Difference between revisions of "Chromosome XVI History"

From SGD-Wiki
Jump to: navigation, search
(Created page with "This page lists all sequence and annotation changes that have been made to the Chromosome XVI systematic reference sequence since its intial release on 1996-07-31. <br> *The s...")
 
 
(5 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
This page lists all sequence and annotation changes that have been made to the Chromosome XVI systematic reference sequence since its intial release on 1996-07-31. <br>
 
This page lists all sequence and annotation changes that have been made to the Chromosome XVI systematic reference sequence since its intial release on 1996-07-31. <br>
 
*The sequence of Chromosome XVI has been updated '''23''' times, affecting '''16''' features. <br>
 
*The sequence of Chromosome XVI has been updated '''23''' times, affecting '''16''' features. <br>
−
*The annotation of Chromosome XVI has been updated '''39''' times, affecting '''72''' features. <br>
+
*The annotation of Chromosome XVI has been updated '''40''' times, affecting '''73''' features. <br>
 
*Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site].
 
*Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site].
  
Line 10: Line 10:
 
{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
 
{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
 
! Date  !! Affected Features !! Start Coordinate of Change !! End Coordinate of Change !! Type of Change !! Old Sequence !! New Sequence
 
! Date  !! Affected Features !! Start Coordinate of Change !! End Coordinate of Change !! Type of Change !! Old Sequence !! New Sequence
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| rowspan="2"| 2011-02-03
 +
| rowspan="2"|[https://www.yeastgenome.org/locus/YPL224C YPL224C]
 +
| 128039
 +
| 128039
 +
| Substitution
 +
| T
 +
| G
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 126768
 +
| 126768
 +
| Insertion
 +
|
 +
| C
 +
|-
 +
| || colspan="6" | Two nucleotide changes were made within the ORF MMT2/YPL224C, altering its coding sequence: one single nucleotide substitution near the 5' end, and one single nucleotide insertion near the 3' end. The start and majority of the reading frame remain the same, but the C-terminus has changed, and the annotated protein is now 35 amino acids longer.
 +
<pre>New 126721 ACCTTTAGAGTCAGAGGTTACATCAACAAACTCGACGTCCACCTTCCCCACGTTTGGCAC  126780
 +
          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
 +
Old 126721 ACCTTTAGAGTCAGAGGTTACATCAACAAACTCGACGTCCACCTTCCC-ACGTTTGGCAC  126779
 +
 +
New 127981 CAGGCTTGATGTTCTTATGGCCCTCCCGGCAGCATGGTAACTAGTGTTGTTATAACCTGGCACAAAGGAA  128050
 +
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
 +
Old 127980 CAGGCTTGATGTTCTTATGGCCCTCCCGGCAGCATGGTAACTAGTGTTGTTATAACCTGTCACAAAGGAA  128049</pre>
 +
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| rowspan="2"| 2011-02-03
 +
| rowspan="2"|[https://www.yeastgenome.org/locus/YPR035W YPR035W]
 +
| 642955
 +
| 642955
 +
| Substitution
 +
| G
 +
| A
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 642995
 +
| 642995
 +
| Substitution
 +
| C
 +
| T
 +
|-
 +
| || colspan="6" | Nucleotide change(s) in the coding region of GLN1/YPR035W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 251 is now Threonine rather than Alanine, and residue 264 is now Methionine rather than Threonine.
 +
<pre>New  642949 GGTTGTCACACTAACGTTTCCACCAAGGAAATGAGACAACCAGGTGGTATGAAATACATCGAACAAGCCA 643018
 +
            ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
 +
Old  642946 GGTTGTCACGCTAACGTTTCCACCAAGGAAATGAGACAACCAGGTGGTACGAAATACATCGAACAAGCCA 643015</pre>
 +
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2011-02-03
 +
| [https://www.yeastgenome.org/locus/YPR097W YPR097W]
 +
| 727933
 +
| 727933
 +
| Substitution
 +
| G
 +
| A
 +
|-
 +
| || colspan="6" | A single nucleotide substitution within the coding region of YPR097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 848 is now Serine rather than Glycine.
 +
<pre>New    727918  ATTTTGAGAAGTTCATGAGTGATTTGATCAGGCTTGTTGATGATGTTATCAATGGTCAGT  727977
 +
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
 +
Old    727916  ATTTTGAGAAGTTCATGGGTGATTTGATCAGGCTTGTTGATGATGTTATCAATGGTCAGT  727975</pre>
 +
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2011-02-03
 +
| [https://www.yeastgenome.org/locus/YPR121W YPR121W]
 +
| 778863
 +
| 778863
 +
| Substitution
 +
| T
 +
| A
 +
|-
 +
| || colspan="6" | A single nucleotide substitution within the coding region of THI22/YPR121W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 95 is now Glutamine rather than Histidine.
 +
<pre>New    778858  CGGCGCTCAAAATATACCAAAGAAAATGGTATCTCAAATATTAGACGCCAATTTACAGGA  778917
 +
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
 +
Old    778854  CGGCGCTCATAATATACCAAAGAAAATGGTATCTCAAATATTAGACGCCAATTTACAGGA  778913</pre>
 +
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| rowspan="2"| 2011-02-03
 +
| rowspan="2"|[https://www.yeastgenome.org/locus/YPL108W YPL108W], [https://www.yeastgenome.org/locus/YPL109C YPL109C]
 +
| 347528
 +
| 347528
 +
| Insertion
 +
|
 +
| G
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 347759
 +
| 347759
 +
| Insertion
 +
|
 +
| C
 +
|-
 +
| || colspan="6" | Two separate single nucleotides were inserted in the intergenic region between ORFs YPL109C and YPL108W.
 +
<pre>New    347521  GGTATTATTGCCCCTCATATATTCGGGGTTATTTATTTTTCGTTGCTTGAAGTAAAGCCT  347580
 +
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
 +
Old    347520  GGTATTATT-CCCCTCATATATTCGGGGTTATTTATTTTTCGTTGCTTGAAGTAAAGCCT  347578
 +
New    347751  CCCTTTCGCGGCACTTTTTCTCTTAGCTCTGCTTGATACATCGACTGGGAACTTCTTCTCTTTGAGCCAA  347820
 +
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 +
Old    347749  CCCTTTCGCGG-ACTTTTTCTCTTAGCTCTGCTTGATACATCGACTGGGAACTTCTTCTCTTTGAGCCAA  347817</pre>
 +
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| rowspan="2"| 2011-02-03
 +
| rowspan="2"|[https://www.yeastgenome.org/locus/YPR121W YPR121W], [https://www.yeastgenome.org/locus/YPRWdelta16 YPRWdelta16]
 +
| 778376
 +
| 778376
 +
| Insertion
 +
|
 +
| C
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 778302
 +
| 778302
 +
| Insertion
 +
|
 +
| G
 +
|-
 +
| || colspan="6" | Two single nucleotide insertions were made in the intergenic region between YPRWdelta16 and YPR121W/THI22.
 +
<pre> New    778258  TTAATGGAATAACGTGATTTTTGTACCAAATTGCCTATTTCAGATTCGGCGTGCGCTTCC  778317
 +
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
 +
Old    778256  TTAATGGAATAACGTGATTTTTGTACCAAATTGCCTATTTCAGATTC-GCGTGCGCTTCC  778314
 +
New    778368  TGCACGGAAGATCCTTGCAGGAATCAAATACTGCCTTTCACTTTGCAACCTCTTAATCACATAGTAGCAC  778437
 +
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 +
Old    778365  TGCACGGAAGAT-CTTGCAGGAATCAAATACTGCCTTTCACTTTGCAACCTCTTAATCACATAGTAGCAC  778433</pre>
 +
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2011-02-03
 +
| [https://www.yeastgenome.org/locus/YPR035W YPR035W], [https://www.yeastgenome.org/locus/YPR036W YPR036W]
 +
| 643579
 +
| 643579
 +
| Substitution
 +
| T
 +
| C
 +
|-
 +
| || colspan="6" | A single nucleotide substitution was made in the intergenic region between ORFs YPR035W/GLN1 and YPR036W/VMA13.
 +
<pre> New    643559  TCGAATTTTTTCTTTTTTTTTTTCTGCAAAGCGACGCTGTGTTGTATATTGCTCTAAAAT  643618
 +
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
 +
Old    643556  TCGAATTTTTTCTTTTTTTTTTTTTGCAAAGCGACGCTGTGTTGTATATTGCTCTAAAAT  643615</pre>
 +
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2011-02-03
 +
| [https://www.yeastgenome.org/locus/YPL016W YPL016W]
 +
| 523639
 +
| 523639
 +
| Substitution
 +
| C
 +
| T
 +
|-
 +
| || colspan="6" | A single nucleotide substitution was made within the ORF SWI1/YPL016W. Note that the protein sequence was not changed.
 +
<pre>New    523619  GATTCCTCCCTAACCAATTTCCTTTGAAAATTCACAGAACTCCTTATTTGACTTCTTTGA  523678
 +
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
 +
Old    523616  GATTCCTCCCTAACCAATTTCCTCTGAAAATTCACAGAACTCCTTATTTGACTTCTTTGA  523675</pre>
 +
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| rowspan="4"| 2011-02-03
 +
| rowspan="4"| [https://www.yeastgenome.org/locus/YPL016W YPL016W], [https://www.yeastgenome.org/locus/YPL017C YPL017C]
 +
| 520375
 +
| 520375
 +
| Insertion
 +
|
 +
| C
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 520378
 +
| 520378
 +
| Substitution
 +
| C
 +
| G
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 520646
 +
| 520646
 +
| Insertion
 +
|
 +
| C
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 520818
 +
| 520818
 +
| Deletion
 +
| T
 +
|
 +
|-
 +
| || colspan="6" | Four single nucleotide changes were made in the intergenic region between ORFs YPL016W/SWI1 and YPL017C/IRC15: two insertions, one substitution, and one deletion.
 +
<pre>New    520320  AGATGCATGCCTGCAGGTCTGGGTGTACCCCCTGCCTGAGTGTTCCACCCAGGCCTCGCCGGAGGAAAAT  520389
 +
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||
 +
Old    520318  AGATGCATGCCTGCAGGTCTGGGTGTACCCCCTGCCTGAGTGTTCCACCCAGGCCTCG-CGCAGGAAAAT  520386
 +
New    520620  CATATTCACATTGCGTTTTAGTCATAACCACCTTCCGGTATTCATCATTCGTATTGAATA  520679
 +
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
 +
Old    520617  CATATTCACATTGCGTTTTAGTCATAACCA-CTTCCGGTATTCATCATTCGTATTGAATA  520675
 +
New    520800  ATCTCTGCTTTGGCATTTCGCG-TTGTTTCCTCTCACGGATTGCAGATTATTGTTCACCA  520858
 +
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
 +
Old    520796  ATCTCTGCTTTGGCATTTCGCGTTTGTTTCCTCTCACGGATTGCAGATTATTGTTCACCA  520855</pre>
 +
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2011-02-03
 +
| [https://www.yeastgenome.org/locus/YPL036W YPL036W], [https://www.yeastgenome.org/locus/YPL037C YPL037C]
 +
| 482773
 +
| 482773
 +
| Deletion
 +
| T
 +
|
 +
|-
 +
| || colspan="6" | A single nucleotide was deleted from the intergenic region between ORFs YPL037C/EGD1 and YPL036W/PMA2.
 +
<pre>New    482761  AAACATACCCATAAC-TTTTTTTTTTTCATTTTTCGTTGCTGTGTGCTAGTACAATTTAA  482819
 +
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
 +
Old    482758  AAACATACCCATAACTTTTTTTTTTTTCATTTTTCGTTGCTGTGTGCTAGTACAATTTAA  482817</pre>
 +
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2011-02-03
 +
| [https://www.yeastgenome.org/locus/YPR078C YPR078C], [https://www.yeastgenome.org/locus/YPR079W YPR079W]
 +
| 698524
 +
| 698524
 +
| Deletion
 +
| A
 +
|
 +
|-
 +
| || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs YPR078C and YPR079W/MRL1.
 +
<pre>New    698519  TTCTTCTG-AAAAAAAAAAAAAAAAATTCAAAAAAAGACACCTTTCTACCTTGGCAGTAA  698577
 +
              |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
 +
Old    698516  TTCTTCTGAAAAAAAAAAAAAAAAAATTCAAAAAAAGACACCTTTCTACCTTGGCAGTAA  698575</pre>
 +
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| rowspan="4"| 2004-07-21
 +
| rowspan="4"| [https://www.yeastgenome.org/locus/YPL109C YPL109C]
 +
| 347273
 +
| 347273
 +
| Insertion
 +
|
 +
| T
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 347265
 +
| 347265
 +
| Deletion
 +
| T
 +
|
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 347285
 +
| 347285
 +
| Insertion
 +
|
 +
| A
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 347375
 +
| 347375
 +
| Insertion
 +
|
 +
| T
 +
|-
 +
| || colspan="6" | The works of Kellis et al. 2003 and Cliften et al. 2003 predicted multiple insertions and deletions in YPL109C, and the sequence errors were confirmed in S288C by SGD. As a consequence of these changes, YPL109C was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 590 to 657 amino acids.
 +
<pre>New:        TGTTTTGGAAACGAATTTT-GTGTCAAATAAAAAGCAATTGACGTAGGTATTATGAACTG
 +
            ||||||||||||||||||| |||||||| |||||||||||| ||||||||||||||||||
 +
Old: 347246 TGTTTTGGAAACGAATTTTTGTGTCAAA-AAAAAGCAATTG-CGTAGGTATTATGAACTG 347303</pre>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2003-09-29
 +
| [https://www.yeastgenome.org/locus/YPR089W YPR089W], [https://www.yeastgenome.org/locus/YPR090W YPR090W]
 +
| 713683
 +
| 713683
 +
| Deletion
 +
| T
 +
|
 +
|-
 +
| || colspan="6" | Due to deletion of a T at position 713683, YPR089W and YPR090W were merged. After merging YPR089W (713271 - 713738 (1-468)) and YPR090W (713728 - 715938 (1-2211)), the coordinates of the merged ORF, YPR089W, are 713271 - 715937 (1-2667). YPR090W is now an alias of YPR089W.<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
 +
|}
 +
 +
<br><br>
 +
 +
=Annotation Changes ''without sequence changes''=
 +
{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
 +
! Date  !! Affected Features
 +
|-
 +
|2021-04-21
 +
|[https://www.yeastgenome.org/locus/S000303815 YNCP0002W] aka GAL4 lncRNA<br>
 +
New ncRNA
 +
*coordinates: 79562..82648
 +
:[https://www.yeastgenome.org/reference/S000148029 Geisler et al 2012] PMID:22226051
 +
|-
 +
| 2014-11-19
 +
| [https://www.yeastgenome.org/locus/ARS1605 ARS1605], [https://www.yeastgenome.org/locus/ARS1607 ARS1607], [https://www.yeastgenome.org/locus/ARS1621 ARS1621], [https://www.yeastgenome.org/locus/ARS1622 ARS1622], [https://www.yeastgenome.org/locus/ARS1625 ARS1625] <br>
 +
The chromosomal coordinates of the following ARS elements on Chromosome XVI were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1605, ARS1607, ARS1621, ARS1622, ARS1625. <br> <br>
 +
'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
 +
[https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text]
 +
|-
 +
| 2014-11-19
 +
| [https://www.yeastgenome.org/locus/ARS1604 ARS1604], [https://www.yeastgenome.org/locus/ARS1607 ARS1607], [https://www.yeastgenome.org/locus/ARS1614 ARS1614], [https://www.yeastgenome.org/locus/ARS1618 ARS1618], [https://www.yeastgenome.org/locus/ARS1619 ARS1619], [https://www.yeastgenome.org/locus/ARS1621 ARS1621], [https://www.yeastgenome.org/locus/ARS1622 ARS1622], [https://www.yeastgenome.org/locus/ARS1623 ARS1623], [https://www.yeastgenome.org/locus/ARS1624 ARS1624], [https://www.yeastgenome.org/locus/ARS1625 ARS1625], [https://www.yeastgenome.org/locus/ARS1626 ARS1626], [https://www.yeastgenome.org/locus/ARS1627 ARS1627], [https://www.yeastgenome.org/locus/ARS1628 ARS1628], [https://www.yeastgenome.org/locus/ARS1630 ARS1630], [https://www.yeastgenome.org/locus/ARS1631 ARS1631] <br>
 +
As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome XVI based on Liachko et al. 2013: ARS1604, ARS1607, ARS1614, ARS1618, ARS1619, ARS1621, ARS1622, ARS1623, ARS1624, ARS1625, ARS1626, ARS1627, ARS1628, ARS1630, ARS1631. <br> <br>
 +
'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
 +
[https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text]
 +
|-
 +
| 2014-11-19
 +
| [https://www.yeastgenome.org/locus/YPL060C-A YPL060C-A] <br>
 +
YPL060C-A had been erroneously identified as a pseudogene because it was incompletely annotated. As part of SGD's genome annotation revision R64.2, the feature_type of YPL060C-A was changed from pseudogene to transposable_element_gene, and the missing plus_1_translational_frameshift and remainder of the gene were added.
 +
<pre>Old coordinates:
 +
442742..439428 CDS
 +
New coordinates:
 +
442742..439429 CDS
 +
439428..439428 plus_1_translational_frameshift
 +
439427..437333 CDS</pre>
 +
'''Kim JM, et al.''' (1998)  Transposable elements and genome organization: a comprehensive survey of retrotransposons revealed by the complete Saccharomyces cerevisiae genome sequence. Genome Res 8(5):464-78. <br>
 +
[https://www.yeastgenome.org/reference/S000072465 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9582191 PubMed] | [https://genome.cshlp.org/content/8/5/464.long Full-Text] <br>
 +
'''Lawler JF Jr, et al.''' (2001) Frameshift signal transplantation and the unambiguous analysis of mutations in the yeast retrotransposon Ty1 Gag-Pol overlap region. J Virol 75(15):6769-75. <br>
 +
[https://www.yeastgenome.org/reference/S000115694 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11435555 PubMed] | [https://jvi.asm.org/content/75/15/6769.long Full-Text] <br>
 +
|-
 +
| 2009-05-08
 +
| [https://www.yeastgenome.org/locus/ARS1603 ARS1603], [https://www.yeastgenome.org/locus/ARS1608 ARS1608], [https://www.yeastgenome.org/locus/ARS1611 ARS1611], [https://www.yeastgenome.org/locus/ARS1612 ARS1612], [https://www.yeastgenome.org/locus/ARS1617 ARS1617], [https://www.yeastgenome.org/locus/ARS1620 ARS1620], [https://www.yeastgenome.org/locus/ARS1629 ARS1629], [https://www.yeastgenome.org/locus/ARS1632 ARS1632] <br>
 +
The following ARS elements on Chromosome 16 were added to the genome annotation based on Raveendranathan et al. 2006: ARS1603, ARS1608, ARS1611, ARS1612, ARS1617, ARS1620, ARS1629, and ARS1632. <br> <br>
 +
'''Raveendranathan M, et al.''' (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39. <br>
 +
[https://www.yeastgenome.org/reference/S000117571 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16888628 PubMed] | [https://www.embopress.org/cgi/doi/10.1038/sj.emboj.7601251 Full-Text]<br>
 +
|-
 +
| 2007-07-10
 +
| [https://www.yeastgenome.org/locus/YPR153W YPR153W] <br>
 +
The start of ORF YPR153W was moved 122 nt upstream and an intron was added at relative coordinates 6..139 based on GenBank EF123126, Juneau et al. 2007, Zhang et al. 2007, and Miura et al. 2006. According to Juneau et al. 2007, the intron is "inefficiently spliced" (splicing rate 50%). The ORF had been annotated as 435 nt long (144 aa), but is now 557 nt long with a 134-nt intron (140 aa).<br> <br>
 +
'''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br>
 +
[https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br>
 +
'''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7.
 +
<br>
 +
[https://www.yeastgenome.org/reference/S000120506 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17244705 PubMed] | [https://www.pnas.org/content/104/5/1522.long Full-Text] <br>
 +
'''Zhang Z, et al.''' (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9. <br>
 +
[https://www.yeastgenome.org/reference/S000121920 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17351133 PubMed] | [https://genome.cshlp.org/content/17/4/503 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=17351133&db=pmid YFGdb]<br>
 +
|-
 +
| 2007-05-09
 +
| [https://www.yeastgenome.org/locus/YPR010C-A YPR010C-A] <br>
 +
YPR010C-A added as a new ORF on ChrXVI between tRNA-Lys and YPR011C. Contains an intron and is conserved among all the Saccharomyces sensu stricto species. Ken Wolfe's lab found a conserved homolog in Kluyveromyces polysporus, without an intron.
 +
''Note: Miura et al. refer to this as "transcription unit no. 633".''<br> <br>
 +
'''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br>
 +
[https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br>
 +
|-
 +
| 2007-05-09
 +
| [https://www.yeastgenome.org/locus/snR70 snR70] <br>
 +
Updated coordinates of snR70 based on GenBank AF064282. Removed 1 nt from 5' end.<br> <br>
 +
|-
 +
| 2007-04-04
 +
| [https://www.yeastgenome.org/locus/YPL230W YPL230W] <br>
 +
YPL230W mRNA contains an intron in the 5' untranslated region (UTR).<br> <br>
 +
'''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br>
 +
[https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br>
 +
|-
 +
| 2006-10-04
 +
| [https://www.yeastgenome.org/locus/ARS1633 ARS1633], [https://www.yeastgenome.org/locus/ARS1634 ARS1634], [https://www.yeastgenome.org/locus/ARS1635 ARS1635] <br>
 +
The following ARS elements on Chromosome XVI were added to SGD based on Nieduszynski et al. 2006: ARS1633/1620.5, ARS1634/1622.5, ARS1635/1626.5. <br> <br>
 +
'''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br>
 +
[https://www.yeastgenome.org/reference/S000117321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] | [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br>
 +
|-
 +
| 2006-09-08
 +
| [https://www.yeastgenome.org/locus/ARS1604 ARS1604], [https://www.yeastgenome.org/locus/ARS1605 ARS1605], [https://www.yeastgenome.org/locus/ARS1607 ARS1607], [https://www.yeastgenome.org/locus/ARS1614 ARS1614], [https://www.yeastgenome.org/locus/ARS1618 ARS1618], [https://www.yeastgenome.org/locus/ARS1619 ARS1619], [https://www.yeastgenome.org/locus/ARS1621 ARS1621], [https://www.yeastgenome.org/locus/ARS1622 ARS1622], [https://www.yeastgenome.org/locus/ARS1623 ARS1623], [https://www.yeastgenome.org/locus/ARS1624 ARS1624], [https://www.yeastgenome.org/locus/ARS1625 ARS1625], [https://www.yeastgenome.org/locus/ARS1626 ARS1626], [https://www.yeastgenome.org/locus/ARS1627 ARS1627], [https://www.yeastgenome.org/locus/ARS1628 ARS1628], [https://www.yeastgenome.org/locus/ARS1630 ARS1630], [https://www.yeastgenome.org/locus/ARS1631 ARS1631] <br>
 +
The following new ARS elements on Chromosome XVI were added to SGD based on Nieduszynski et al. 2006: ARS1604, ARS1605, ARS1607, ARS1614, ARS1618, ARS1619, ARS1621, ARS1622, ARS1623, ARS1624, ARS1625, ARS1626, ARS1627, ARS1628, ARS1630, ARS1631.<br> <br>
 +
'''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br>
 +
[https://www.yeastgenome.org/reference/S000117321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] | [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br>
 +
|-
 +
| 2006-05-09
 +
| [https://www.yeastgenome.org/locus/CEN16 CEN16] <br>
 +
The previously annotated 3' boundary of CEN16 was moved 1 bp upstream to coincide with the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in ''Saccharomyces cerevisiae''.<br><br>
 +
'''Wieland G, et al.''' (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60. <br>
 +
[https://www.yeastgenome.org/reference/S000059647 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11222754 PubMed] | [https://academic.oup.com/nar/article/29/5/1054/2381189 Full-Text]<br>
 +
'''Espelin CW, et al.''' (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68. <br>
 +
[https://www.yeastgenome.org/reference/S000074756 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/13679521 PubMed] | [https://www.molbiolcell.org/doi/full/10.1091/mbc.e02-08-0533?url_ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed Full-Text]<br>
 +
|-
 +
| 2005-12-14
 +
| [https://www.yeastgenome.org/locus/YPL052W YPL052W], [https://www.yeastgenome.org/locus/YPL052W-A YPL052W-A] <br>
 +
Palanimurugan et al. 2004 have shown that the translation start site of OAZ1/YPL052W is located at chromosomal coordinate 458796, 274 bp upstream from the originally annotated start site. This change results in a merge of upstream ORF YPL052W-A into OAZ1/YPL052W. The full translation product is generated by translational frameshifting to skip the first base of what was previously annotated as the stop codon of YPL052W-A.<br><br>
 +
'''Palanimurugan R, et al.''' (2004) Polyamines regulate their synthesis by inducing expression and blocking degradation of ODC antizyme. EMBO J 23(24):4857-67. <br>
 +
[https://www.yeastgenome.org/reference/S000079797 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/15538383 PubMed] | [https://www.embopress.org/doi/10.1038/sj.emboj.7600473 Full-Text] <br>
 +
|-
 +
| 2005-12-13
 +
| [https://www.yeastgenome.org/locus/YPL052W-A YPL052W-A] <br>
 +
Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that this new ORF, YPL052W-A, be added to the S. cerevisiae genome annotation.<br><br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2005-12-01
 +
| [https://www.yeastgenome.org/locus/YPR169W YPR169W] <br>
 +
The work of Zhang & Dietrich 2005 confirmed the suggestion from Kellis et al. 2003 that the start site of YPR169W be moved 66 nt downstream from 878620 to 878686. This annotation change results in a predicted protein of 492 aa, as opposed to the previously annotated 514 aa.<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Zhang Z and Dietrich FS''' (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51. <br>
 +
[https://www.yeastgenome.org/reference/S000082006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/15905473 PubMed] | [https://academic.oup.com/nar/article/33/9/2838/2401448 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=15905473&db=pmid YFGdb]<br>
 +
|-
 +
| 2005-11-21
 +
| [https://www.yeastgenome.org/locus/YPR145C-A YPR145C-A] <br>
 +
Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that this new ORF, YPR145C-A, be added to the S. cerevisiae genome annotation.<br><br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2004-10-12
 +
| [https://www.yeastgenome.org/locus/CEN16 CEN16] <br>
 +
Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.<br><br>
 +
'''Wieland G, et al.''' (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60. <br>
 +
[https://www.yeastgenome.org/reference/S000059647 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11222754 PubMed] | [https://academic.oup.com/nar/article/29/5/1054/2381189 Full-Text]<br>
 +
'''Espelin CW, et al.''' (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68. <br>
 +
[https://www.yeastgenome.org/reference/S000074756 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/13679521 PubMed] | [https://www.molbiolcell.org/doi/full/10.1091/mbc.e02-08-0533?url_ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed Full-Text]<br>
 +
|-
 +
| 2004-04-01
 +
| [https://www.yeastgenome.org/locus/RUF6 RUF6] <br>
 +
Feature annotation removed per John McCutcheon and Sean Eddy.<br><br>
 +
'''McCutcheon JP and Eddy SR''' (2004) Detailed correction to: Computational identification of noncoding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res. 31:4119-4128, 2003. <br>
 +
[https://www.yeastgenome.org/reference/S000074006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12853629 PubMed] | [https://academic.oup.com/nar/article/31/14/4119/2904330#55548715 Full-Text] <br>
 +
|-
 +
| 2004-01-09
 +
| [https://www.yeastgenome.org/locus/YPL094C YPL094C] <br>
 +
Start moved 27 bp downstream; protein is actually 274 aa rather than the previously annotated 283 aa. This is an annotation change only; no sequence change. See Willer et al. This change was also suggested by Kellis et al. based on the automated comparison of closely related Saccharomyces species.<br><br>
 +
'''Willer M, et al.''' (2003) Identification of novel protein-protein interactions at the cytosolic surface of the Sec63 complex in the yeast ER membrane. Yeast 20(2):133-48.<br>
 +
[https://www.yeastgenome.org/reference/S000072462 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12518317 PubMed] | [https://onlinelibrary.wiley.com/doi/full/10.1002/yea.954 Full-Text] <br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
|-
 +
| 2003-09-27
 +
| [https://www.yeastgenome.org/locus/YPL109C YPL109C] <br>
 +
Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 3' exon for YPL109C. The resulting ORF is 47 residues longer and has an altered C-terminus. This proposal was reviewed and accepted by SGD curators.<br><br>
 +
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
 +
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2003-09-27
 +
| [https://www.yeastgenome.org/locus/YPR098C YPR098C] <br>
 +
Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 5' exon for YPR098C. The resulting ORF is in the same frame, but has a 53-residue extension at the N-terminus. This change was reviewed and accepted by SGD curators.<br><br>
 +
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
 +
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2003-09-22
 +
| [https://www.yeastgenome.org/locus/YPR047W YPR047W] <br>
 +
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for MSF1/YPR047W be moved 15 nt (5 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) This protein is predicted to have a function in mitochondria and using the new 5' coordinate in prediction programs (MITOP and Predator) still results in a strong prediction that Msf1p will be targeted to the mitochondria.<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2003-09-22
 +
| [https://www.yeastgenome.org/locus/YPR085C YPR085C] <br>
 +
The automated comparison of closely related Saccharomyces species suggests that the start site for YPR085C be moved 15 nt (5 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2003-09-22
 +
| [https://www.yeastgenome.org/locus/YPL270W YPL270W] <br>
 +
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for MDL2/YPL270W be moved 141 nt (47 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Although a corresponding ATG is found at the original start (30341) in S. paradoxus, S. mikatae, and S. bayanus, there are indels between this ATG and the predicted start site which lead to frameshifts in the predicted mRNAs in non S. cerevisiae sequences. 4) the protein is found in mitochondria (Young et al.) and the MITPROT prediction program predicts a signal cleavage site for the new shorter protein suggesting this protein would be targeted to the mitochondria. In contrast, mitochondrial targeting is not predicted with the protein's original start at 30341.<br><br>
 +
'''Young L, et al.''' (2001) Role of the ABC transporter Mdl1 in peptide export from mitochondria. Science 291(5511):2135-8. <br>
 +
[https://www.yeastgenome.org/reference/S000060200 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11251115 PubMed] | [https://science.sciencemag.org/content/291/5511/2135.long Full-Text] <br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2003-09-22
 +
| [https://www.yeastgenome.org/locus/YPR093C YPR093C] <br>
 +
The automated comparison of closely related Saccharomyces species suggests that the start site for YPR093C be moved 66 nt (22 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2003-09-22
 +
| [https://www.yeastgenome.org/locus/YPL210C YPL210C] <br>
 +
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for SRP72/YPL210C be moved 18 nt (6 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of ''Saccharomyces'' species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The first ATG at 156229 is not conserved in the other ''Saccharomyces'' species; 4) Protein sequence comparisons against the nr dataset show that sequence similarity begins after 156211 between S. cerevisiae YPL210C and related proteins.<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2003-09-22
 +
| [https://www.yeastgenome.org/locus/YPR175W YPR175W] <br>
 +
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for DPB2/YPR175W be moved 9 nt (3 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of ''Saccharomyces'' species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The first ATG at 888960 is not conserved in ''S. paradoxus'', ''S. mikatae'', and ''S. bayanus''.<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2003-09-22
 +
| [https://www.yeastgenome.org/locus/YPL148C YPL148C] <br>
 +
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PPT2/YPL148C be moved 12 nt (4 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al. 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2003-09-09
 +
| [https://www.yeastgenome.org/locus/TEL16L TEL16L], [https://www.yeastgenome.org/locus/TEL16R TEL16R] <br>
 +
The chromosomal locations for TEL16L, TEL16L-XC, TEL16L-XR, TEL16L-YP, TEL16R, TEL16R-XC, and TEL16R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).<br><br>
 +
Note that both TEL16L and TEL16R have telomeric repeats (TEL16L-TR and TEL16R-TR), but they are missing from the genome annotation due to sequencing difficulties encountered during the initial genome sequencing efforts in the 1990s.<br><br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YPL189C-A YPL189C-A] <br>
 +
Thanks to Brachat et al. for providing the coordinates of YPL189C-A.<br><br>
 +
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
 +
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YPR170W-B YPR170W-B] <br>
 +
Thanks to Brachat et al. for providing the coordinates of YPL189C-A.<br><br>
 +
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
 +
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YPL135C-A YPL135C-A], [https://www.yeastgenome.org/locus/YPL152W-A YPL152W-A], [https://www.yeastgenome.org/locus/YPL222C-A YPL222C-A], [https://www.yeastgenome.org/locus/YPL283W-A YPL283W-A], [https://www.yeastgenome.org/locus/YPL283W-B YPL283W-B], [https://www.yeastgenome.org/locus/YPR159C-A YPR159C-A], [https://www.yeastgenome.org/locus/YPR160C-A YPR160C-A], [https://www.yeastgenome.org/locus/YPR204C-A YPR204C-A] <br>
 +
Thanks to Kumar et al. for providing the coordinates of the following Chromosome XVI ORFs: YPL152W-A, YPL222C-A, YPL283W-A, YPL283W-B, YPR159C-A, YPR160C-A, YPR204C-A, and YPL135C-A.<br> <br>
 +
'''Kumar A, et al.''' (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63. <br>
 +
[https://www.yeastgenome.org/reference/S000073673 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11753363 PubMed] | [https://www.nature.com/articles/nbt0102-58 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11753363&db=pmid YFGdb] | [https://www.yeastgenome.org/reference/S000141796 Comments & Errata] <br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YPL038W-A YPL038W-A], [https://www.yeastgenome.org/locus/YPL250W-A YPL250W-A], [https://www.yeastgenome.org/locus/YPR108W-A YPR108W-A], [https://www.yeastgenome.org/locus/YPR169W-A YPR169W-A]<br>
 +
Thanks to Kessler et al. for providing the coordinates of the following Chromosome XVI ORFs: YPR169W-A, YPR108W-A, YPL038W-A, and YPL250W-A.<br> <br>
 +
'''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br>
 +
[https://www.yeastgenome.org/reference/S000073671 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] | [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YPL119C-A YPL119C-A], [https://www.yeastgenome.org/locus/YPR160W-A YPR160W-A], [https://www.yeastgenome.org/locus/YPR170W-A YPR170W-A] <br>
 +
Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XVI ORFs: YPR170W-A, YPL119C-A and YPR160W-A.<br> <br>
 +
'''Basrai MA, et al.''' (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9. <br>
 +
[https://www.yeastgenome.org/reference/S000042214 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10490641 PubMed] | [https://mcb.asm.org/content/19/10/7041.long Full-Text] <br>
 +
'''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br>
 +
[https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br>
 +
'''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br>
 +
[https://www.yeastgenome.org/reference/S000073672 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] | [https://genome.cshlp.org/content/12/8/1210.long Full-Text] | [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br>
 +
|-
 +
| 2003-05-23
 +
| [https://www.yeastgenome.org/locus/YPR131C YPR131C] <br>
 +
The start site of NAT3/YPR131C has been moved 168 nt downstream from 794661 to 794493 based on experimental evidence as well as sequence comparisons in other species published by Polevoda et al. Also, the downstream ATG codon is clearly conserved in the closely related sensu stricto Saccharomyces species. <br><br>
 +
'''Polevoda B, et al.''' (2003) Nat3p and Mdm20p are required for function of yeast NatB Nalpha-terminal acetyltransferase and of actin and tropomyosin. J Biol Chem 278(33):30686-97. <br>
 +
[https://www.yeastgenome.org/reference/S000073825 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12783868 PubMed] | [http://www.jbc.org/content/278/33/30686.long Full-Text] <br>
 +
|-
 +
| 2003-03-06
 +
| [https://www.yeastgenome.org/locus/RUF6 RUF6] <br>
 +
Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8. <br><br>
 +
'''McCutcheon JP and Eddy SR''' (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28. <br>
 +
[https://www.yeastgenome.org/reference/S000074006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12853629 PubMed] | [https://academic.oup.com/nar/article/31/14/4119/2904330 Full-Text] <br>
 +
|-
 +
| 2002-07-25
 +
| [https://www.yeastgenome.org/locus/YPR036W-A YPR036W-A] <br>
 +
Based on the work of Miura et al. (2001), the new ORF YPR036W-A was added to Chromosome XV. <br><br>
 +
'''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br>
 +
[https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br>
 +
|-
 +
| 1999-07-17
 +
| [https://www.yeastgenome.org/locus/YPR111W YPR111W] <br>
 +
The intron in ORF YPR111W was removed. The start, stop, and frame were left as is, so that the sequence that was previously annotated as the intron is now part of the translation. The chromosomal coordinates of the coding region change from 747303-747593..748014-748997 to 747303-748997. The relative coordinates of the coding region change from 1-291..712-1695 to 1-1695.<br><br>
 +
|-
 +
| 1998-05-21
 +
| [https://www.yeastgenome.org/locus/YPR002C-A YPR002C-A] <br>
 +
The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. <br><br>
 +
The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.<br><br>
 +
'''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br>
 +
[https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br>
 +
|-
 +
| 1997-10-20
 +
| [https://www.yeastgenome.org/locus/YPL075W YPL075W] <br>
 +
Edition 14: The GCR1 gene was modified in October 1997 to include an intron reported by Tornow and Santangelo (1994).<br><br>
 +
'''Tornow J and Santangelo G''' (1994) The GCR1 gene of Saccharomyces cerevisiae is a split gene with an unusually long intron. Genetics 138(3):973-4. <br>
 +
[https://www.yeastgenome.org/reference/S000050346 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/7851789 PubMed] | [https://www.genetics.org/content/138/3/973.long Full-Text] <br>
 +
'''Cherry JM, et al.''' (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73. <br>
 +
[https://www.yeastgenome.org/reference/S000060841 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9169866 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3057085/ Full-Text] <br>
 +
 +
|}

Latest revision as of 15:10, 21 April 2022

This page lists all sequence and annotation changes that have been made to the Chromosome XVI systematic reference sequence since its intial release on 1996-07-31.

  • The sequence of Chromosome XVI has been updated 23 times, affecting 16 features.
  • The annotation of Chromosome XVI has been updated 40 times, affecting 73 features.
  • Current and past versions can be obtained from SGD's Download site.


Sequence Changes

Date Affected Features Start Coordinate of Change End Coordinate of Change Type of Change Old Sequence New Sequence
2011-02-03 YPL224C 128039 128039 Substitution T G
126768 126768 Insertion C
Two nucleotide changes were made within the ORF MMT2/YPL224C, altering its coding sequence: one single nucleotide substitution near the 5' end, and one single nucleotide insertion near the 3' end. The start and majority of the reading frame remain the same, but the C-terminus has changed, and the annotated protein is now 35 amino acids longer.
New 126721 ACCTTTAGAGTCAGAGGTTACATCAACAAACTCGACGTCCACCTTCCCCACGTTTGGCAC  126780
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old 126721 ACCTTTAGAGTCAGAGGTTACATCAACAAACTCGACGTCCACCTTCCC-ACGTTTGGCAC  126779

New 127981 CAGGCTTGATGTTCTTATGGCCCTCCCGGCAGCATGGTAACTAGTGTTGTTATAACCTGGCACAAAGGAA  128050
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old 127980 CAGGCTTGATGTTCTTATGGCCCTCCCGGCAGCATGGTAACTAGTGTTGTTATAACCTGTCACAAAGGAA  128049

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YPR035W 642955 642955 Substitution G A
642995 642995 Substitution C T
Nucleotide change(s) in the coding region of GLN1/YPR035W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 251 is now Threonine rather than Alanine, and residue 264 is now Methionine rather than Threonine.
New  642949 GGTTGTCACACTAACGTTTCCACCAAGGAAATGAGACAACCAGGTGGTATGAAATACATCGAACAAGCCA 643018
            ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old  642946 GGTTGTCACGCTAACGTTTCCACCAAGGAAATGAGACAACCAGGTGGTACGAAATACATCGAACAAGCCA 643015

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YPR097W 727933 727933 Substitution G A
A single nucleotide substitution within the coding region of YPR097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 848 is now Serine rather than Glycine.
New    727918  ATTTTGAGAAGTTCATGAGTGATTTGATCAGGCTTGTTGATGATGTTATCAATGGTCAGT  727977
               ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old    727916  ATTTTGAGAAGTTCATGGGTGATTTGATCAGGCTTGTTGATGATGTTATCAATGGTCAGT  727975

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YPR121W 778863 778863 Substitution T A
A single nucleotide substitution within the coding region of THI22/YPR121W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 95 is now Glutamine rather than Histidine.
New    778858  CGGCGCTCAAAATATACCAAAGAAAATGGTATCTCAAATATTAGACGCCAATTTACAGGA  778917
               ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Old    778854  CGGCGCTCATAATATACCAAAGAAAATGGTATCTCAAATATTAGACGCCAATTTACAGGA  778913

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YPL108W, YPL109C 347528 347528 Insertion G
347759 347759 Insertion C
Two separate single nucleotides were inserted in the intergenic region between ORFs YPL109C and YPL108W.
New    347521  GGTATTATTGCCCCTCATATATTCGGGGTTATTTATTTTTCGTTGCTTGAAGTAAAGCCT  347580
               ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Old    347520  GGTATTATT-CCCCTCATATATTCGGGGTTATTTATTTTTCGTTGCTTGAAGTAAAGCCT  347578
New    347751  CCCTTTCGCGGCACTTTTTCTCTTAGCTCTGCTTGATACATCGACTGGGAACTTCTTCTCTTTGAGCCAA  347820
               ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    347749  CCCTTTCGCGG-ACTTTTTCTCTTAGCTCTGCTTGATACATCGACTGGGAACTTCTTCTCTTTGAGCCAA  347817

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YPR121W, YPRWdelta16 778376 778376 Insertion C
778302 778302 Insertion G
Two single nucleotide insertions were made in the intergenic region between YPRWdelta16 and YPR121W/THI22.
 New    778258  TTAATGGAATAACGTGATTTTTGTACCAAATTGCCTATTTCAGATTCGGCGTGCGCTTCC  778317
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    778256  TTAATGGAATAACGTGATTTTTGTACCAAATTGCCTATTTCAGATTC-GCGTGCGCTTCC  778314
New    778368  TGCACGGAAGATCCTTGCAGGAATCAAATACTGCCTTTCACTTTGCAACCTCTTAATCACATAGTAGCAC  778437
               |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    778365  TGCACGGAAGAT-CTTGCAGGAATCAAATACTGCCTTTCACTTTGCAACCTCTTAATCACATAGTAGCAC  778433

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YPR035W, YPR036W 643579 643579 Substitution T C
A single nucleotide substitution was made in the intergenic region between ORFs YPR035W/GLN1 and YPR036W/VMA13.
 New    643559  TCGAATTTTTTCTTTTTTTTTTTCTGCAAAGCGACGCTGTGTTGTATATTGCTCTAAAAT  643618
               ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old    643556  TCGAATTTTTTCTTTTTTTTTTTTTGCAAAGCGACGCTGTGTTGTATATTGCTCTAAAAT  643615

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YPL016W 523639 523639 Substitution C T
A single nucleotide substitution was made within the ORF SWI1/YPL016W. Note that the protein sequence was not changed.
New    523619  GATTCCTCCCTAACCAATTTCCTTTGAAAATTCACAGAACTCCTTATTTGACTTCTTTGA  523678
               ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old    523616  GATTCCTCCCTAACCAATTTCCTCTGAAAATTCACAGAACTCCTTATTTGACTTCTTTGA  523675

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YPL016W, YPL017C 520375 520375 Insertion C
520378 520378 Substitution C G
520646 520646 Insertion C
520818 520818 Deletion T
Four single nucleotide changes were made in the intergenic region between ORFs YPL016W/SWI1 and YPL017C/IRC15: two insertions, one substitution, and one deletion.
New    520320  AGATGCATGCCTGCAGGTCTGGGTGTACCCCCTGCCTGAGTGTTCCACCCAGGCCTCGCCGGAGGAAAAT  520389
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||
Old    520318  AGATGCATGCCTGCAGGTCTGGGTGTACCCCCTGCCTGAGTGTTCCACCCAGGCCTCG-CGCAGGAAAAT  520386
New    520620  CATATTCACATTGCGTTTTAGTCATAACCACCTTCCGGTATTCATCATTCGTATTGAATA  520679
               |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Old    520617  CATATTCACATTGCGTTTTAGTCATAACCA-CTTCCGGTATTCATCATTCGTATTGAATA  520675
New    520800  ATCTCTGCTTTGGCATTTCGCG-TTGTTTCCTCTCACGGATTGCAGATTATTGTTCACCA  520858
               |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old    520796  ATCTCTGCTTTGGCATTTCGCGTTTGTTTCCTCTCACGGATTGCAGATTATTGTTCACCA  520855

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YPL036W, YPL037C 482773 482773 Deletion T
A single nucleotide was deleted from the intergenic region between ORFs YPL037C/EGD1 and YPL036W/PMA2.
New    482761  AAACATACCCATAAC-TTTTTTTTTTTCATTTTTCGTTGCTGTGTGCTAGTACAATTTAA  482819
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    482758  AAACATACCCATAACTTTTTTTTTTTTCATTTTTCGTTGCTGTGTGCTAGTACAATTTAA  482817

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YPR078C, YPR079W 698524 698524 Deletion A
A single nucleotide deletion was made in the intergenic region between ORFs YPR078C and YPR079W/MRL1.
New    698519  TTCTTCTG-AAAAAAAAAAAAAAAAATTCAAAAAAAGACACCTTTCTACCTTGGCAGTAA  698577
               |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Old    698516  TTCTTCTGAAAAAAAAAAAAAAAAAATTCAAAAAAAGACACCTTTCTACCTTGGCAGTAA  698575

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2004-07-21 YPL109C 347273 347273 Insertion T
347265 347265 Deletion T
347285 347285 Insertion A
347375 347375 Insertion T
The works of Kellis et al. 2003 and Cliften et al. 2003 predicted multiple insertions and deletions in YPL109C, and the sequence errors were confirmed in S288C by SGD. As a consequence of these changes, YPL109C was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 590 to 657 amino acids.
New:        TGTTTTGGAAACGAATTTT-GTGTCAAATAAAAAGCAATTGACGTAGGTATTATGAACTG
            ||||||||||||||||||| |||||||| |||||||||||| ||||||||||||||||||
Old: 347246 TGTTTTGGAAACGAATTTTTGTGTCAAA-AAAAAGCAATTG-CGTAGGTATTATGAACTG 347303

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-29 YPR089W, YPR090W 713683 713683 Deletion T
Due to deletion of a T at position 713683, YPR089W and YPR090W were merged. After merging YPR089W (713271 - 713738 (1-468)) and YPR090W (713728 - 715938 (1-2211)), the coordinates of the merged ORF, YPR089W, are 713271 - 715937 (1-2667). YPR090W is now an alias of YPR089W.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement



Annotation Changes without sequence changes

Date Affected Features
2021-04-21 YNCP0002W aka GAL4 lncRNA

New ncRNA

  • coordinates: 79562..82648
Geisler et al 2012 PMID:22226051
2014-11-19 ARS1605, ARS1607, ARS1621, ARS1622, ARS1625

The chromosomal coordinates of the following ARS elements on Chromosome XVI were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1605, ARS1607, ARS1621, ARS1622, ARS1625.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704.
SGD paper | PubMed | Full-Text

2014-11-19 ARS1604, ARS1607, ARS1614, ARS1618, ARS1619, ARS1621, ARS1622, ARS1623, ARS1624, ARS1625, ARS1626, ARS1627, ARS1628, ARS1630, ARS1631

As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome XVI based on Liachko et al. 2013: ARS1604, ARS1607, ARS1614, ARS1618, ARS1619, ARS1621, ARS1622, ARS1623, ARS1624, ARS1625, ARS1626, ARS1627, ARS1628, ARS1630, ARS1631.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704.
SGD paper | PubMed | Full-Text

2014-11-19 YPL060C-A

YPL060C-A had been erroneously identified as a pseudogene because it was incompletely annotated. As part of SGD's genome annotation revision R64.2, the feature_type of YPL060C-A was changed from pseudogene to transposable_element_gene, and the missing plus_1_translational_frameshift and remainder of the gene were added.

Old coordinates:
442742..439428 CDS
New coordinates:
442742..439429 CDS
439428..439428 plus_1_translational_frameshift
439427..437333 CDS

Kim JM, et al. (1998) Transposable elements and genome organization: a comprehensive survey of retrotransposons revealed by the complete Saccharomyces cerevisiae genome sequence. Genome Res 8(5):464-78.
SGD paper | PubMed | Full-Text
Lawler JF Jr, et al. (2001) Frameshift signal transplantation and the unambiguous analysis of mutations in the yeast retrotransposon Ty1 Gag-Pol overlap region. J Virol 75(15):6769-75.
SGD paper | PubMed | Full-Text

2009-05-08 ARS1603, ARS1608, ARS1611, ARS1612, ARS1617, ARS1620, ARS1629, ARS1632

The following ARS elements on Chromosome 16 were added to the genome annotation based on Raveendranathan et al. 2006: ARS1603, ARS1608, ARS1611, ARS1612, ARS1617, ARS1620, ARS1629, and ARS1632.

Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39.
SGD paper | PubMed | Full-Text

2007-07-10 YPR153W

The start of ORF YPR153W was moved 122 nt upstream and an intron was added at relative coordinates 6..139 based on GenBank EF123126, Juneau et al. 2007, Zhang et al. 2007, and Miura et al. 2006. According to Juneau et al. 2007, the intron is "inefficiently spliced" (splicing rate 50%). The ORF had been annotated as 435 nt long (144 aa), but is now 557 nt long with a 134-nt intron (140 aa).

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51.
SGD paper | PubMed | Full-Text
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7.
SGD paper | PubMed | Full-Text
Zhang Z, et al. (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9.
SGD paper | PubMed | Full-Text | YFGdb

2007-05-09 YPR010C-A

YPR010C-A added as a new ORF on ChrXVI between tRNA-Lys and YPR011C. Contains an intron and is conserved among all the Saccharomyces sensu stricto species. Ken Wolfe's lab found a conserved homolog in Kluyveromyces polysporus, without an intron. Note: Miura et al. refer to this as "transcription unit no. 633".

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51.
SGD paper | PubMed | Full-Text

2007-05-09 snR70

Updated coordinates of snR70 based on GenBank AF064282. Removed 1 nt from 5' end.

2007-04-04 YPL230W

YPL230W mRNA contains an intron in the 5' untranslated region (UTR).

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51.
SGD paper | PubMed | Full-Text

2006-10-04 ARS1633, ARS1634, ARS1635

The following ARS elements on Chromosome XVI were added to SGD based on Nieduszynski et al. 2006: ARS1633/1620.5, ARS1634/1622.5, ARS1635/1626.5.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9.
SGD paper | PubMed | Full-Text | Web Supplement

2006-09-08 ARS1604, ARS1605, ARS1607, ARS1614, ARS1618, ARS1619, ARS1621, ARS1622, ARS1623, ARS1624, ARS1625, ARS1626, ARS1627, ARS1628, ARS1630, ARS1631

The following new ARS elements on Chromosome XVI were added to SGD based on Nieduszynski et al. 2006: ARS1604, ARS1605, ARS1607, ARS1614, ARS1618, ARS1619, ARS1621, ARS1622, ARS1623, ARS1624, ARS1625, ARS1626, ARS1627, ARS1628, ARS1630, ARS1631.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9.
SGD paper | PubMed | Full-Text | Web Supplement

2006-05-09 CEN16

The previously annotated 3' boundary of CEN16 was moved 1 bp upstream to coincide with the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60.
SGD paper | PubMed | Full-Text
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68.
SGD paper | PubMed | Full-Text

2005-12-14 YPL052W, YPL052W-A

Palanimurugan et al. 2004 have shown that the translation start site of OAZ1/YPL052W is located at chromosomal coordinate 458796, 274 bp upstream from the originally annotated start site. This change results in a merge of upstream ORF YPL052W-A into OAZ1/YPL052W. The full translation product is generated by translational frameshifting to skip the first base of what was previously annotated as the stop codon of YPL052W-A.

Palanimurugan R, et al. (2004) Polyamines regulate their synthesis by inducing expression and blocking degradation of ODC antizyme. EMBO J 23(24):4857-67.
SGD paper | PubMed | Full-Text

2005-12-13 YPL052W-A

Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that this new ORF, YPL052W-A, be added to the S. cerevisiae genome annotation.

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2005-12-01 YPR169W

The work of Zhang & Dietrich 2005 confirmed the suggestion from Kellis et al. 2003 that the start site of YPR169W be moved 66 nt downstream from 878620 to 878686. This annotation change results in a predicted protein of 492 aa, as opposed to the previously annotated 514 aa.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51.
SGD paper | PubMed | Full-Text | YFGdb

2005-11-21 YPR145C-A

Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that this new ORF, YPR145C-A, be added to the S. cerevisiae genome annotation.

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2004-10-12 CEN16

Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60.
SGD paper | PubMed | Full-Text
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68.
SGD paper | PubMed | Full-Text

2004-04-01 RUF6

Feature annotation removed per John McCutcheon and Sean Eddy.

McCutcheon JP and Eddy SR (2004) Detailed correction to: Computational identification of noncoding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res. 31:4119-4128, 2003.
SGD paper | PubMed | Full-Text

2004-01-09 YPL094C

Start moved 27 bp downstream; protein is actually 274 aa rather than the previously annotated 283 aa. This is an annotation change only; no sequence change. See Willer et al. This change was also suggested by Kellis et al. based on the automated comparison of closely related Saccharomyces species.

Willer M, et al. (2003) Identification of novel protein-protein interactions at the cytosolic surface of the Sec63 complex in the yeast ER membrane. Yeast 20(2):133-48.
SGD paper | PubMed | Full-Text
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata

2003-09-27 YPL109C

Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 3' exon for YPL109C. The resulting ORF is 47 residues longer and has an altered C-terminus. This proposal was reviewed and accepted by SGD curators.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-27 YPR098C

Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 5' exon for YPR098C. The resulting ORF is in the same frame, but has a 53-residue extension at the N-terminus. This change was reviewed and accepted by SGD curators.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YPR047W

Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for MSF1/YPR047W be moved 15 nt (5 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) This protein is predicted to have a function in mitochondria and using the new 5' coordinate in prediction programs (MITOP and Predator) still results in a strong prediction that Msf1p will be targeted to the mitochondria.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YPR085C

The automated comparison of closely related Saccharomyces species suggests that the start site for YPR085C be moved 15 nt (5 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YPL270W

Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for MDL2/YPL270W be moved 141 nt (47 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Although a corresponding ATG is found at the original start (30341) in S. paradoxus, S. mikatae, and S. bayanus, there are indels between this ATG and the predicted start site which lead to frameshifts in the predicted mRNAs in non S. cerevisiae sequences. 4) the protein is found in mitochondria (Young et al.) and the MITPROT prediction program predicts a signal cleavage site for the new shorter protein suggesting this protein would be targeted to the mitochondria. In contrast, mitochondrial targeting is not predicted with the protein's original start at 30341.

Young L, et al. (2001) Role of the ABC transporter Mdl1 in peptide export from mitochondria. Science 291(5511):2135-8.
SGD paper | PubMed | Full-Text
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YPR093C

The automated comparison of closely related Saccharomyces species suggests that the start site for YPR093C be moved 66 nt (22 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YPL210C

Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for SRP72/YPL210C be moved 18 nt (6 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The first ATG at 156229 is not conserved in the other Saccharomyces species; 4) Protein sequence comparisons against the nr dataset show that sequence similarity begins after 156211 between S. cerevisiae YPL210C and related proteins.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YPR175W

Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for DPB2/YPR175W be moved 9 nt (3 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The first ATG at 888960 is not conserved in S. paradoxus, S. mikatae, and S. bayanus.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YPL148C

Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PPT2/YPL148C be moved 12 nt (4 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al. 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-09 TEL16L, TEL16R

The chromosomal locations for TEL16L, TEL16L-XC, TEL16L-XR, TEL16L-YP, TEL16R, TEL16R-XC, and TEL16R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).

Note that both TEL16L and TEL16R have telomeric repeats (TEL16L-TR and TEL16R-TR), but they are missing from the genome annotation due to sequencing difficulties encountered during the initial genome sequencing efforts in the 1990s.

2003-07-29 YPL189C-A

Thanks to Brachat et al. for providing the coordinates of YPL189C-A.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text

2003-07-29 YPR170W-B

Thanks to Brachat et al. for providing the coordinates of YPL189C-A.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-07-29 YPL135C-A, YPL152W-A, YPL222C-A, YPL283W-A, YPL283W-B, YPR159C-A, YPR160C-A, YPR204C-A

Thanks to Kumar et al. for providing the coordinates of the following Chromosome XVI ORFs: YPL152W-A, YPL222C-A, YPL283W-A, YPL283W-B, YPR159C-A, YPR160C-A, YPR204C-A, and YPL135C-A.

Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63.
SGD paper | PubMed | Full-Text | YFGdb | Comments & Errata

2003-07-29 YPL038W-A, YPL250W-A, YPR108W-A, YPR169W-A

Thanks to Kessler et al. for providing the coordinates of the following Chromosome XVI ORFs: YPR169W-A, YPR108W-A, YPL038W-A, and YPL250W-A.

Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71.
SGD paper | PubMed | Full-Text

2003-07-29 YPL119C-A, YPR160W-A, YPR170W-A

Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XVI ORFs: YPR170W-A, YPL119C-A and YPR160W-A.

Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9.
SGD paper | PubMed | Full-Text
Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51.
SGD paper | PubMed | Full-Text | YFGdb
Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20.
SGD paper | PubMed | Full-Text | Web Supplement | YFGdb

2003-05-23 YPR131C

The start site of NAT3/YPR131C has been moved 168 nt downstream from 794661 to 794493 based on experimental evidence as well as sequence comparisons in other species published by Polevoda et al. Also, the downstream ATG codon is clearly conserved in the closely related sensu stricto Saccharomyces species.

Polevoda B, et al. (2003) Nat3p and Mdm20p are required for function of yeast NatB Nalpha-terminal acetyltransferase and of actin and tropomyosin. J Biol Chem 278(33):30686-97.
SGD paper | PubMed | Full-Text

2003-03-06 RUF6

Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8.

McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28.
SGD paper | PubMed | Full-Text

2002-07-25 YPR036W-A

Based on the work of Miura et al. (2001), the new ORF YPR036W-A was added to Chromosome XV.

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51.
SGD paper | PubMed | Full-Text

1999-07-17 YPR111W

The intron in ORF YPR111W was removed. The start, stop, and frame were left as is, so that the sequence that was previously annotated as the intron is now part of the translation. The chromosomal coordinates of the coding region change from 747303-747593..748014-748997 to 747303-748997. The relative coordinates of the coding region change from 1-291..712-1695 to 1-1695.

1998-05-21 YPR002C-A

The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A.

The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.

Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51.
SGD paper | PubMed | Full-Text | YFGdb

1997-10-20 YPL075W

Edition 14: The GCR1 gene was modified in October 1997 to include an intron reported by Tornow and Santangelo (1994).

Tornow J and Santangelo G (1994) The GCR1 gene of Saccharomyces cerevisiae is a split gene with an unusually long intron. Genetics 138(3):973-4.
SGD paper | PubMed | Full-Text
Cherry JM, et al. (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73.
SGD paper | PubMed | Full-Text