Difference between revisions of "Chromosome V History"
(→Annotation Changes without sequence changes) |
|||
| (3 intermediate revisions by 2 users not shown) | |||
| Line 1: | Line 1: | ||
This page lists all sequence and annotation changes that have been made to the Chromosome V systematic reference sequence since its intial release on 1996-07-31. <br> | This page lists all sequence and annotation changes that have been made to the Chromosome V systematic reference sequence since its intial release on 1996-07-31. <br> | ||
*The sequence of Chromosome V has been updated '''20''' times, affecting '''19''' features. <br> | *The sequence of Chromosome V has been updated '''20''' times, affecting '''19''' features. <br> | ||
| − | *The annotation of Chromosome V has been updated ''' | + | *The annotation of Chromosome V has been updated '''43''' times, affecting '''94''' features. <br> |
*Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site]. | *Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site]. | ||
| Line 295: | Line 295: | ||
{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6" | {| border="1" style="border-collapse:collapse; width:90%" cellpadding="6" | ||
! Date !! Affected Features | ! Date !! Affected Features | ||
| + | |- | ||
| + | |2021-04-21 | ||
| + | |[https://www.yeastgenome.org/locus/S000000792 HPA3/YEL066W]<br> | ||
| + | Moved translation start to Met19 | ||
| + | *old coordinates: 26667..27206 | ||
| + | *new coordinates: 26721..27206 | ||
| + | :[https://www.yeastgenome.org/reference/S000154122 Sampath et al 2013] PMID:23775086 | ||
| + | |- | ||
| + | |2021-04-21 | ||
| + | |[https://www.yeastgenome.org/locus/S000303805 YELWdelta27]<br> | ||
| + | New Ty1 LTR | ||
| + | *coordinates 449274..449626 | ||
| + | :[https://www.yeastgenome.org/reference/S000249429 Nene et al 2018] PMID:29320491 | ||
|- | |- | ||
| 2014-11-19 | | 2014-11-19 | ||
| Line 498: | Line 511: | ||
| [https://www.yeastgenome.org/locus/YEL009C-A YEL009C-A], [https://www.yeastgenome.org/locus/YEL018C-A YEL018C-A], [https://www.yeastgenome.org/locus/YEL034C-A YEL034C-A], [https://www.yeastgenome.org/locus/YEL053W-A YEL053W-A], [https://www.yeastgenome.org/locus/YER006C-A YER006C-A], [https://www.yeastgenome.org/locus/YER038W-A YER038W-A], [https://www.yeastgenome.org/locus/YER046W-A YER046W-A], [https://www.yeastgenome.org/locus/YER067C-A YER067C-A], [https://www.yeastgenome.org/locus/YER068C-A YER068C-A], [https://www.yeastgenome.org/locus/YER076W-A YER076W-A], [https://www.yeastgenome.org/locus/YER079C-A YER079C-A], [https://www.yeastgenome.org/locus/YER084W-A YER084W-A], [https://www.yeastgenome.org/locus/YER087C-A YER087C-A], [https://www.yeastgenome.org/locus/YER088C-A YER088C-A], [https://www.yeastgenome.org/locus/YER107W-A YER107W-A], [https://www.yeastgenome.org/locus/YER133W-A YER133W-A], [https://www.yeastgenome.org/locus/YER137W-A YER137W-A], [https://www.yeastgenome.org/locus/YER145C-A YER145C-A], [https://www.yeastgenome.org/locus/YER147C-A YER147C-A], [https://www.yeastgenome.org/locus/YER148W-A YER148W-A], [https://www.yeastgenome.org/locus/YER152W-A YER152W-A], [https://www.yeastgenome.org/locus/YER165C-A YER165C-A], [https://www.yeastgenome.org/locus/YER172C-A YER172C-A], [https://www.yeastgenome.org/locus/YER188C-A YER188C-A] <br> | | [https://www.yeastgenome.org/locus/YEL009C-A YEL009C-A], [https://www.yeastgenome.org/locus/YEL018C-A YEL018C-A], [https://www.yeastgenome.org/locus/YEL034C-A YEL034C-A], [https://www.yeastgenome.org/locus/YEL053W-A YEL053W-A], [https://www.yeastgenome.org/locus/YER006C-A YER006C-A], [https://www.yeastgenome.org/locus/YER038W-A YER038W-A], [https://www.yeastgenome.org/locus/YER046W-A YER046W-A], [https://www.yeastgenome.org/locus/YER067C-A YER067C-A], [https://www.yeastgenome.org/locus/YER068C-A YER068C-A], [https://www.yeastgenome.org/locus/YER076W-A YER076W-A], [https://www.yeastgenome.org/locus/YER079C-A YER079C-A], [https://www.yeastgenome.org/locus/YER084W-A YER084W-A], [https://www.yeastgenome.org/locus/YER087C-A YER087C-A], [https://www.yeastgenome.org/locus/YER088C-A YER088C-A], [https://www.yeastgenome.org/locus/YER107W-A YER107W-A], [https://www.yeastgenome.org/locus/YER133W-A YER133W-A], [https://www.yeastgenome.org/locus/YER137W-A YER137W-A], [https://www.yeastgenome.org/locus/YER145C-A YER145C-A], [https://www.yeastgenome.org/locus/YER147C-A YER147C-A], [https://www.yeastgenome.org/locus/YER148W-A YER148W-A], [https://www.yeastgenome.org/locus/YER152W-A YER152W-A], [https://www.yeastgenome.org/locus/YER165C-A YER165C-A], [https://www.yeastgenome.org/locus/YER172C-A YER172C-A], [https://www.yeastgenome.org/locus/YER188C-A YER188C-A] <br> | ||
The coordinates for the following ORFs on Chromosome V were provided by [https://bioinformatik.wzw.tum.de/index.php?id=63 MIPS]: YEL009C-A, YEL018C-A, YEL034C-A, YEL053W-A, YER006C-A, YER038W-A, YER046W-A, YER067C-A, YER068C-A, YER076W-A, YER079C-A, YER084W-A, YER087C-A, YER088C-A, YER107W-A, YER133W-A, YER137W-A, YER145C-A, YER147C-A, YER148W-A, YER152W-A, YER165C-A, YER172C-A, YER188C-A.<br><br> | The coordinates for the following ORFs on Chromosome V were provided by [https://bioinformatik.wzw.tum.de/index.php?id=63 MIPS]: YEL009C-A, YEL018C-A, YEL034C-A, YEL053W-A, YER006C-A, YER038W-A, YER046W-A, YER067C-A, YER068C-A, YER076W-A, YER079C-A, YER084W-A, YER087C-A, YER088C-A, YER107W-A, YER133W-A, YER137W-A, YER145C-A, YER147C-A, YER148W-A, YER152W-A, YER165C-A, YER172C-A, YER188C-A.<br><br> | ||
| + | |- | ||
| + | | 2003-07-29 | ||
| + | | [https://www.yeastgenome.org/locus/YEL008C-A YEL008C-A], [https://www.yeastgenome.org/locus/YEL030C-A YEL030C-A], [https://www.yeastgenome.org/locus/YEL032C-A YEL032C-A], [https://www.yeastgenome.org/locus/YEL077W-A YEL077W-A], [https://www.yeastgenome.org/locus/YER023C-A YER023C-A], [https://www.yeastgenome.org/locus/YER088W-B YER088W-B], [https://www.yeastgenome.org/locus/YER158W-A YER158W-A], [https://www.yeastgenome.org/locus/YER175W-A YER175W-A], [https://www.yeastgenome.org/locus/YER190C-A YER190C-A], [https://www.yeastgenome.org/locus/YER190C-B YER190C-B] <br> | ||
| + | The coordinates for the following ORFs on Chromosome V were provided by Kumar et al. 2002: YEL008C-A, YEL030C-A, YEL032C-A, YEL077W-A, YER023C-A, YER088W-B, YER158W-A, YER175W-A, YER190C-A, YER190C-B. <br><br> | ||
| + | '''Kumar A, et al.''' (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000073673 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11753363 PubMed] | [https://www.nature.com/articles/nbt0102-58 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11753363&db=pmid YFGdb] | [https://www.yeastgenome.org/reference/S000141796 Comments & Errata] <br> | ||
| + | |- | ||
| + | | 2003-07-29 | ||
| + | | [https://www.yeastgenome.org/locus/YEL020C-B YEL020C-B], [https://www.yeastgenome.org/locus/YEL050W-A YEL050W-A], [https://www.yeastgenome.org/locus/YER078W-A YER078W-A] <br> | ||
| + | The coordinates for the following ORFs on Chromosome V were provided by Kessler et al. 2003: YEL020C-B, YEL050W-A, YER078W-A. <br><br> | ||
| + | '''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000073671 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] | [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br> | ||
| + | |- | ||
| + | | 2003-03-07 | ||
| + | | [https://www.yeastgenome.org/locus/YER180C-A YER180C-A] <br> | ||
| + | ORF YER180C-A was added to SGD based on Panic et al. 2003. <br><br> | ||
| + | '''Panic B, et al.''' (2003) The ARF-like GTPases Arl1p and Arl3p act in a pathway that interacts with vesicle-tethering factors at the Golgi apparatus. Curr Biol 13(5):405-10. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000072666 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12620189 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0960982203000915?via%3Dihub Full-Text] | [https://www.ncbi.nlm.nih.gov/pubmed/12620205 Comments & Errata] <br> | ||
| + | |- | ||
| + | | 2003-03-06 | ||
| + | | [https://www.yeastgenome.org/locus/RUF4 RUF4] <br> | ||
| + | Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8. <br><br> | ||
| + | '''McCutcheon JP and Eddy SR''' (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000074006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12853629 PubMed] | [https://academic.oup.com/nar/article/31/14/4119/2904330 Full-Text] <br> | ||
| + | |- | ||
| + | | 2002-11-19 | ||
| + | | [https://www.yeastgenome.org/locus/YERCTy1-1 YERCTy1-1], [https://www.yeastgenome.org/locus/YERWdelta18 YERWdelta18] <br> | ||
| + | The YERWdelta18 element was initially mistakenly annotated as a separate LTR, though its coordinates completely overlapped with the full length transposon https://www.yeastgenome.org/locus/YERCTy1-1 YERCTy1-1]. Thus, YERWdelta18 has been deleted from the database. <br><br> | ||
| + | |- | ||
| + | | 2002-11-19 | ||
| + | | [https://www.yeastgenome.org/locus/YERCTy1-2 YERCTy1-2], [https://www.yeastgenome.org/locus/YERCsigma4 YERCsigma4] <br> | ||
| + | The YERCsigma4 element was initially mistakenly annotated as a separate sigma LTR, though its coordinates completely overlapped with the full length transposon [https://www.yeastgenome.org/locus/YERCTy1-2 YERCTy1-2], which contains delta elements, not sigma elements. Thus, YERCsigma4 has been deleted from the genome annotation. <br><br> | ||
| + | |- | ||
| + | | 2000-12-01 | ||
| + | | [https://www.yeastgenome.org/locus/YER056C-A YER056C-A] <br> | ||
| + | The intron of YER056C-A was moved 2 nucleotides upstream. The genomic sequence remains unchanged, but the coding sequence is now only very slightly altered. R''elative coordinates change from 1-39..437-763 to 1-37..435-780, and chromosomal coordinates change from 270183-270145..269747-269421 to 270183-270147..269749-269421.'' <br><br> | ||
| + | |- | ||
| + | | 2000-12-01 | ||
| + | | [https://www.yeastgenome.org/locus/YEL012W YEL012W] <br> | ||
| + | The start site of YEL012W was moved 159 nucleotides upstream, and an intron was added at relative coordinates 6-128. The stop remains unchanged. ''Relative coordinates change from 1-621 to 1-5..129-780, and chromosomal coordinates change from 131931-132551 to 131772-131776..131900-132551.'' <br><br> | ||
| + | |- | ||
| + | | 1999-07-17 | ||
| + | | [https://www.yeastgenome.org/locus/YER060W-A YER060W-A] <br> | ||
| + | YER060W-A/FCY22 was originally incorrectly annotated as being identical to its neighboring ORF YER060W/FCY21, at coordinates 274565-276151 (1587 nucleotides long). This error has been corrected, and the coordinates of YER060W-A/FCY22 are now 276570-278162 (1593 nt). Sequence files have been updated accordingly. <br><br> | ||
| + | |- | ||
| + | | 1999-07-17 | ||
| + | | [https://www.yeastgenome.org/locus/YER108C YER108C], [https://www.yeastgenome.org/locus/YER109C YER109C] <br> | ||
| + | YER108C and YER109C were originally annotated as two separate open reading frames, but it has been demonstrated that they correspond to the FLO8 gene, which contains a nonsense mutation in the reference strain S288C - an A to G transition at position 431, changing amino acid 144 from a Trp to a stop. Therefore, they have been fused into one reading frame with an internal stop codon. <br><br> | ||
| + | '''Liu H, et al.''' (1996) Saccharomyces cerevisiae S288C has a mutation in FLO8, a gene required for filamentous growth. Genetics 144(3):967-78. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000054124 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/8913742 PubMed] | [https://www.genetics.org/content/144/3/967.long Full-Text] <br> | ||
| + | |- | ||
| + | | 1998-05-21 | ||
| + | | [https://www.yeastgenome.org/locus/YER048W-A YER048W-A], [https://www.yeastgenome.org/locus/YER091C-A YER091C-A], [https://www.yeastgenome.org/locus/YER138W-A YER138W-A] <br> | ||
| + | The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. <br><br> | ||
| + | The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD. <br><br> | ||
| + | '''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br> | ||
| + | |||
| + | |} | ||
Latest revision as of 14:07, 21 April 2022
This page lists all sequence and annotation changes that have been made to the Chromosome V systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome V has been updated 20 times, affecting 19 features.
- The annotation of Chromosome V has been updated 43 times, affecting 94 features.
- Current and past versions can be obtained from SGD's Download site.
Sequence Changes
| Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
|---|---|---|---|---|---|---|
| 2011-02-03 | YER075C | 308627 | 308627 | Substitution | C | G |
| 308984 | 308984 | Substitution | G | T | ||
| 309047 | 309047 | Substitution | G | C | ||
Nucleotide substitutions within the coding region of PTP3/YER075C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 717 is now Alanine rather than Proline, and residue 738 is now Lysine rather than Q, and residue 857 is now Glutamine rather than Glutamic Acid.
New 308581 GTCATAAATGAAAATAAATTGATTAATGTTCTGGACCATGGATATTCGTTGCTTTCTAAA 308640
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Old 308577 GTCATAAATGAAAATAAATTGATTAATGTTCTGGACCATGGATATTCGTTCCTTTCTAAA 308636
New 308941 TAACAATTCATAAGGTTTCTCTTGATCATGATATGTTAGCAGAATTTTTCTTATGAGAAT 309000
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old 308937 TAACAATTCATAAGGTTTCTCTTGATCATGATATGTTAGCAGAATTTGTCTTATGAGAAT 308996
New 309001 TGCGTCATCATCATCATCATCATCATCATCACAAGCAGCAGCAGTAACAGCAATATTACT 309060
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Old 308997 TGCGTCATCATCATCATCATCATCATCATCACAAGCAGCAGCAGTAACAGGAATATTACT 309056
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YER162C | 502222 | 502222 | Substitution | T | A |
A single nucleotide substitution within the coding region of RAD4/YER162C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 223 is now Valine rather than Glutamic Acid.
New 502201 CTTTCCAGGTTCTCATATAAAGTCCCACATTATCATATTTTTTAGTGATCTTCCAGTGTT 502260
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Old 502196 CTTTCCAGGTTCTCATATAAAGTCCCTCATTATCATATTTTTTAGTGATCTTCCAGTGTT 502255
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YER041W | 232634 | 232634 | Substitution | C | G |
A single nucleotide substitution within the coding region of YEN1/YER041W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 59 is now Alanine rather than Proline.
New 232621 ATATAGATATAAGCGCCAGATCTAGATCAAGATCAAGGAGTCCTACCCGTTCTCCGCGTG 232680
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Old 232620 ATATAGATATAAGCCCCAGATCTAGATCAAGATCAAGGAGTCCTACCCGTTCTCCGCGTG 232679
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YER061C | 278525 | 278526 | Substitution | CG | GC |
Nucleotide changes within the coding region of CEM1/YER061C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 367 is now Alanine rather than Arginine.
New 278521 GCGCCAGCTGCACCTAAAAGATGGCCAATTGCACCTTTGTTACTGGATATGTACAGTGGC 278580
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Old 278519 GCGCCACGTGCACCTAAAAGATGGCCAATTGCACCTTTGTTACTGGATATGTACAGTGGC 278578
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YER073W | 305258 | 305258 | Substitution | G | A |
A single nucleotide substitution within the coding region of ALD5/YER073W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 411 is now Glutamic Acid rather than Glycine.
New 305221 GGTTATTTTGTCAAGCCAACAGTGTTTGCTGATGTCAAAGAAGATATGAGAATTGTTAAG 305280
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old 305218 GGTTATTTTGTCAAGCCAACAGTGTTTGCTGATGTCAAAGGAGATATGAGAATTGTTAAG 305277
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YEL007W, YEL008W | 141112 | 141112 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs YEL008W and YEL007W.
New 141061 GCAATGATCTGTCCAACTCACCGAAACAAGAAAAAATTTTGCGTTTTTTTTTTCCTACAAATCCCCCATT 141130
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old 141061 GCAATGATCTGTCCAACTCACCGAAACAAGAAAAAATTTTGCGTTTTTTTTT-CCTACAAATCCCCCATT 141129
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YEL070W, YEL071W | 18079 | 18079 | Substitution | A | T |
A single nucleotide substitution was made in the intergenic region between ORFs DLD3/YEL071W and DSF1/YEL070W.
New 18061 ATCTCCTGATTGCGTACTTCAAAAAGTGTTCGTCCATTTTTTCTTTACTACATTAGATAA 18120
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old 18061 ATCTCCTGATTGCGTACTACAAAAAGTGTTCGTCCATTTTTTCTTTACTACATTAGATAA 18120
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YER056C, YER056C-A | 268857 | 268857 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs FCY2/YER056C and RPL34A/YER056C-A.
New 268801 AACTTGGTTGAAAGTGGCTGAATTTACGACGTAATCTGTCTTGACATCTTTTTTTTTTTCAGCGAGCATT 268870
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old 268800 AACTTGGTTGAAAGTGGCTGAATTTACGACGTAATCTGTCTTGACATCTTTTTTTTTT-CAGCGAGCATT 268868
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YER072W, YER073W | 303532 | 303532 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs VTC1/YER072W and ALD5/YER073W.
New 303481 CCGTTTACACATCAATGATAAATAAGTATACAAAAAGGGTTCCATTTTTTTTTTTGGCCGCTACCGGACT 303550
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old 303479 CCGTTTACACATCAATGATAAATAAGTATACAAAAAGGGTTCCATTTTTTTTTT-GGCCGCTACCGGACT 303547
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YER133W, tH(GUG)E2 | 434284 | 434284 | Substitution | C | T |
A single nucleotide substitution was made in the intergenic region between GLC7/YER133W and tH(GUG)E2.
New 434281 CAATTTTTCTTTATTTTCTTTTATTACTATTATCATTACTATTATTATTAGTATTATTAT 434340
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Old 434277 CAATTTTCCTTTATTTTCTTTTATTACTATTATCATTACTATTATTATTAGTATTATTAT 434336
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YER138W-A, YER139C | 449959 | 449959 | Insertion | A | |
A single nucleotide insertion was made in the intergenic region between ORFs YER138W-A and RTR1/YER139C.
New 449941 GTGGGTTTCCTATGTTCTCGAAGAGAGCTTCAAGTGTATTCTATAAACTAAGAATATTAG 450000
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old 449937 GTGGGTTTCCTATGTTCTCGAAG-GAGCTTCAAGTGTATTCTATAAACTAAGAATATTAG 449995
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YER073W, ER074W | 305968 | 305968 | Substitution | T | A |
| 305885 | 305886 | Substitution | CA | TC | ||
| 305880 | 305880 | Substitution | T | G | ||
| 305828 | 305828 | Substitution | A | G | ||
| 305710 | 305710 | Insertion | A | |||
A single nucleotide insertion and several different substitutions were made in the intergenic region between ORFs ALD5/YER073W and RPS24A/YER074W.
New 305701 CAAAAAAAAAAAAACAAAACAAAAAAATAATAACGTGATAAACATTAATGAACAATGTAT 305760
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old 305698 CAAAAAAAAAAAA-CAAAACAAAAAAATAATAACGTGATAAACATTAATGAACAATGTAT 305756
New 305821 TATTGTATATTGAAATATATAGTAATCAAATTCGTTTCATTGATCAAATTGCTCACTAGT 305880
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old 305817 TATTGTATATTAAAATATATAGTAATCAAATTCGTTTCATTGATCAAATTGCTCACTAGT 305876
New 305881 TCTGTTTTTCAAAATTTCATCTTTATAGGTAGATACAAGTGCCAGAGAGATATATAAACA 305940
||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Old 305877 TCTTTTTTCAAAAATTTCATCTTTATAGGTAGATACAAGTGCCAGAGAGATATATAAACA 305936
New 305941 GAAAACTCTATCGATGTGATAATGTATGCCAATATCGGGACTGTACACCCACACATTTAC 306000
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old 305937 GAAAACTCTATCGATGTGATAATGTATGCCATTATCGGGACTGTACACCCACACATTTAC 305996
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | ARS504 | 9168 | 9168 | Substitution | G | T |
A single nucleotide substitution was made within ARS504.
New 9121 GTTGGCCTGCCATACTTTAATTGAATAAAAGCTCCGTATATGCTTCTTAAAAATAAGCAA 9180
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old 9121 GTTGGCCTGCCATACTTTAATTGAATAAAAGCTCCGTATATGCTTCTGAAAAATAAGCAA 9180
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2000-03-16 | YER123W | 406383 | 406383 | Deletion | G | |
A single G nucleotide was deleted within ORF YER123W at chromosomal coordinate 406383, creating a new stop codon; this ORF is shortened, but a prenylation site is created.
Old: 406381 TGGATAAAGCGATTTTTATACTTTTCTCTTTTTCCTTTTTTTTTTTGATTGGCTGTTTCC 406440
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New: 406381 TG-ATAAAGCGATTTTTATACTTTTCTCTTTTTCCTTTTTTTTTTTGATTGGCTGTTTCC 406439
Wang X, et al. (1996) Prenylated isoforms of yeast casein kinase I, including the novel Yck3p, suppress the gcs1 blockage of cell proliferation from stationary phase. Mol Cell Biol 16(10):5375-85. | ||||||
Annotation Changes without sequence changes
| Date | Affected Features |
|---|---|
| 2021-04-21 | HPA3/YEL066W Moved translation start to Met19
|
| 2021-04-21 | YELWdelta27 New Ty1 LTR
|
| 2014-11-19 | ARS507, ARS508, ARS511, ARS512, ARS513.7, ARS514, ARS516, ARS518, ARS520, ARS523 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome V based on Liachko et al. 2013: ARS507, ARS508, ARS511, ARS512, ARS513.7, ARS514, ARS516, ARS518, ARS520, ARS523. |
| 2014-11-19 | ARS503, ARS507, ARS510, ARS511, ARS514, ARS516, ARS520, ARS523 The chromosomal coordinates of the following ARS elements on Chromosome V were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS503, ARS507, ARS510, ARS511, ARS514, ARS516, ARS520, ARS523. |
| 2014-11-19 | ARS513.5, ARS513.7 The following new ARS elements on Chromosome V were added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS513.5, ARS513.7. |
| 2014-11-18 | YER109C The feature_type annotation of FLO8/YER109C was changed from ORF to blocked_reading_frame (SO:0000718) as part of SGD's genome annotation revision R64.2. |
| 2014-07-18 | YER038W-A ORF YER038W-A was upgraded from 'Dubious' to 'Uncharacterized' on 2014-01-30 because its protein product was found in the mitochondria in both the Sickmann et al 2003 and Reinders et al 2006 studies. |
| 2007-07-09 | YEL003W The start of GIM4/YEL003W was moved 52 nt upstream, and an intron was added at relative coordinates 20-107, based on GenBank EF123144, Juneau et al. 2007, and Miura et al. 2006. According to Juneau et al. 2007, the intron is "inefficiently spliced" (splicing rate = 72%). The old coding coordinates were 148227..148598 (372 nt, 123 aa), and the new coding coordinates are 148175..148193,148282..148598 (1..19,108..424; 111 aa). |
| 2007-04-04 | YER131W RPS26B/YER131W mRNA contains an intron in the 5' untranslated region (UTR). |
| 2007-04-04 | YER102W RPS8B/YER102W mRNA contains an intron in the 5' untranslated region (UTR). |
| 2007-04-03 | YERCdelta8 YERCdelta8, a Ty1 LTR on Chromosome V, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). The error has now been corrected. |
| 2006-10-02 | ARS516 The coordinates of ARS516 were updated based on Nieduszynski et al. 2006. |
| 2006-09-07 | ARS507, ARS508, ARS510, ARS511, ARS512, ARS514, ARS517, ARS518, ARS522 The coordinates of the following ARS elements on Chromosome V were updated based on Nieduszynski et al. 2006: ARS507, ARS508, ARS510, ARS511, ARS512, ARS514, ARS517, ARS518, ARS522/501. |
| 2006-05-09 | YEL038W The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for UTR4/YEL038W be moved 42 nt (14 codons) downstream. |
| 2006-05-08 | CEN5 The previously annotated boundaries of CEN5 were adjusted to coincide with the 5' end of CDEI and the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae. |
| 2005-11-29 | snR80 New snoRNA added to genome annotation. |
| 2005-11-29 | YER030W The start site of YER030W is being moved 21 bp downstream from 213415 to 213436 because the 5' SAGE data used by Zhang & Dietrich 2005 to study transcription start sites confirmed the initial suggestion by Kellis et al. 2003 that this change be made. The size of the predicted protein is reduced from 160 aa to 153 aa. |
| 2005-11-28 | YER050C The start site of RSM18/YER050C is being moved 192 bp downstream from 254578 to 254386, based on 5' SAGE data used by Zhang & Dietrich 2005 to study transcription start sites. |
| 2004-10-19 | ARS502, ARS503, ARS504, ARS50, ARS508, ARS510, ARS511, ARS512, ARS513, ARS514, ARS515, ARS516, ARS517, ARS518, ARS519, ARS520, ARS521, ARS522, ARS523 The following ARS elements on Chromosome V were added to SGD based on Tanaka et al. 1996 and Raghuraman et al. 2001: ARS502, ARS503, ARS504, ARS507, ARS508, ARS510, ARS511, ARS512, ARS513, ARS514, ARS515, ARS516, ARS517, ARS518, ARS519, ARS520, ARS521, ARS522, ARS523. |
| 2004-10-12 | CEN5 Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003. |
| 2004-10-08 | SCR1 The coordinates of the small cytoplasmic RNA SCR1 were corrected to match the sequence determined by Felici, et al. and reported in the GenBank entry M28116. |
| 2004-08-27 | YER090C-A The ORF YER090C-A was added per Oshiro et al. 2002. |
| 2004-04-01 | RUF4 Feature annotation removed per John McCutcheon and Sean Eddy. |
| 2004-01-08 | YER074W-A Both introns in YER074W-A were extended 1 bp in the 5' direction and 2 bp in the 3' direction based on conserved splice site sequences in other fungal species as predicted by Blandin et al. 2000. |
| 2003-10-29 | SRG1 This non-coding RNA feature was annotated based on information from Fred Winston; the SRG1 TATA begins at position 322124, the transcription start sites are at positions 322208 and 322209, and the size of the transcript is approximately 550 bases as determined by Northern analysis. |
| 2003-09-22 | YER178W Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for PDA1/YER178W was moved 69 nt (23 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The predicted protein translated from the conserved methionine contains a predicted mitochondrial targeting signal sequence (using both MitoProt and Predotar), while the predicted protein translated from the currently annotated S. cerevisiae start codon does not. |
| 2003-09-22 | YER032W Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for FIR1/YER032W was moved 147 nt (49 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
| 2003-09-22 | YER083C Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for YER083C was moved 66 nt (22 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
| 2003-09-22 | YEL062W Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for NPR2/YEL062W was moved 27 nt (9 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
| 2003-09-22 | YEL061C Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for CIN8/YEL061C was moved 114 nt (38 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
| 2003-09-22 | TEL05L, TEL05R The chromosomal locations for the following telomeric elements on Chromosome V were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL05L, TEL05L-XC, TEL05L-YP, TEL05R, TEL05R-XC, TEL05R-XR, TEL05R-YP. |
| 2003-07-29 | YEL009C-A, YEL018C-A, YEL034C-A, YEL053W-A, YER006C-A, YER038W-A, YER046W-A, YER067C-A, YER068C-A, YER076W-A, YER079C-A, YER084W-A, YER087C-A, YER088C-A, YER107W-A, YER133W-A, YER137W-A, YER145C-A, YER147C-A, YER148W-A, YER152W-A, YER165C-A, YER172C-A, YER188C-A The coordinates for the following ORFs on Chromosome V were provided by MIPS: YEL009C-A, YEL018C-A, YEL034C-A, YEL053W-A, YER006C-A, YER038W-A, YER046W-A, YER067C-A, YER068C-A, YER076W-A, YER079C-A, YER084W-A, YER087C-A, YER088C-A, YER107W-A, YER133W-A, YER137W-A, YER145C-A, YER147C-A, YER148W-A, YER152W-A, YER165C-A, YER172C-A, YER188C-A. |
| 2003-07-29 | YEL008C-A, YEL030C-A, YEL032C-A, YEL077W-A, YER023C-A, YER088W-B, YER158W-A, YER175W-A, YER190C-A, YER190C-B The coordinates for the following ORFs on Chromosome V were provided by Kumar et al. 2002: YEL008C-A, YEL030C-A, YEL032C-A, YEL077W-A, YER023C-A, YER088W-B, YER158W-A, YER175W-A, YER190C-A, YER190C-B. |
| 2003-07-29 | YEL020C-B, YEL050W-A, YER078W-A The coordinates for the following ORFs on Chromosome V were provided by Kessler et al. 2003: YEL020C-B, YEL050W-A, YER078W-A. |
| 2003-03-07 | YER180C-A ORF YER180C-A was added to SGD based on Panic et al. 2003. |
| 2003-03-06 | RUF4 Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8. |
| 2002-11-19 | YERCTy1-1, YERWdelta18 The YERWdelta18 element was initially mistakenly annotated as a separate LTR, though its coordinates completely overlapped with the full length transposon https://www.yeastgenome.org/locus/YERCTy1-1 YERCTy1-1]. Thus, YERWdelta18 has been deleted from the database. |
| 2002-11-19 | YERCTy1-2, YERCsigma4 The YERCsigma4 element was initially mistakenly annotated as a separate sigma LTR, though its coordinates completely overlapped with the full length transposon YERCTy1-2, which contains delta elements, not sigma elements. Thus, YERCsigma4 has been deleted from the genome annotation. |
| 2000-12-01 | YER056C-A The intron of YER056C-A was moved 2 nucleotides upstream. The genomic sequence remains unchanged, but the coding sequence is now only very slightly altered. Relative coordinates change from 1-39..437-763 to 1-37..435-780, and chromosomal coordinates change from 270183-270145..269747-269421 to 270183-270147..269749-269421. |
| 2000-12-01 | YEL012W The start site of YEL012W was moved 159 nucleotides upstream, and an intron was added at relative coordinates 6-128. The stop remains unchanged. Relative coordinates change from 1-621 to 1-5..129-780, and chromosomal coordinates change from 131931-132551 to 131772-131776..131900-132551. |
| 1999-07-17 | YER060W-A YER060W-A/FCY22 was originally incorrectly annotated as being identical to its neighboring ORF YER060W/FCY21, at coordinates 274565-276151 (1587 nucleotides long). This error has been corrected, and the coordinates of YER060W-A/FCY22 are now 276570-278162 (1593 nt). Sequence files have been updated accordingly. |
| 1999-07-17 | YER108C, YER109C YER108C and YER109C were originally annotated as two separate open reading frames, but it has been demonstrated that they correspond to the FLO8 gene, which contains a nonsense mutation in the reference strain S288C - an A to G transition at position 431, changing amino acid 144 from a Trp to a stop. Therefore, they have been fused into one reading frame with an internal stop codon. |
| 1998-05-21 | YER048W-A, YER091C-A, YER138W-A The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. |