ARS923 The chromosomal coordinates of the following ARS elements on Chromosome IX were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS909, ARS913, ARS923, ARS914, ARS919, ARS922. |
2014-11-19 | ARS907 ARS907 was added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2. |
2014-11-19 | YIR043C, YIR044C The annotations of YIR043C and YIR044C, which were previously annotated as adjacent pseudogenes, have been changed as part of SGD's genome annotation revision R64.2. They were merged into a single blocked reading frame, keeping the name YIR043C. YIR044C is being retained as an alias. |
2014-11-19 | YIL167W, YIL168W As part of SGD's genome annotation revision R64.2, the annotations of SDL1/YIL167W and YIL168W, which were previously annotated as adjacent pseudogenes, have been changed. They were merged into a single blocked reading frame, keeping the name SDL1/YIL167W. YIL168W is being retained as an alias. |
2013-08-14 | YIL080W YIL080W was included in the original annotation in error and was later withdrawn because it overlaps completely with functional transposable element gene YIL082W-A. It was annotated with the same start as YIL082W-A, but with a different stop codon 225 bp downstream, resulting in an incorrectly appended C-terminus containing internal stops. |
2010-01-05 | PWR1 New ncRNA PWR1 was added to the genome annotation based on Bumgarner et al. 2009. |
2010-01-05 | ICR1 New ncRNA ICR1 was added to the genome annotation based on Bumgarner et al. 2009. |
2009-05-07 | ARS902, ARS904, ARS910, ARS915, ARS918, ARS921 The following ARS elements on Chromosome 9 were added to the genome annotation based on Raveendranathan et al. 2006: ARS902, ARS904, ARS910, ARS915, ARS918, and ARS921. |
2007-04-04 | YIL123W SIM1/YIL123W mRNA contains an intron in the 5' untranslated region (UTR). |
2007-04-03 | YILWdelta2 YILCdelta2, a Ty2 LTR on Chromosome IX, was mistakenly annotated on the wrong strand (i.e., on Crick instead of Watson). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YILWdelta2 and is annotated on the Watson strand. Thanks go to Bertrand Llorente for bringing this annotation error to our attention. The name YILCdelta2 is being retained as an alias. |
2006-10-03 | ARS923 ARS923, also known as ARS913.5, was added to the genome annotation based on Nieduszynski et al. 2006. |
2006-09-08 | ARS909, ARS911, ARS912, ARS914, ARS919, ARS920, ARS922 The following new ARS elements on Chromosome IX were added to SGD based on Nieduszynski et al. 2006: ARS909, ARS911, ARS912, ARS914, ARS919, ARS920, ARS922. |
2006-09-08 | ARS913 The coordinates of ARS element ARS901, also known as ARS913, were updated based on Nieduszynski et al. 2006. |
2006-05-09 | CEN9 The previously annotated 3' boundary of CEN9 was moved 1 bp upstream to coincide with the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae. |
2006-01-24 | YIL053W Based on 5' SAGE transcription start site data and experimental verification of the start methionine, the start site for YIL053W was moved 63 bp downstream. As a consequence, YIL053W was shorted on the 5' end, altering the N-terminus and shortening the size of the predicted protein from 271 amino acids to 250 amino acids. |
2006-01-23 | YIL043W Based on based on 5' SAGE TSS data, Zhang and Dietrich suggest that the start site for CBR1/YIL043C be moved 114 nt (38 codons) downstream. These data corroborate the start site that Kellis et al. predicted based on the alignment of multiple orthologous sequences. This change has been incorporated into SGD and the numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. |
2005-11-22 | YIL076W Based on 5' SAGE transcription start site data and experimental verification of the start methionine, the start site for YIL076W was moved 189 bp downstream. As a consequence, YIL076W was shortened on the 5' end, altering the N-terminus and shortening the size of the predicted protein from 359 amino acids to 296 amino acids. |
2005-11-21 | YIL102C-A Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that this new ORF, YIL102C-A, be added to the S. cerevisiae genome annotation. |
2004-10-12 | CEN9 Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003. |
2003-09-27 | YIL073C Based on the alignment of orthologs in related Saccharomyces species, Cliften et al. proposed an intron and new 5' exon for SPO22/YIL073C. The resulting ORF is in the same frame, but has an 89-residue extension at the N-terminus. This change was reviewed and accepted by SGD curators. |
2003-09-22 | YIR014W The automated comparison of closely related Saccharomyces species suggests that the start site for YIR014W be moved 102 nt (34 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-22 | YIL145C Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PAN6/YIL145C be moved 108 nt (36 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-09 | TEL09L, TEL09R The chromosomal locations for TEL09L-XC, TEL09L-YP, TEL09R-TR, TEL09R-XR, TEL09R-XC, TEL09R, TEL09L-XR, TEL09L-TR, and TEL09L were generously provided by Ed Louis and Dave Barton (University of Leicester, UK). |
2003-07-29 | YIL020C-A, YIL029W-A, YIL030W-A, YIL047C-A, YIL066W-A, YIL068W-A, YIL071W-A, YIL100C-A, YIL115W-A, YIL142C-A, YIL156W-A, YIL171W-A, YIR017W-A, YIR020C-B, YIR023C-A, YIR030W-A, YIR036W-A Thanks to MIPS for providing the coordinates of the following Chromosome IX ORFs: YIL020C-A, YIL029W-A, YIL030W-A, YIL047C-A, YIL066W-A, YIL068W-A, YIL071W-A, YIL100C-A, YIL115W-A, YIL142C-A, YIL156W-A, YIL171W-A, YIR017W-A, YIR020C-B, YIR023C-A, YIR030W-A, and YIR036W-A. |
2003-07-29 | YIL021C-A, YIL105W-A, YIL177W-A Thanks to Kumar et al. for providing the coordinates of the following Chromosome IX ORFs: YIL021C-A, YIL105W-A, and YIL177W-A. |
2003-07-29 | YIL134C-A Thanks to Kessler et al. for providing the coordinates of YIL134C-A. |
2003-07-29 | YIL156W-B Thanks to Brachat et al and Cliften et al. for providing the coordinates of YIL156W-B. |
2003-07-29 | YIL002W-A, YIL046W-A, YIR018C-A, YIR021W-A Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome IX ORFs: YIL002W-A, YIL046W-A, YIR018C-A, and YIR021W-A. |
2001-03-06 | ARS913 Courtesy of Prof. BiK Tye; based on Ph. D. thesis of Dr. Clarence Chan. |
1999-11-17 | YIL106W Spingola et al. 1999 identified an intron in YIL106W that was not previously annotated, and also identified a different start codon. The intron has been added, and the start shifted upstream. The old chromosomal coordinates for YIL106W were 166731-167441 (coding 1-711). The new chromosomal coordinates are 166412-167441 (coding 1-20..106-1030). |
1998-05-21 | YIR020W-A The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A.
|