Difference between revisions of "Chromosome XIV History"

From SGD-Wiki
Jump to: navigation, search
(→‎Sequence Changes)
 
(9 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
This page lists all sequence and annotation changes that have been made to the Chromosome XIV systematic reference sequence since its intial release on 1996-07-31. <br>
 
This page lists all sequence and annotation changes that have been made to the Chromosome XIV systematic reference sequence since its intial release on 1996-07-31. <br>
 
*The sequence of Chromosome XIV has been updated '''43''' times, affecting '''41''' features. <br>
 
*The sequence of Chromosome XIV has been updated '''43''' times, affecting '''41''' features. <br>
−
*The annotation of Chromosome XIV has been updated '''33''' times, affecting '''59''' features. <br>
+
*The annotation of Chromosome XIV has been updated '''34''' times, affecting '''60''' features. <br>
 
*Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site].
 
*Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site].
  
Line 635: Line 635:
 
{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
 
{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
 
! Date  !! Affected Features
 
! Date  !! Affected Features
 +
|-
 +
|2021-04-21
 +
|[https://www.yeastgenome.org/locus/S000005204 LTO1/YNL260C]<br>
 +
Move start to Met37
 +
*old coordinates: 156859..157455 Crick
 +
*new coordinates: 156859..157347 Crick
 +
:[https://www.yeastgenome.org/reference/S000180918 Paul et al 2015] PMID:26182403
 +
|-
 +
| 2014-11-19
 +
| [https://www.yeastgenome.org/locus/ARS1411 ARS1411], [https://www.yeastgenome.org/locus/ARS1412 ARS1412], [https://www.yeastgenome.org/locus/ARS1414 ARS1414], [https://www.yeastgenome.org/locus/ARS1419 ARS1419], [https://www.yeastgenome.org/locus/ARS1420 ARS1420], [https://www.yeastgenome.org/locus/ARS1421 ARS1421], [https://www.yeastgenome.org/locus/ARS1424 ARS1424] <br>
 +
The chromosomal coordinates of the following ARS elements on Chromosome XIV were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1411, ARS1412, ARS1414, ARS1419, ARS1420, ARS1421, ARS1424. <br> <br>
 +
'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
 +
[https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text]
 +
|-
 +
| 2014-11-19
 +
| [https://www.yeastgenome.org/locus/ARS1405 ARS1405], [https://www.yeastgenome.org/locus/ARS1406 ARS1406], [https://www.yeastgenome.org/locus/ARS1407 ARS1407], [https://www.yeastgenome.org/locus/ARS1411 ARS1411], [https://www.yeastgenome.org/locus/ARS1414 ARS1414], [https://www.yeastgenome.org/locus/ARS1415 ARS1415], [https://www.yeastgenome.org/locus/ARS1419 ARS1419], [https://www.yeastgenome.org/locus/ARS1420 ARS1420], [https://www.yeastgenome.org/locus/ARS1421 ARS1421], [https://www.yeastgenome.org/locus/ARS1422 ARS1422], [https://www.yeastgenome.org/locus/ARS1424 ARS1424], [https://www.yeastgenome.org/locus/ARS1426 ARS1426], [https://www.yeastgenome.org/locus/ARS1427 ARS1427] <br>
 +
As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome XIV based on Liachko et al. 2013: ARS1405, ARS1406, ARS1407, ARS1411, ARS1414, ARS1415, ARS1419, ARS1420, ARS1421, ARS1422, ARS1424, ARS1426, ARS1427. <br> <br>
 +
'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
 +
[https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text]
 +
|-
 +
| 2013-02-15
 +
| [https://www.yeastgenome.org/locus/YNL054W-B YNL054W-B]
 +
YNL054W-B was changed from pseudogene to transposable_element_gene. It had been erroneously annotated as a pseudogene based on Kim et al. 1998 which stated that a single nucleotide insertion "would likely render [it] nonfunctional". Lawler et al. 2001 later showed that the insertion was a +1 translational frameshift.<br><br>
 +
'''Kim JM, et al.''' (1998) Transposable elements and genome organization: a comprehensive survey of retrotransposons revealed by the complete Saccharomyces cerevisiae genome sequence. Genome Res 8(5):464-78. <br>
 +
[https://www.yeastgenome.org/reference/S000072465 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9582191 PubMed] | [https://genome.cshlp.org/content/8/5/464.long Full-Text]<br>
 +
'''Lawler JF Jr, et al.''' (2001) Frameshift signal transplantation and the unambiguous analysis of mutations in the yeast retrotransposon Ty1 Gag-Pol overlap region. J Virol 75(15):6769-75. <br>
 +
[https://www.yeastgenome.org/reference/S000115694 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11435555 PubMed] | [https://jvi.asm.org/content/75/15/6769.long Full-Text] <br>
 +
|-
 +
| 2009-05-06
 +
| [https://www.yeastgenome.org/locus/ARS1409 ARS1409], [https://www.yeastgenome.org/locus/ARS1410 ARS1410], [https://www.yeastgenome.org/locus/ARS1416 ARS1416], [https://www.yeastgenome.org/locus/ARS1423 ARS1423], [https://www.yeastgenome.org/locus/ARS1425 ARS1425] <br>
 +
The following ARS elements on Chromosome XIV were added to the genome annotation based on Raveendranathan et al. 2006: ARS1409, ARS1410, ARS1416, ARS1423, and ARS1425. <br> <br>
 +
'''Raveendranathan M, et al.''' (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39. <br>
 +
[https://www.yeastgenome.org/reference/S000117571 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16888628 PubMed] | [https://www.embopress.org/cgi/doi/10.1038/sj.emboj.7601251 Full-Text]<br>
 +
|-
 +
| 2007-09-06
 +
| [https://www.yeastgenome.org/locus/YNL147W YNL147W]
 +
The 3' end of the intron within LSM7/YNL147W was moved 24 nt upstream, from chromosomal coordinate 351079 to 351055, based on Miura et al. 2006.<br><br>
 +
'''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br>
 +
[https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br>
 +
|-
 +
| 2007-07-09
 +
| [https://www.yeastgenome.org/locus/YNL004W YNL004W]
 +
The start of ORF HRB1/YNL004W was moved 417 nt upstream and an intron was added at relative coordinates 31..372 based on GenBank EF123128, Juneau et al. 2007, and Zhang et al. 2007. The ORF had been annotated as 1290 nt long, but is now 1707 nt in length.<br><br>
 +
'''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7.
 +
<br>
 +
[https://www.yeastgenome.org/reference/S000120506 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17244705 PubMed] | [https://www.pnas.org/content/104/5/1522.long Full-Text] <br>
 +
'''Zhang Z, et al.''' (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9. <br>
 +
[https://www.yeastgenome.org/reference/S000121920 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17351133 PubMed] | [https://genome.cshlp.org/content/17/4/503 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=17351133&db=pmid YFGdb]<br>
 +
|-
 +
| 2007-04-04
 +
| [https://www.yeastgenome.org/locus/YNL066W YNL066W]
 +
SUN4/YNL066W mRNA contains an intron in the 5' untranslated region (UTR).<br><br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
'''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br>
 +
[https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br>
 +
'''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7.
 +
<br>
 +
[https://www.yeastgenome.org/reference/S000120506 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17244705 PubMed] | [https://www.pnas.org/content/104/5/1522.long Full-Text] <br>
 +
|-
 +
| 2006-09-07
 +
| [https://www.yeastgenome.org/locus/ARS1405 ARS1405], [https://www.yeastgenome.org/locus/ARS1406 ARS1406], [https://www.yeastgenome.org/locus/ARS1407 ARS1407], [https://www.yeastgenome.org/locus/ARS1415 ARS1415], [https://www.yeastgenome.org/locus/ARS1417 ARS1417], [https://www.yeastgenome.org/locus/ARS1419 ARS1419], [https://www.yeastgenome.org/locus/ARS1420 ARS1420], [https://www.yeastgenome.org/locus/ARS1421 ARS1421], [https://www.yeastgenome.org/locus/ARS1422 ARS1422], [https://www.yeastgenome.org/locus/ARS1424 ARS1424], [https://www.yeastgenome.org/locus/ARS1426 ARS1426], [https://www.yeastgenome.org/locus/ARS1427 ARS1427] <br>
 +
The following new ARS elements on Chromosome XIV were added to SGD based on Nieduszynski et al. 2006: ARS1405, ARS1406, ARS1407, ARS1415, ARS1417, ARS1419, ARS1420, ARS1421, ARS1422, ARS1424, ARS1426, ARS1427. <br> <br>
 +
'''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br>
 +
[https://www.yeastgenome.org/reference/S000117321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] | [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br>
 +
|-
 +
| 2006-09-07
 +
| [https://www.yeastgenome.org/locus/ARS1411 ARS1411], [https://www.yeastgenome.org/locus/ARS1412 ARS1412], [https://www.yeastgenome.org/locus/ARS1414 ARS1414] <br>
 +
The coordinates of the following ARS elements on Chromosome XIV were updated based on Nieduszynski et al. 2006: ARS1411, ARS1412, ARS1414. <br> <br>
 +
'''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br>
 +
[https://www.yeastgenome.org/reference/S000117321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] | [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br>
 +
|-
 +
| 2006-05-10
 +
| [https://www.yeastgenome.org/locus/YNL310C YNL310C]
 +
The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for ZIM17/YNL310C be moved 93 nt (31 amino acids) downstream. <br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2006-05-10
 +
| [https://www.yeastgenome.org/locus/YNL202W YNL202W]
 +
The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for SPS19/YNL202W was moved 9 nt (3 amino acids) downstream. <br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2004-10-18
 +
| [https://www.yeastgenome.org/locus/ARS1411 ARS1411], [https://www.yeastgenome.org/locus/ARS1412 ARS1412], [https://www.yeastgenome.org/locus/ARS1413 ARS1413], [https://www.yeastgenome.org/locus/ARS1414 ARS1414] <br>
 +
ARS1411, ARS1412, ARS1413, and ARS1414 were added to SGD based on Friedman et al., and Raghuraman et al. <br> <br>
 +
'''Friedman KL, et al.''' (1996) Multiple determinants controlling activation of yeast replication origins late in S phase. Genes Dev 10(13):1595-607. <br>
 +
[https://www.yeastgenome.org/reference/S000064277 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/8682291 PubMed] | [http://genesdev.cshlp.org/content/10/13/1595.long Full-Text] <br>
 +
'''Raghuraman MK, et al.''' (2001) Replication dynamics of the yeast genome. Science 294(5540):115-21. <br>
 +
[https://www.yeastgenome.org/reference/S000113866 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11588253 PubMed] | [https://science.sciencemag.org/content/294/5540/115.long Full-Text] <br>
 +
|-
 +
| 2004-10-12
 +
| [https://www.yeastgenome.org/locus/CEN14 CEN14]
 +
The coordinates of this centromere were updated to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. 2001, and Espelin et al. 2003.<br><br>
 +
'''Wieland G, et al.''' (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60. <br>
 +
[https://www.yeastgenome.org/reference/S000059647 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11222754 PubMed] | [https://academic.oup.com/nar/article/29/5/1054/2381189 Full-Text]<br>
 +
'''Espelin CW, et al.''' (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68. <br>
 +
[https://www.yeastgenome.org/reference/S000074756 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/13679521 PubMed] | [https://www.molbiolcell.org/doi/full/10.1091/mbc.e02-08-0533?url_ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed Full-Text]<br>
 +
|-
 +
| 2004-04-21
 +
| [https://www.yeastgenome.org/locus/YNL082W YNL082W]
 +
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PMS1/YNL082W be moved 93 nt downstream. This suggestion was reviewed by SGD curators and incorporated. Evidence supporting this change includes: 1) This is the predicted start methionine in S. bayanus, S. paradoxus and S. mikatae; 2) The proposed start methionine is conserved in the S. kluyveri, S. castellii, and S. kudriavzevii sequences published by Cliften et al. 3) DNA sequence conservation begins abruptly at this ATG.<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2004-02-04
 +
| [https://www.yeastgenome.org/locus/snR19 snR19]
 +
Start moved 100 bp downstream from 230771 to 230671. See GenBank M17205, Z71497, and Z71498.<br><br>
 +
|-
 +
| 2004-02-03
 +
| [https://www.yeastgenome.org/locus/YNL130C YNL130C]
 +
Start moved 328 bp downstream based on sequence conservation in other Saccharomyces species. In addition, the 5' splice site for the existing intron moved 349 bp downstream. There is no change to Exon 2.<br><br>
 +
'''Hjelmstad RH and Bell RM''' (1990) The sn-1,2-diacylglycerol cholinephosphotransferase of Saccharomyces cerevisiae. Nucleotide sequence, transcriptional mapping, and gene product analysis of the CPT1 gene. J Biol Chem 265(3):1755-64. <br>
 +
[https://www.yeastgenome.org/reference/S000039137 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/2153142 PubMed] | [http://www.jbc.org/content/265/3/1755.long Full-Text] <br>
 +
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
 +
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
 +
|-
 +
| 2003-09-27
 +
| [https://www.yeastgenome.org/locus/YNL038W YNL038W]
 +
Based on the alignment of orthologs in related Saccharomyces species, Cliften et al. proposed an intron and new 3' exon for GPI15/YNL038W. The resulting ORF is 17 residues longer and has an altered C-terminus. This change was reviewed and accepted by SGD curators.<br><br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2003-09-22
 +
| [https://www.yeastgenome.org/locus/YNL223W YNL223W]
 +
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for ATG4/YNL223W be moved 36 nt (12 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The first ATG is not conserved in S. paradoxus, S. mikatae, and S. bayanus; 4) In an independent Genbank record also uses the second ATG for the protein translation (Version AAA86498.1 GI:1173491).<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2003-09-22
 +
| [https://www.yeastgenome.org/locus/YNL309W YNL309W]
 +
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for STB1/YNL309W be moved 117 nt (39 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2003-09-22
 +
| [https://www.yeastgenome.org/locus/YNL256W YNL256W]
 +
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for FOL1/YNL256W be moved 120 nt (40 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The first ATG is not conserved in the other Saccharomyces species; 4) Protein sequence comparisons against the nr dataset show there is no sequence similarity between S. cerevisiae and other species between the first and the second ATG; sequence similarity begins after the second methionine.<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2003-09-22
 +
| [https://www.yeastgenome.org/locus/YNL316C YNL316C]
 +
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PHA2/YNL316C be moved 102 nt (34 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2003-09-09
 +
| [https://www.yeastgenome.org/locus/TEL14L TEL14L], [https://www.yeastgenome.org/locus/TEL14R TEL14R]
 +
The chromosomal locations for TEL14L, TEL14L-TR, TEL14L-XC, TEL14L-XR, TEL14L-YP, TEL14R, TEL14R-TR, TEL14R-XC, and TEL14R-XR were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).<br><br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YNL130C-A YNL130C-A]
 +
Thanks to Kessler et al. for providing the coordinates of YNL130C-A.<br><br>
 +
'''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br>
 +
[https://www.yeastgenome.org/reference/S000073671 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] | [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YNL138W-A YNL138W-A]
 +
Thanks to Brachat et al. and Cliften et al.for providing the coordinates of YNL138W-A.<br><br>
 +
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
 +
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YNL024C-A YNL024C-A], [https://www.yeastgenome.org/locus/YNL097C-B YNL097C-B], [https://www.yeastgenome.org/locus/YNL097W-A YNL097W-A], [https://www.yeastgenome.org/locus/YNL103W-A YNL103W-A], [https://www.yeastgenome.org/locus/YNL144W-A YNL144W-A], [https://www.yeastgenome.org/locus/YNL339W-A YNL339W-A], [https://www.yeastgenome.org/locus/YNL339W-B YNL339W-B], [https://www.yeastgenome.org/locus/YNR003W-A YNR003W-A], [https://www.yeastgenome.org/locus/YNR075C-A YNR075C-A]
 +
Thanks to Kumar et al. for providing the coordinates of the following Chromosome XIV ORFs: YNL097C-B, YNL103W-A, YNL339W-A, YNR003W-A, YNR075C-A, YNL339W-B, YNL144W-A, YNL097W-A, and YNL024C-A.<br><br>
 +
'''Kumar A, et al.''' (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63. <br>
 +
[https://www.yeastgenome.org/reference/S000073673 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11753363 PubMed] | [https://www.nature.com/articles/nbt0102-58 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11753363&db=pmid YFGdb] | [https://www.yeastgenome.org/reference/S000141796 Comments & Errata] <br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YNL067W-B YNL067W-B]
 +
Thanks to [https://bioinformatik.wzw.tum.de/index.php?id=63 MIPS] for providing the coordinates of YNL067W-B.<br><br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YNL042W-B YNL042W-B], [https://www.yeastgenome.org/locus/YNL146C-A YNL146C-A], [https://www.yeastgenome.org/locus/YNL277W-A YNL277W-A]
 +
Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XIV ORFs: YNL042W-B, YNL146C-A, and YNL277W-A. <br><br>
 +
'''Basrai MA, et al.''' (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9. <br>
 +
[https://www.yeastgenome.org/reference/S000042214 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10490641 PubMed] | [https://mcb.asm.org/content/19/10/7041.long Full-Text] <br>
 +
'''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br>
 +
[https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br>
 +
'''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br>
 +
[https://www.yeastgenome.org/reference/S000073672 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] | [https://genome.cshlp.org/content/12/8/1210.long Full-Text] | [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br>
 +
|-
 +
| 2003-02-03
 +
| [https://www.yeastgenome.org/locus/snR191 snR191]
 +
Previously unmapped small nucleolar RNA feature snR191 was added.<br><br>
 +
|-
 +
| 2003-01-07
 +
| [https://www.yeastgenome.org/locus/YNL239W YNL239W]
 +
Gal6p purified from yeast indicates that native Gal6p is translated from the second translation start codon (454 aa and not 483 aa). Therefore, the start site of LAP3/GAL6/YNL239W has been moved 87 nt downstream from 200481 to 200568.<br><br>
 +
'''Zheng W, et al.''' (1997) The cysteine-peptidase bleomycin hydrolase is a member of the galactose regulon in yeast. J Biol Chem 272(48):30350-5. <br>
 +
[https://www.yeastgenome.org/reference/S000063844 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9374524 PubMed] | [http://www.jbc.org/content/272/48/30350.long Full-Text] <br>
 +
|-
 +
| 2000-12-01
 +
| [https://www.yeastgenome.org/locus/YNL162W YNL162W]
 +
The boundary between the intron and the downstream exon of YNL162W was moved 30 base pairs downstream, so that the relative coding coordinates change from 1-4..487-833 to 1-4..517-833.<br><br>
 +
|-
 +
| 2000-07-14
 +
| [https://www.yeastgenome.org/locus/YNL012W YNL012W]
 +
The start site of YNL012W was moved 369 base pairs upstream and at the same time an intron was added at new relative coordinates 106-189.<br><br>
 +
'''Davis CA, et al.''' (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6. <br>
 +
[https://www.yeastgenome.org/reference/S000042737 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10734188 PubMed] | [https://academic.oup.com/nar/article/28/8/1700/1009222 Full-Text] <br>
 +
|-
 +
| 1999-11-17
 +
| [https://www.yeastgenome.org/locus/YNL044W YNL044W]
 +
The start site of YNL044W was moved 133 base pairs upstream and at the same time an intron was added at new relative coordinates 25-103.<br><br>
 +
|-
 +
| 1998-05-21
 +
| [https://www.yeastgenome.org/locus/YNR032C-A YNR032C-A]
 +
The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. <br><br>
 +
The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.<br><br>
 +
'''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br>
 +
[https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br>
 +
 +
|}

Latest revision as of 14:10, 21 April 2022

This page lists all sequence and annotation changes that have been made to the Chromosome XIV systematic reference sequence since its intial release on 1996-07-31.

  • The sequence of Chromosome XIV has been updated 43 times, affecting 41 features.
  • The annotation of Chromosome XIV has been updated 34 times, affecting 60 features.
  • Current and past versions can be obtained from SGD's Download site.


Sequence Changes

Date Affected Features Start Coordinate of Change End Coordinate of Change Type of Change Old Sequence New Sequence
2011-02-03 YNL008C 618198 618198 Deletion G
A single C nucleotide was deleted within ORF YNL008C, altering its coding sequence. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 7 amino acids longer. 
New    618178  AAAAGCTAAATACATCTC-TGTTATGGAGCAATTGCTTAACATGTTGCAATATATTTGTA  618236
               |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old    618180  AAAAGCTAAATACATCTCGTGTTATGGAGCAATTGCTTAACATGTTGCAATATATTTGTA  618239

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL243W 189081 189081 Substitution CG GC
Nucleotide change(s) in the coding region of SLA2/YNL243W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 344 is now Alanine rather than Arginine. 
New    189059  ATCCCCACTGCCACTGGTGCAGCTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAG  189118
               |||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||
Old    189060  ATCCCCACTGCCACTGGTGCACGTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAG  189119

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL175C 307728 307728 Substitution T G
Nucleotide change(s) in the coding region of NOP13/YNL175C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 296 is now Alanine rather than Glutamic Acid. 
New    307678  ATTCGCAATGGCCTTCCGGCAATTTTTCTACAACTTTTATCCTTTAATGCATTAGTAGAT  307737
               |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    307680  ATTCGCAATGGCCTTCCGGCAATTTTTCTACAACTTTTATCCTTTAATTCATTAGTAGAT  307739

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL176C 306231 306231 Substitution C A
Nucleotide change(s) in the coding region of YNL176C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 251 is now Phenylalanine rather than Cysteine. 
New    306178  GAAAGCGATGAACTGTAAAACGATGTGGAAGTATTCCGACTGGAACTTGGGAATGTGGTA  306237
               ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Old    306180  GAAAGCGATGAACTGTAAAACGATGTGGAAGTATTCCGACTGGAACTTGGGCATGTGGTA  306239

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL271C 132573 132573 Substitution T C
Nucleotide change(s) in the coding region of BNI1/YNL271C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 938 is now Alanine rather than Threonine. 
New    132539  TGGAAATATCATTACTTTCCATTTGGATTTCAGCCAAAGCCCGCCTTAGGTCATTTAGTT  132598
               ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old    132540  TGGAAATATCATTACTTTCCATTTGGATTTCAGTCAAAGCCCGCCTTAGGTCATTTAGTT  132599

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL177C 304165 304165 Substitution G T
Nucleotide change(s) in the coding region of MRPL22/YNL177C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 151 is now Leucine rather than Phenylalanine. 
New    304138  CTAGTACTTCAATTTCTCTTTTTGTTAACTTTAGCTTGTAACGTTCGCTAGAATTTGGTA  304197
               ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Old    304140  CTAGTACTTCAATTTCTCTTTTTGTGAACTTTAGCTTGTAACGTTCGCTAGAATTTGGTA  304199

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL193W 274732 274732 Substitution G C
Nucleotide change(s) in the coding region of YNL193W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 122 is now Leucine rather than Valine. 
New    274679  GCAATACGTGAAAATGGATGATATGCCTGATCTTTCCAATTTGGTGTTATCTCTGCCACA  274738
               |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Old    274680  GCAATACGTGAAAATGGATGATATGCCTGATCTTTCCAATTTGGTGTTATCTGTGCCACA  274739

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL172W 315278 315278 Substitution T G
Nucleotide change(s) in the coding region of APC1/YNL172W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1547 is now Methionine rather than Isoleucine. 
New    315238  CCACATCCCTTACAAGAATTGAAGCATTTCTGGAGCATGGCTGTAGAGCCTCGTTGCCTT  315297
               |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Old    315240  CCACATCCCTTACAAGAATTGAAGCATTTCTGGAGCATTGCTGTAGAGCCTCGTTGCCTT  315299

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL327W 25775 25775 Substitution G A
Nucleotide change(s) in the coding region of EGT2/YNL327W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 577 is now Threonine rather than Alanine. 
New    25741   CCAGTTTATCATCCGGCCCATTTGTTTCAAACACAACGGTTGCCTCTGGGTCTTATATTC  25800
               ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Old    25740   CCAGTTTATCATCCGGCCCATTTGTTTCAAACACAGCGGTTGCCTCTGGGTCTTATATTC  25799

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL192W 278945 278945 Substitution T G
Nucleotide change(s) in the coding region of CHS1/YNL192W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 815 is now Valine rather than Phenylalanine. 
New    278939  TCCTAGTCTTTAGAATTCTCACTGTTTCTATTGCACTGGCATACCATTCAGCATTTAATG  278998
               ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    278940  TCCTATTCTTTAGAATTCTCACTGTTTCTATTGCACTGGCATACCATTCAGCATTTAATG  278999

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL186W 290429 290429 Substitution T G
Nucleotide change(s) in the coding region of UBP10/YNL186W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 310 is now Glutamic Acid rather than Aspartic Acid. 
New    290398  GGAGAGGAGGAGGAAGAAGAGGAAGAAGAGCTGAAACATAAATCTAGGTCAATCACCCCT  290457
               ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Old    290400  GGAGAGGAGGAGGAAGAAGAGGAAGAAGATCTGAAACATAAATCTAGGTCAATCACCCCT  290459

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL181W 299120 299120 Substitution C G
Nucleotide change(s) in the coding region of YNL181W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 262 is now Alanine rather than Proline. 
New    299098  AAAACCAAAAGACGAATGGCGCTGAAAGAACAGGAAAAAATGTTACCATTACTATGGTTC  299157
               |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Old    299100  AAAACCAAAAGACGAATGGCCCTGAAAGAACAGGAAAAAATGTTACCATTACTATGGTTC  299159

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL271C, YNL272C 129279 129279 Deletion A
A single nucleotide deletion was made in the intergenic region between ORFs SEC2/YNL272C and BNI1/YNL271C. 
New    129240  TAAACGAGAGCCATGTTTTAAAGGTGCTTCAGCGAACGC-GAAATACAAGTTCCGGGTAG  129298
               ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old    129240  TAAACGAGAGCCATGTTTTAAAGGTGCTTCAGCGAACGCAGAAATACAAGTTCCGGGTAG  129299

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNR055C, YNR056C 731363 731363 Insertion C
A single nucleotide insertion was made in the intergenic region between ORFs HOL1/YNR055C and BIO5/YNR056C. 
New    731337  GTAAAATGGCTTTATGTGTTCTGATCTTATAATGAATCGTAATCGAAATCCACATATTTC  731396
               ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Old    731339  GTAAAATGGCTTTATGTGTTCTGAT-TTATAATGAATCGTAATCGAAATCCACATATTTC  731397

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNR053C 721794 721794 Insertion A
A single nucleotide insertion was made within the intron of ORF NOG2/YNR053C. 
New    721737  GACGTTCCTTTGACAAATGTTTGACCCAAGCTGCCTACTTGTAAAGTTAGAATTGAAAAAAAAAAACCTT  721806
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    721740  GACGTTCCTTTGACAAATGTTTGACCCAAGCTGCCTACTTGTAAAGTTAGAATTG-AAAAAAAAAACCTT  721808

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNR070W 766524 766524 Substitution C T
A single nucleotide substitution was made within ORF PDR18/YNR070W. Note that the protein sequence was not changed. 
New    766497  ATTAGACTTTGCACTATTAGAGGTTTTCTAAGGATTTACGGTGATAAGTCATACACCGTT  766556
               |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Old    766498  ATTAGACTTTGCACTATTAGAGGTTTCCTAAGGATTTACGGTGATAAGTCATACACCGTT  766557

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL128W 383566 383566 Substitution A G
A single nucleotide substitution was made within ORF TEP1/YNL128W. Note that the protein sequence was not changed. 
New    383518  CAGATTACTTTCAAGTAGAGAGGTTAAAGAGAGACGAAATGCTTGGGACAACCATAAGCT  383577
               |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    383520  CAGATTACTTTCAAGTAGAGAGGTTAAAGAGAGACGAAATGCTTGGAACAACCATAAGCT  383579

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL133C, tF(GAA)N 374744 374744 Substitution T C
374768 374768 Substitution A C
374810 374810 Substitution A C
Three separate single nucleotide substitutions were made in the intergenic region between ORF FYV6/YNL133C and tRNA tF(GAA)N. 
New    374698  TATAACAGAGCCCACAGTCTTTTGTTGGAACCGCTTTCTCTAGGCTTCGATGGACTTACA  374757
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    374700  TATAACAGAGCCCACAGTCTTTTGTTGGAACCGCTTTCTCTAGGTTTCGATGGACTTACA  374759
New    374758  TCTAATTGCACATTCTCGTGCGTTTAAACGTCATTTTTCCCTCAGATTGGCAGTGCATCA  374817
               |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Old    374760  TCTAATTGAACATTCTCGTGCGTTTAAACGTCATTTTTCCCTCAGATTGGAAGTGCATCA  374819

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL141W, YNL142W 359024 359024 Substitution C T
A single nucleotide substitution was made in the intergenic region between ORFs MEP2/YNL142W and AAH1/YNL141W. 
New    358978  TTATGTTTAATCTTTATGTAACGCTTCATTTAATAATTTTATTTTTAATATTTGATATAT  359037
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    358980  TTATGTTTAATCTTTATGTAACGCTTCATTTAATAATTTTATTTCTAATATTTGATATAT  359039

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL173C, YNL175C 308753 308753 Substitution G C
A single nucleotide substitution was made in the intergenic region between NOP13/YNL175C and MDG1/YNL173C. 
New    308698  CATCTATGCTCATCGCAATTTTTTCTTTCAGACTGAAAAATTTCAGGTTTTTGCATTTCA  308757
               ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Old    308700  CATCTATGCTCATCGCAATTTTTTCTTTCAGACTGAAAAATTTCAGGTTTTTGGATTTCA  308759

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL327W, YNL328C 23471 23471 Insertion C
A single nucleotide insertion was made in the intergenic region between ORFs MDJ2/YNL328C and EGT2/YNL327W. 
New    23461   GGCAGTAATGCCATAACGAAGATCAATAGTGTATGGGATGTTGGATATGTCGTTTCCCTG  23520
               ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old    23461   GGCAGTAATGC-ATAACGAAGATCAATAGTGTATGGGATGTTGGATATGTCGTTTCCCTG  23519

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL307C, YNL308C 56227 56227 Deletion A
A single nucleotide deletion was made in the intergenic region between ORFs KRI1/YNL308C and MCK1/YNL307C. 
New    56221   AAAAAAA-TTAGGAACATAAAATAAAAAATAAAGAAGAAATTGAAGGAGTGACTGGATAA  56279
               ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    56220   AAAAAAAATTAGGAACATAAAATAAAAAATAAAGAAGAAATTGAAGGAGTGACTGGATAA  56279

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL187W, YNL188W 287983 287983 Deletion A
A single nucleotide deletion was made in the intergenic region between ORFs KAR1/YNL188W and SWT21/YNL187W. 
New    287939  CGAGTATCCACGACTAGGAGAATCACCATATATCAATATGACA-GACGACTTCAGAATGG  287997
               ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old    287940  CGAGTATCCACGACTAGGAGAATCACCATATATCAATATGACAAGACGACTTCAGAATGG  287999

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YNL192W, YNL193W 276356 276356 Substitution A G
A single nucleotide substitution was made in the intergenic region between ORFs YNL193W and CHS1/YNL192W. 
New    276299  ATTGATTTTAATATATATCTCGGGTTCATTTTTTACGTCGGTACTCCAAAGGATCAGAACACTTACATTT  276368
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    276300  ATTGATTTTAATATATATCTCGGGTTCATTTTTTACGTCGGTACTCCAAAGGATCAAAACACTTACATTT  276369

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2010-01-05 YNL083W 472581 472581 Substitution T G
472585 472585 Substitution C GG
SAL1 contains a frameshift mutation (the sal1-1 allele) in certain laboratory strains, including S288C. The sal1-1 frameshift mutation results in the encoding of missense amino acids starting with the 403rd codon, and truncates the protein to 494 amino acids from its "wild-type" length in other strains of 545 amino acids. The annotation of SAL1 was altered in SGD in February 2004 away from the sal1-1 allele after sequence comparisons to related fungi (Belenkiy et al. 2000; Brachat et al. 2003). Dimitrov et al. (2009) sequenced the SAL1 gene from strains BY4716 and S288C, and discovered that these strains do both indeed contain the sal1-1 allele despite the previous annotation change in SGD. The correct annotation of SAL1 has now been reinstated in SGD.

Belenkiy R, et al. (2000) The yeast mitochondrial transport proteins: new sequences and consensus residues, lack of direct relation between consensus residues and transmembrane helices, expression patterns of the transport protein genes, and protein-protein interactions with other proteins. Biochim Biophys Acta 1467(1):207-18.
SGD paper | PubMed | Full-Text
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text
Chen XJ (2004) Sal1p, a calcium-dependent carrier protein that suppresses an essential cellular function associated With the Aac2 isoform of ADP/ATP translocase in Saccharomyces cerevisiae. Genetics 167(2):607-17.
SGD paper | PubMed | Full-Text
Smith CP and Thorsness PE (2008) The Molecular Basis for Relative Physiological Functionality of the ADP/ATP Carrier Isoforms in Saccharomyces cerevisiae. Genetics 179(3):1285-99.
SGD paper | PubMed | Full-Text
Dimitrov LN, et al. (2009) Polymorphisms in multiple genes contribute to the spontaneous mitochondrial genome instability of Saccharomyces cerevisiae S288C strains. Genetics 183(1):365-83.
SGD paper | PubMed | Full-Text

2006-11-09 YNL103W 429061 429061 Substitution G C
429057 429058 Substitution CG GC
The systematic sequence is being updated within the ORF YNL103W with the following three transversions: C to G at chromosomal coordinate 429057, G to C at 429058, and G to C at 429061. These are nucleotide positions 1321, 1322, and 1325 within ORF YNL103W, changing amino acids 441 and 442 from Arg-Gly to Ala-Ala. Thanks to Phil Robinson in Roger Kornberg's lab for alerting SGD to these sequencing errors. 
New:   1311 GGCTGAAACTGCTGCGCCAACTACCTTATCAACGTCGCCTTCGTTCAATGAGCACGGTGTAGTAGCAGAG 1380
            ||||||||||  || |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old: 429047 GGCTGAAACTCGTGGGCCAACTACCTTATCAACGTCGCCTTCGTTCAATGAGCACGGTGTAGTAGCAGAG 429116
2005-11-07 YNL304W 60402 60402 Insertion C
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. and Cliften et al. suggested that the start site for YPT11/YNL304W be moved 185 nt upstream. This change required a sequencing error in the reference strain. SGD confirmed a sequencing error in this position, and the systematic sequence has been updated accordingly. As a consequence of this sequence change, YPT11/YN304W was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 355 to 417 amino acids. 
New: 60367 CACCGATACGGACTAACGAATCCAATTGGGAAGCTGCTTCGCCAGCGAGTGCTGCATCTT 60426
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old: 60367 CACCGATACGGACTAACGAATCCAATTGGGAAGCTG-TTCGCCAGCGAGTGCTGCATCTT 60425

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2005-11-03 YNL299W 68349 68349 Insertion C
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the stop site for TRF5/YNL299W be moved 50 nt downstream. The insertion of a single C nt was confirmed in S. cerevisiae strains BMA38, BY4741, LMA210 (Jon Houseley, personal communication) and S288C (SGD). The systematic sequence has been updated accordingly. As a consequence of this sequence change, TRF5/YNL299W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 625 to 642 amino acids. 
New: 68328 GATCAAAAAGGAAGAGATACCCCTTCGGGACAAGATGAGAAATCACCACTGGAAACT 68384 
           |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Old: 68328 GATCAAAAAGGAAGAGATACCC-TTCGGGACAAGATGAGAAATCACCACTGGAAACT 68383

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata

2004-07-22 YNL064C, YNL065W 505515 505515 Insertion C
The work of Kellis et al. proposed an indel that would shorten the YNL065W reading frame. Sequencing of S288C by SGD confirmed the current sequence for YNL065W, but an error in the intergenic region between YNL065W and YNL064C was identified. This insertion does not affect any coding features. 
New:        ATTAATTGGCATTCTTCAATTTGATAGACACTTATCCCTGCATATTTTTTTTATAAACAG
            ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Old: 505479 ATTAATTGGCATTCTTCAATTTGATAGACACTTATCC-TGCATATTTTTTTTATAAACAG 505537

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata

2004-02-19 YNL208W 254767 254767 Insertion G
254927 254927 Insertion G
Kellis et al. predicted and confirmed the insertion of two nucleotides. As a consequence of this sequence change, YNL208W was shortened at the 3' end, altering the C-terminus and decreasing the predicted protein from 204 to 199 amino acids. 
New:        AAGGTGGACACAACAACCATCACCGTCAGGACAATAACAACAATAACGGTGGATTTGGCG 
               ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
 Sbjct: 254739 AAGGTGGACACAACAACCATCACCGTCAG-ACAATAACAACAATAACGGTGGATTTGGCG 254797 
   New:        AAGGATTCGGTGGTCCAAATCCTCAAGAATTCGGCGGGCCAGGTGGCCAAGGATTCGGTG
               ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
 Sbjct: 254891 AAGGATTCGGTGGTCCAAATCCTCAAGAATTCGGCGG-CCAGGTGGCCAAGGATTCGGTG 254949

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata

2004-02-18 YNL083W 472580 472580 Substitution G C
471764 471764 Substitution G A
472576 472576 Substitution G T
472581 472581 Deletion G
Brachat et al. 2003 predicted the extension of the 3' end of YNL083W based on the automated comparison of related fungi. Belenkiy et al. 2000 had previously confirmed the sequence change in strain CG379. The sequence is available in GenBank (accession number AF419344). As a consequence, YNL083W was extended in the 3' end, increasing the size of the predicted protein from 494 amino acids to 545 amino acids. This C-terminal extension is also conserved in S. bayanus, S. mikatae, S. paradoxus, and S. kluyveri. 
 New:        GAACTTAATCATGAACTTTCAAATGAAAAGATGAACAAATTCTCGAGGTTTTTTGAATGG
               |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
 Sbjct: 471734 GAACTTAATCATGAACTTTCAAATGAAAAGGTGAACAAATTCTCGAGGTTTTTTGAATGG 471793 
   New:        GTGGGC-TCAGATTATTTTACAGAGGTGTCACAGTCGGTATAGTGGGCATATTTCCCTA
               | |||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
 Sbjct: 472574 GGGGGGGTCAGATTATTTTACAGAGGTGTCACAGTCGGTATAGTGGGCATATTTCCCTA 472633

Belenkiy R, et al. (2000) The yeast mitochondrial transport proteins: new sequences and consensus residues, lack of direct relation between consensus residues and transmembrane helices, expression patterns of the transport protein genes, and protein-protein interactions with other proteins. Biochim Biophys Acta 1467(1):207-18.
SGD paper | PubMed | Full-Text
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text

2004-02-18 YNL195C 271649 271649 Insertion G
Kellis et al. predicted and confirmed the insertion of a single G nt. As a consequence of this sequence change, YNL195C was extended at the 3' end, altering the C-terminus and increasing the predicted protein from 243 to 261 amino acids. 
New:        TTGTGCCGATCACCCACACCGTAGGCGTAGGTTTCCTTTTCCTCAGTTTCCTGATTGAAT
               |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
 Sbjct: 271626 TTGTGCCGATCACCCACACCGTAG-CGTAGGTTTCCTTTTCCTCAGTTTCCTGATTGAAT 271684

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata

1998-11-10 YNL180C 299726 299726 Deletion AT
An AT dinucleotide at chromosomal coordinates 299726-299727 within YNL180C was removed. This corresponds to relative coordinates 171-172, and causes a frameshift. The protein is now annotated as 331 amino acids in length. 
Old: 299701 TTGGTTTAGCTTGCTTGTTGTGATGATATTATTTGAGGCAATTTTACTACCTTTGCTTTT 299760
            |||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||
New: 299701 TTGGTTTAGCTTGCTTGTTGTGATGAT--TATTTGAGGCAATTTTACTACCTTTGCTTTT 299758
1997-07-27 YNL051W, YNL052W 532300 532300 Insertion G
A single G was inserted after the G at 532300 in the intergenic region between COX5A/YNL052W and COG5/YNL051W. 
New: 532260 ACGAAAGTGAATATCTTATTACATTATAAGTGTATCCATGGGCATCCGCCCAATACAATG 532319
            ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old: 532260 ACGAAAGTGAATATCTTATTACATTATAAGTGTATCCATGG-CATCCGCCCAATACAATG 532318
1997-07-27 YNL059C, YNL061W 512412 512412 Insertion G
A single G was inserted after the G at 512412 in the intergenic region between NOP2/YNL061W and ARP5/YNL059C. 
New: 512401 ACAAACGTAGTGGCATCATGTTAGCATAGTTTTCTCTCTCTAATCTTTCTCTGTCTACAT 512460
            |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Old: 512401 ACAAACGTAGTG-CATCATGTTAGCATAGTTTTCTCTCTCTAATCTTTCTCTGTCTACAT 512459



Annotation Changes without sequence changes

Date Affected Features
2021-04-21 LTO1/YNL260C

Move start to Met37

  • old coordinates: 156859..157455 Crick
  • new coordinates: 156859..157347 Crick
Paul et al 2015 PMID:26182403
2014-11-19 ARS1411, ARS1412, ARS1414, ARS1419, ARS1420, ARS1421, ARS1424

The chromosomal coordinates of the following ARS elements on Chromosome XIV were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1411, ARS1412, ARS1414, ARS1419, ARS1420, ARS1421, ARS1424.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704.
SGD paper | PubMed | Full-Text

2014-11-19 ARS1405, ARS1406, ARS1407, ARS1411, ARS1414, ARS1415, ARS1419, ARS1420, ARS1421, ARS1422, ARS1424, ARS1426, ARS1427

As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome XIV based on Liachko et al. 2013: ARS1405, ARS1406, ARS1407, ARS1411, ARS1414, ARS1415, ARS1419, ARS1420, ARS1421, ARS1422, ARS1424, ARS1426, ARS1427.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704.
SGD paper | PubMed | Full-Text

2013-02-15 YNL054W-B

YNL054W-B was changed from pseudogene to transposable_element_gene. It had been erroneously annotated as a pseudogene based on Kim et al. 1998 which stated that a single nucleotide insertion "would likely render [it] nonfunctional". Lawler et al. 2001 later showed that the insertion was a +1 translational frameshift.

Kim JM, et al. (1998) Transposable elements and genome organization: a comprehensive survey of retrotransposons revealed by the complete Saccharomyces cerevisiae genome sequence. Genome Res 8(5):464-78.
SGD paper | PubMed | Full-Text
Lawler JF Jr, et al. (2001) Frameshift signal transplantation and the unambiguous analysis of mutations in the yeast retrotransposon Ty1 Gag-Pol overlap region. J Virol 75(15):6769-75.
SGD paper | PubMed | Full-Text

2009-05-06 ARS1409, ARS1410, ARS1416, ARS1423, ARS1425

The following ARS elements on Chromosome XIV were added to the genome annotation based on Raveendranathan et al. 2006: ARS1409, ARS1410, ARS1416, ARS1423, and ARS1425.

Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39.
SGD paper | PubMed | Full-Text

2007-09-06 YNL147W

The 3' end of the intron within LSM7/YNL147W was moved 24 nt upstream, from chromosomal coordinate 351079 to 351055, based on Miura et al. 2006.

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51.
SGD paper | PubMed | Full-Text

2007-07-09 YNL004W

The start of ORF HRB1/YNL004W was moved 417 nt upstream and an intron was added at relative coordinates 31..372 based on GenBank EF123128, Juneau et al. 2007, and Zhang et al. 2007. The ORF had been annotated as 1290 nt long, but is now 1707 nt in length.

Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7.
SGD paper | PubMed | Full-Text
Zhang Z, et al. (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9.
SGD paper | PubMed | Full-Text | YFGdb

2007-04-04 YNL066W

SUN4/YNL066W mRNA contains an intron in the 5' untranslated region (UTR).

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement
Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51.
SGD paper | PubMed | Full-Text
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7.
SGD paper | PubMed | Full-Text

2006-09-07 ARS1405, ARS1406, ARS1407, ARS1415, ARS1417, ARS1419, ARS1420, ARS1421, ARS1422, ARS1424, ARS1426, ARS1427

The following new ARS elements on Chromosome XIV were added to SGD based on Nieduszynski et al. 2006: ARS1405, ARS1406, ARS1407, ARS1415, ARS1417, ARS1419, ARS1420, ARS1421, ARS1422, ARS1424, ARS1426, ARS1427.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9.
SGD paper | PubMed | Full-Text | Web Supplement

2006-09-07 ARS1411, ARS1412, ARS1414

The coordinates of the following ARS elements on Chromosome XIV were updated based on Nieduszynski et al. 2006: ARS1411, ARS1412, ARS1414.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9.
SGD paper | PubMed | Full-Text | Web Supplement

2006-05-10 YNL310C

The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for ZIM17/YNL310C be moved 93 nt (31 amino acids) downstream.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2006-05-10 YNL202W

The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for SPS19/YNL202W was moved 9 nt (3 amino acids) downstream.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2004-10-18 ARS1411, ARS1412, ARS1413, ARS1414

ARS1411, ARS1412, ARS1413, and ARS1414 were added to SGD based on Friedman et al., and Raghuraman et al.

Friedman KL, et al. (1996) Multiple determinants controlling activation of yeast replication origins late in S phase. Genes Dev 10(13):1595-607.
SGD paper | PubMed | Full-Text
Raghuraman MK, et al. (2001) Replication dynamics of the yeast genome. Science 294(5540):115-21.
SGD paper | PubMed | Full-Text

2004-10-12 CEN14

The coordinates of this centromere were updated to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. 2001, and Espelin et al. 2003.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60.
SGD paper | PubMed | Full-Text
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68.
SGD paper | PubMed | Full-Text

2004-04-21 YNL082W

Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PMS1/YNL082W be moved 93 nt downstream. This suggestion was reviewed by SGD curators and incorporated. Evidence supporting this change includes: 1) This is the predicted start methionine in S. bayanus, S. paradoxus and S. mikatae; 2) The proposed start methionine is conserved in the S. kluyveri, S. castellii, and S. kudriavzevii sequences published by Cliften et al. 3) DNA sequence conservation begins abruptly at this ATG.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2004-02-04 snR19

Start moved 100 bp downstream from 230771 to 230671. See GenBank M17205, Z71497, and Z71498.

2004-02-03 YNL130C

Start moved 328 bp downstream based on sequence conservation in other Saccharomyces species. In addition, the 5' splice site for the existing intron moved 349 bp downstream. There is no change to Exon 2.

Hjelmstad RH and Bell RM (1990) The sn-1,2-diacylglycerol cholinephosphotransferase of Saccharomyces cerevisiae. Nucleotide sequence, transcriptional mapping, and gene product analysis of the CPT1 gene. J Biol Chem 265(3):1755-64.
SGD paper | PubMed | Full-Text
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text

2003-09-27 YNL038W

Based on the alignment of orthologs in related Saccharomyces species, Cliften et al. proposed an intron and new 3' exon for GPI15/YNL038W. The resulting ORF is 17 residues longer and has an altered C-terminus. This change was reviewed and accepted by SGD curators.

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YNL223W

Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for ATG4/YNL223W be moved 36 nt (12 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The first ATG is not conserved in S. paradoxus, S. mikatae, and S. bayanus; 4) In an independent Genbank record also uses the second ATG for the protein translation (Version AAA86498.1 GI:1173491).

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YNL309W

Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for STB1/YNL309W be moved 117 nt (39 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YNL256W

Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for FOL1/YNL256W be moved 120 nt (40 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The first ATG is not conserved in the other Saccharomyces species; 4) Protein sequence comparisons against the nr dataset show there is no sequence similarity between S. cerevisiae and other species between the first and the second ATG; sequence similarity begins after the second methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YNL316C

Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PHA2/YNL316C be moved 102 nt (34 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-09 TEL14L, TEL14R

The chromosomal locations for TEL14L, TEL14L-TR, TEL14L-XC, TEL14L-XR, TEL14L-YP, TEL14R, TEL14R-TR, TEL14R-XC, and TEL14R-XR were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).

2003-07-29 YNL130C-A

Thanks to Kessler et al. for providing the coordinates of YNL130C-A.

Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71.
SGD paper | PubMed | Full-Text

2003-07-29 YNL138W-A

Thanks to Brachat et al. and Cliften et al.for providing the coordinates of YNL138W-A.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-07-29 YNL024C-A, YNL097C-B, YNL097W-A, YNL103W-A, YNL144W-A, YNL339W-A, YNL339W-B, YNR003W-A, YNR075C-A

Thanks to Kumar et al. for providing the coordinates of the following Chromosome XIV ORFs: YNL097C-B, YNL103W-A, YNL339W-A, YNR003W-A, YNR075C-A, YNL339W-B, YNL144W-A, YNL097W-A, and YNL024C-A.

Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63.
SGD paper | PubMed | Full-Text | YFGdb | Comments & Errata

2003-07-29 YNL067W-B

Thanks to MIPS for providing the coordinates of YNL067W-B.

2003-07-29 YNL042W-B, YNL146C-A, YNL277W-A

Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XIV ORFs: YNL042W-B, YNL146C-A, and YNL277W-A.

Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9.
SGD paper | PubMed | Full-Text
Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51.
SGD paper | PubMed | Full-Text | YFGdb
Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20.
SGD paper | PubMed | Full-Text | Web Supplement | YFGdb

2003-02-03 snR191

Previously unmapped small nucleolar RNA feature snR191 was added.

2003-01-07 YNL239W

Gal6p purified from yeast indicates that native Gal6p is translated from the second translation start codon (454 aa and not 483 aa). Therefore, the start site of LAP3/GAL6/YNL239W has been moved 87 nt downstream from 200481 to 200568.

Zheng W, et al. (1997) The cysteine-peptidase bleomycin hydrolase is a member of the galactose regulon in yeast. J Biol Chem 272(48):30350-5.
SGD paper | PubMed | Full-Text

2000-12-01 YNL162W

The boundary between the intron and the downstream exon of YNL162W was moved 30 base pairs downstream, so that the relative coding coordinates change from 1-4..487-833 to 1-4..517-833.

2000-07-14 YNL012W

The start site of YNL012W was moved 369 base pairs upstream and at the same time an intron was added at new relative coordinates 106-189.

Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6.
SGD paper | PubMed | Full-Text

1999-11-17 YNL044W

The start site of YNL044W was moved 133 base pairs upstream and at the same time an intron was added at new relative coordinates 25-103.

1998-05-21 YNR032C-A

The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A.

The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.

Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51.
SGD paper | PubMed | Full-Text | YFGdb

Retrieved from "https://wiki.yeastgenome.org/index.php?title=Chromosome_XIV_History&oldid=404197"