Difference between revisions of "Chromosome VIII History"
(→Sequence Changes) |
|||
| (10 intermediate revisions by 2 users not shown) | |||
| Line 1: | Line 1: | ||
This page lists all sequence and annotation changes that have been made to the Chromosome VIII systematic reference sequence since its intial release on 1996-07-31. <br> | This page lists all sequence and annotation changes that have been made to the Chromosome VIII systematic reference sequence since its intial release on 1996-07-31. <br> | ||
| − | *The sequence of Chromosome | + | *The sequence of Chromosome VIII has been updated '''33''' times, affecting '''40''' features. <br> |
| − | *The annotation of Chromosome | + | *The annotation of Chromosome VIII has been updated '''27''' times, affecting '''72''' features. <br> |
| − | *Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads | + | *Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site]. |
__FORCETOC__ | __FORCETOC__ | ||
| Line 497: | Line 497: | ||
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] | ||
| + | |||
| + | |- style="height:30px; width:30px; text-align:center;" | ||
| + | | 2000-01-21 | ||
| + | | [https://www.yeastgenome.org/locus/YHR132W-A YHR132W-A] | ||
| + | | 370332 | ||
| + | | 370332 | ||
| + | | Insertion | ||
| + | | | ||
| + | | C | ||
| + | |- | ||
| + | | || colspan="6" | A single C nucleotide was inserted after the C at chromosomal coordinate 370331, resulting in the creation of a new ORF YHR132W-A spanning coordinates 370055-370450. See GenBank files: YSCH9315 GenBank entry, accession U10398, U00093. Thank you to Atsuko Horiuchi for alerting SGD to this omission. | ||
| + | <pre>New: aatcctagcggtttaagagag | ||
| + | |||| |||||||||||||||| | ||
| + | Old: aatc-tagcggtttaagagag</pre> | ||
| + | |||
| + | |} | ||
| + | |||
| + | <br><br> | ||
| + | |||
| + | =Annotation Changes ''without sequence changes''= | ||
| + | {| border="1" style="border-collapse:collapse; width:90%" cellpadding="6" | ||
| + | ! Date !! Affected Features | ||
| + | |- | ||
| + | |2021-04-21 | ||
| + | |[https://www.yeastgenome.org/locus/S000303807 YHR052C-B]<br> | ||
| + | New ORF | ||
| + | *coordinates: 212519..212692 Crick | ||
| + | :[https://www.yeastgenome.org/reference/S000217202 He et al 2018] PMID:29897761 | ||
| + | |- | ||
| + | |2021-04-21 | ||
| + | |[https://www.yeastgenome.org/locus/S000303808 YHR054C-B]<br> | ||
| + | New ORF | ||
| + | *coordinates: 214517..214690 Crick | ||
| + | :[https://www.yeastgenome.org/reference/S000217202 He et al 2018] PMID:29897761 | ||
| + | |- | ||
| + | |2021-04-21 | ||
| + | |[https://www.yeastgenome.org/locus/S000303809 SUT169/YNCH0011W]<br> | ||
| + | New ncRNA | ||
| + | *coordinates 378254..379237 | ||
| + | :[https://www.yeastgenome.org/reference/S000129105 Xu et al 2009] PMID:19169243, | ||
| + | :[https://www.yeastgenome.org/reference/S000148029 Geisler et al 2012] PMID:22226051, | ||
| + | :[https://www.yeastgenome.org/reference/S000183986 Huber et al 2016] PMID:27292640, | ||
| + | :[https://www.yeastgenome.org/reference/S000206477 Bunina et al 2017] PMID:28977638 | ||
| + | |- | ||
| + | | 2014-11-19 | ||
| + | | [https://www.yeastgenome.org/locus/ARS802 ARS802], [https://www.yeastgenome.org/locus/ARS805 ARS805], [https://www.yeastgenome.org/locus/ARS807 ARS807], [https://www.yeastgenome.org/locus/ARS813 ARS813], [https://www.yeastgenome.org/locus/ARS818 ARS818], [https://www.yeastgenome.org/locus/ARS820 ARS820]<br> | ||
| + | As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome VIII based on Liachko et al. 2013: ARS802, ARS805, ARS807, ARS813, ARS818, ARS820.<br> <br> | ||
| + | '''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text] | ||
| + | |- | ||
| + | | 2014-11-19 | ||
| + | | [https://www.yeastgenome.org/locus/ARS802 ARS802], [https://www.yeastgenome.org/locus/ARS805 ARS805], [https://www.yeastgenome.org/locus/ARS807 ARS807], [https://www.yeastgenome.org/locus/ARS809 ARS809], [https://www.yeastgenome.org/locus/ARS813 ARS813], [https://www.yeastgenome.org/locus/ARS815 ARS815], [https://www.yeastgenome.org/locus/ARS818 ARS818], [https://www.yeastgenome.org/locus/ARS820 ARS820]<br> | ||
| + | The chromosomal coordinates of the following ARS elements on Chromosome VIII were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS802, ARS805, ARS807, ARS809, ARS813, ARS815, ARS818, ARS820.<br> <br> | ||
| + | '''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text] | ||
| + | |- | ||
| + | | 2009-05-06 | ||
| + | | [https://www.yeastgenome.org/locus/ARS801 ARS801], [https://www.yeastgenome.org/locus/ARS806 ARS806], [https://www.yeastgenome.org/locus/ARS810 ARS810], [https://www.yeastgenome.org/locus/ARS811 ARS811], [https://www.yeastgenome.org/locus/ARS814 ARS814], [https://www.yeastgenome.org/locus/ARS815 ARS815] <br> | ||
| + | The following ARS elements on Chromosome 8 were added to the genome annotation based on Raveendranathan et al. 2006: ARS801, ARS806, ARS810, ARS811, ARS814, and ARS815.<br> <br> | ||
| + | '''Raveendranathan M, et al.''' (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000117571 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16888628 PubMed] | [https://www.embopress.org/cgi/doi/10.1038/sj.emboj.7601251 Full-Text] | ||
| + | |- | ||
| + | | 2007-07-09 | ||
| + | | [https://www.yeastgenome.org/locus/YHR076W YHR076W] <br> | ||
| + | An intron was annotated within PTC7/YHR076W at relative coordinates 56..148 based on GenBank EF123135, Juneau et al. 2007, and Zhang et al. 2007. According to Juneau et al. 2007, the intron is "inefficiently spliced" (splicing rate = 55%). Note that the currently annotated start and stop remain the same.<br> <br> | ||
| + | '''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7. | ||
| + | <br> | ||
| + | [https://www.yeastgenome.org/reference/S000120506 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17244705 PubMed] | [https://www.pnas.org/content/104/5/1522.long Full-Text] <br> | ||
| + | '''Zhang Z, et al.''' (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000121920 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17351133 PubMed] | [https://genome.cshlp.org/content/17/4/503 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=17351133&db=pmid YFGdb] | ||
| + | |- | ||
| + | | 2006-09-07 | ||
| + | | [https://www.yeastgenome.org/locus/ARS802 ARS802], [https://www.yeastgenome.org/locus/ARS807 ARS807], [https://www.yeastgenome.org/locus/ARS809 ARS809], [https://www.yeastgenome.org/locus/ARS813 ARS813], [https://www.yeastgenome.org/locus/ARS818 ARS818], [https://www.yeastgenome.org/locus/ARS820 ARS820], [https://www.yeastgenome.org/locus/ARS822 ARS822], [https://www.yeastgenome.org/locus/ARS824 ARS824]<br> | ||
| + | The following new ARS elements on Chromosome VIII were added to SGD based on Nieduszynski et al. 2006: ARS802, ARS807, ARS809, ARS813, ARS818, ARS820, ARS822, ARS824.<br> <br> | ||
| + | '''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000117321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] | [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br> | ||
| + | |- | ||
| + | | 2006-09-07 | ||
| + | | [https://www.yeastgenome.org/locus/ARS805 ARS805]<br> | ||
| + | The coordinates of ARS805 were updated based on Nieduszynski et al. 2006.<br> <br> | ||
| + | '''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000117321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] | [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br> | ||
| + | |- | ||
| + | | 2006-04-13 | ||
| + | | [https://www.yeastgenome.org/locus/ARS808 ARS808]<br> | ||
| + | ARS808, also known as ARS2, was added to the genome annotation for Chromosome VII at coordinates 140342-141267 based on Wyrick et al. 2001 and Hsiao & Carbon 1981. "ARS2" is being retained as the Standard Gene Name for historical reasons, but the systematic name "ARS808" is being used for consistency purposes, to indicate that this ARS is part of Chromosome VIII.<br> <br> | ||
| + | '''Hsiao CL and Carbon J''' (1981) Characterization of a yeast replication origin (ars2) and construction of stable minichromosomes containing cloned yeast centromere DNA (CEN3). Gene 15(2-3):157-66. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000041563 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/7028571 PubMed] | [https://www.sciencedirect.com/science/article/pii/0378111981901256?via%3Dihub Full-Text]<br> | ||
| + | '''Wyrick JJ, et al.''' (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000069019 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11743203 PubMed] | [https://science.sciencemag.org/content/294/5550/2357.long Full-Text] | [https://www.ncbi.nlm.nih.gov/pubmed/11743187 Comments & Errata]<br> | ||
| + | |- | ||
| + | | 2006-04-13 | ||
| + | | [https://www.yeastgenome.org/locus/ARS805 ARS805]<br> | ||
| + | ARS805, also known as "SPO11 ARS", was added to the genome annotation for Chromosome VIII at coordinates 64155-64459 based on Wyrick et al. 2001 and Atcheson et al. 1987.<br> <br> | ||
| + | '''Atcheson CL, et al.''' (1987) Isolation, DNA sequence, and regulation of a meiosis-specific eukaryotic recombination gene. Proc Natl Acad Sci U S A 84(22):8035-9. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000053823 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/3317399 PubMed] | [https://www.sciencedirect.com/science/article/pii/0378111981901256?via%3Dihub Full-Text]<br> | ||
| + | '''Wyrick JJ, et al.''' (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000069019 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11743203 PubMed] | [https://www.pnas.org/content/84/22/8035.long Full-Text]<br> | ||
| + | |- | ||
| + | | 2005-11-07 | ||
| + | | [https://www.yeastgenome.org/locus/YHR163W YHR163W]<br> | ||
| + | High-throughput identification of transcription start sites by Zhang and Dietrich 2005 confirmed that the start site for YHR163W should be moved 93 nt downstream from 423632 to 423725. As a consequence of this annotation change, YHR163W was shortened at the 5' end, decreasing the size of the predicted protein from 280 amino acids to 249 amino acids.<br> <br> | ||
| + | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
| + | '''Zhang Z and Dietrich FS''' (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000082006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/15905473 PubMed] | [https://academic.oup.com/nar/article/33/9/2838/2401448 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=15905473&db=pmid YFGdb]<br> | ||
| + | |- | ||
| + | | 2005-11-03 | ||
| + | | [https://www.yeastgenome.org/locus/YHR079C-A YHR079C-A]<br> | ||
| + | The following intron predicted by Brachat, et al was added to SAE3/YHR079C-A on the basis of experimental evidence provided by Hayase, et al and Tsubouchi and Roeder: | ||
| + | exon 1: ...tgtctaaaga aaagaaaaa<br> <br> | ||
| + | <pre>intron: g tatgtagcta ttttttccag tcggcaaaaa tcggtataac aaacaaaaaa tatttagttt ctgttattaa cagaacttgt caaag | ||
| + | |||
| + | exon2: tgatg agacaccaaa aaaaatttcc tcgacgtaca ttaaagagtt...</pre> | ||
| + | <br> | ||
| + | '''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br> | ||
| + | '''Hayase A, et al.''' (2004) A protein complex containing Mei5 and Sae3 promotes the assembly of the meiosis-specific RecA homolog Dmc1. Cell 119(7):927-40. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000080355 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/15620352 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867404011420?via%3Dihub Full-Text] <br> | ||
| + | '''Tsubouchi H and Roeder GS''' (2002) The Mnd1 protein forms a complex with hop2 to promote homologous chromosome pairing and meiotic double-strand break repair. Mol Cell Biol 22(9):3078-88. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000069966 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11940665 PubMed] | [https://mcb.asm.org/content/22/9/3078 Full-Text] <br> | ||
| + | |- | ||
| + | | 2004-10-12 | ||
| + | | [https://www.yeastgenome.org/locus/CEN8 CEN8]<br> | ||
| + | The orientation of this centromere was reversed (from Watson to Crick) to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. and Espelin et al.<br><br> | ||
| + | '''Wieland G, et al.''' (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000059647 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11222754 PubMed] | [https://academic.oup.com/nar/article/29/5/1054/2381189 Full-Text]<br> | ||
| + | '''Espelin CW, et al.''' (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000074756 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/13679521 PubMed] | [https://www.molbiolcell.org/doi/full/10.1091/mbc.e02-08-0533?url_ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed Full-Text]<br> | ||
| + | |- | ||
| + | | 2004-04-01 | ||
| + | | [https://www.yeastgenome.org/locus/RUF5-1 RUF5-1], [https://www.yeastgenome.org/locus/RUF5-2 RUF5-2]<br> | ||
| + | Start and stop coordinates updated per McCutcheon & Eddy 2004.<br><br> | ||
| + | '''McCutcheon JP and Eddy SR''' (2004) GDetailed correction to: Computational identification of noncoding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res. 31:4119-4128, 2003. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000074006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12853629 PubMed] | [https://academic.oup.com/nar/article/31/14/4119/2904330#55548715 Full-Text] <br> | ||
| + | |- | ||
| + | | 2004-02-20 | ||
| + | | [https://www.yeastgenome.org/locus/YHR199C-A YHR199C-A]<br> | ||
| + | Thanks to Cliften et al. for providing the coordinates of YHR199C-A.<br><br> | ||
| + | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
| + | |- | ||
| + | | 2003-09-22 | ||
| + | | [https://www.yeastgenome.org/locus/YHR065C YHR065C]<br> | ||
| + | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for RRP3/YHR065C be moved 126 nt (42 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br><br> | ||
| + | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
| + | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
| + | |- | ||
| + | | 2003-09-22 | ||
| + | | [https://www.yeastgenome.org/locus/YHR064C YHR064C]<br> | ||
| + | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for SSZ1/YHR064C be moved 102 nt (34 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) protein sequence conservation with other chaperone homologs in S. cerevisiae begins sharply at about 30 amino acids from the current start.<br><br> | ||
| + | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
| + | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
| + | |- | ||
| + | | 2003-09-22 | ||
| + | | [https://www.yeastgenome.org/locus/YHR128W YHR128W]<br> | ||
| + | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for FUR1/YHR128W be moved 106 nt (35 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br><br> | ||
| + | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
| + | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
| + | |- | ||
| + | | 2003-09-09 | ||
| + | | [https://www.yeastgenome.org/locus/TEL08L TEL08L], [https://www.yeastgenome.org/locus/TEL08R TEL08R]<br> | ||
| + | The chromosomal locations for TEL08L, TEL08L-TR, TEL08L-XC, TEL08L-XR, TEL08L-YP, TEL08R, TEL08R-TR1 , TEL08R-TR2, TEL08R-XC, TEL08R-XR, and TEL08R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).<br><br> | ||
| + | |- | ||
| + | | 2003-07-29 | ||
| + | | [https://www.yeastgenome.org/locus/YHL015W-A YHL015W-A], [https://www.yeastgenome.org/locus/YHL048C-A YHL048C-A], [https://www.yeastgenome.org/locus/YHR007C-A YHR007C-A], [https://www.yeastgenome.org/locus/YHR032W-A YHR032W-A], [https://www.yeastgenome.org/locus/YHR050W-A YHR050W-A], [https://www.yeastgenome.org/locus/YHR073C-B YHR073C-B], [https://www.yeastgenome.org/locus/YHR073W-A YHR073W-A]<br> | ||
| + | Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome VIII ORFs: YHL015W-A, YHL048C-A, YHR007C-A, YHR032W-A, YHR050W-A, YHR073C-B, and YHR073W-A.<br><br> | ||
| + | '''Basrai MA, et al.''' (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000042214 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10490641 PubMed] | [https://mcb.asm.org/content/19/10/7041.long Full-Text] <br> | ||
| + | '''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br> | ||
| + | '''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000073672 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] | [https://genome.cshlp.org/content/12/8/1210.long Full-Text] | [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br> | ||
| + | |- | ||
| + | | 2003-07-29 | ||
| + | | [https://www.yeastgenome.org/locus/YHL002C-A YHL002C-A], [https://www.yeastgenome.org/locus/YHL006W-A YHL006W-A], [https://www.yeastgenome.org/locus/YHL019W-A YHL019W-A], [https://www.yeastgenome.org/locus/YHL030W-A YHL030W-A], [https://www.yeastgenome.org/locus/YHL034W-A YHL034W-A], [https://www.yeastgenome.org/locus/YHL046W-A YHL046W-A], [https://www.yeastgenome.org/locus/YHR028W-A YHR028W-A], [https://www.yeastgenome.org/locus/YHR056W-A YHR056W-A], [https://www.yeastgenome.org/locus/YHR063W-A YHR063W-A], [https://www.yeastgenome.org/locus/YHR069C-A YHR069C-A], [https://www.yeastgenome.org/locus/YHR070C-A YHR070C-A], [https://www.yeastgenome.org/locus/YHR071C-A YHR071C-A], [https://www.yeastgenome.org/locus/YHR131W-A YHR131W-A], [https://www.yeastgenome.org/locus/YHR165W-A YHR165W-A], [https://www.yeastgenome.org/locus/YHR182C-A YHR182C-A], [https://www.yeastgenome.org/locus/YHR193C-A YHR193C-A], [https://www.yeastgenome.org/locus/YHR218W-A YHR218W-A]<br> | ||
| + | Thanks to [https://bioinformatik.wzw.tum.de/index.php?id=63 MIPS] for providing the coordinates for the following Chromosome VIII ORFs: YHL002C-A, YHL006W-A, YHL019W-A, YHL030W-A, YHL034W-A, YHL046W-A, YHR028W-A, YHR032C-A, YHR056W-A, YHR063W-A, YHR069C-A, YHR070C-A, YHR071C-A, YHR131W-A, YHR165W-A, YHR182C-A, YHR193C-A, and YHR218W-A.<br><br> | ||
| + | |- | ||
| + | | 2003-07-29 | ||
| + | | [https://www.yeastgenome.org/locus/YHR086W-A YHR086W-A], [https://www.yeastgenome.org/locus/YHR175W-A YHR175W-A], [https://www.yeastgenome.org/locus/YHR180C-B YHR180C-B], [https://www.yeastgenome.org/locus/YHR180W-A YHR180W-A]<br> | ||
| + | Thanks to Kessler et al. for providing the coordinates of the following Chromosome VIII ORFs: YHR180C-B, YHR180W-A, YHR175W-A, and YHR086W-A.<br><br> | ||
| + | '''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000073671 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] | [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br> | ||
| + | |- | ||
| + | | 2003-07-29 | ||
| + | | [https://www.yeastgenome.org/locus/YHL050W-A YHL050W-A], [https://www.yeastgenome.org/locus/YHR022C-A YHR022C-A], [https://www.yeastgenome.org/locus/YHR032C-A YHR032C-A], [https://www.yeastgenome.org/locus/YHR052W-A YHR052W-A], [https://www.yeastgenome.org/locus/YHR054W-A YHR054W-A], [https://www.yeastgenome.org/locus/YHR137C-A YHR137C-A], [https://www.yeastgenome.org/locus/YHR212W-A YHR212W-A], [https://www.yeastgenome.org/locus/YHR213W-A YHR213W-A], [https://www.yeastgenome.org/locus/YHR213W-B YHR213W-B], [https://www.yeastgenome.org/locus/YHR214C-D YHR214C-D], [https://www.yeastgenome.org/locus/YHR214C-E YHR214C-E], [https://www.yeastgenome.org/locus/YHR219C-A YHR219C-A]<br> | ||
| + | Thanks to Kumar et al. for providing the coordinates of the followinc Chromosome VIII ORFs: YHL050W-A, YHR052W-A, YHR137C-A, YHR213W-A, YHR213W-B, YHR214C-D, YHR214C-E, YHR219C-A, YHR212W-A, YHR054W-A, YHR032C-A, and YHR022C-A.<br><br> | ||
| + | '''Kumar A, et al.''' (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000073673 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11753363 PubMed] | [https://www.nature.com/articles/nbt0102-58 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11753363&db=pmid YFGdb] | [https://www.yeastgenome.org/reference/S000141796 Comments & Errata] <br> | ||
| + | |- | ||
| + | | 2003-03-06 | ||
| + | | [https://www.yeastgenome.org/locus/RUF5-1 RUF5-1], [https://www.yeastgenome.org/locus/RUF5-2 RUF5-2]<br> | ||
| + | Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8.<br><br> | ||
| + | '''McCutcheon JP and Eddy SR''' (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28. <br> | ||
| + | [https://www.yeastgenome.org/reference/S000074006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12853629 PubMed] | [https://academic.oup.com/nar/article/31/14/4119/2904330 Full-Text] <br> | ||
| + | |- | ||
| + | | 2000-08-11 | ||
| + | | [https://www.yeastgenome.org/locus/YHR039C-A YHR039C-A]<br> | ||
| + | Old name: YHR039C-B; new name: YHR039C-A; date: 11/1998; old coord: ChrVIII 187670 187164; SGDID: S0002100; Name changed due to nomenclature.<br><br> | ||
| + | |- | ||
| + | | 2000-08-11 | ||
| + | | [https://www.yeastgenome.org/locus/YHR079C-A YHR079C-A]<br> | ||
| + | Old name: YHR079C-B; new name: YHR079C-A; date: 11/1998; old coord: ChrVIII 262554 262402; SGDID: S0001957; Name changed due to nomenclature.<br><br> | ||
| + | |||
| + | |} | ||
Latest revision as of 15:08, 21 April 2022
This page lists all sequence and annotation changes that have been made to the Chromosome VIII systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome VIII has been updated 33 times, affecting 40 features.
- The annotation of Chromosome VIII has been updated 27 times, affecting 72 features.
- Current and past versions can be obtained from SGD's Download site.
Sequence Changes
| Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
|---|---|---|---|---|---|---|
| 2011-02-03 | ARS814, YHR092C | 287178 | 287178 | Insertion | C | |
| 287123 | 287123 | Deletion | C | |||
| 287116 | 287116 | Deletion | G | |||
One single nucleotide was inserted, and two single nucleotides deleted, within the ORF HXT4/YHR092C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 16 amino acids longer. The two nucleotide deletions also alter the sequence of the overlapping ARS814.
New 287091 CCGAACATCTTCTTGTAAAATGG-TTGATC-ATCATGCATTAGATCATCAGCGTTGTAGT 287148
||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||
Old 287093 CCGAACATCTTCTTGTAAAATGGGTTGATCCATCATGCATTAGATCATCAGCGTTGTAGT 287152
New 287149 CAGTACCTCTCTTGTTTGGTGGAACCCAAGAAGGTGATTTCCATGGCAAAACACCTTCTT 287208
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Old 287153 CAGTACCTCTCTTGTTTGGTGGAACC-AAGAAGGTGATTTCCATGGCAAAACACCTTCTT 287211
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YHR049C-A | 207353 | 207353 | Deletion | A | |
A single nucleotide was deleted near the middle of ORF YHR049C-A, altering its coding sequence. The start remains the same, but the C-terminal half of the protein sequence has changed and the annotated protein is now five amino acids shorter.
New 207360 GTGCTGCTAA-CCCCGCCCGGCGCGAAAAATCCACCCGGGGTGCTTTAGCGTGGCTTACGAAGACCTTTT 207418
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old 207353 GTGCTGCTAAACCCCGCCCGGCGCGAAAAATCCACCCGGGGTGCTTTAGCGTGGCTTACGAAGACCTTTT 207412
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YHR095W | 293374 | 293374 | Insertion | C | |
A single C nucleotide was inserted within ORF YHR095W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 20 amino acids longer.
New 293329 TACGTTTTTGCAAGCAAAAATGAAGATAATCCGAGCGCATGCGCAAGTAGTCCCTGCCAT 293388
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old 293332 TACGTTTTTGCAAGCAAAAATGAAGATAATCCGAGCGCATGCG-AAGTAGTCCCTGCCAT 293390
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YHR168W | 441869 | 441869 | Insertion | G | |
A single G nucleotide was inserted very near the 3' end of ORF MTG2/YHR168W, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 19 amino acids longer.
New 441827 GTCAGGAATGGGACTGTGTTCCGATAAGCGCCCTCAGAGAGGAAAACATAGATGTGTTAA 441886
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old 441829 GTCAGGAATGGGACTGTGTTCCGATAAGCGCCCTCAGAGAG-AAAACATAGATGTGTTAA 441887
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YHL037C | 441869 | 441869 | Deletion | G | |
A single nucleotide was deleted within the ORF YHL037C, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 26 amino acids shorter.
New 25801 ATGCAAGGGTTATGG-CATGCGCATCCATGTGGCGTTTCCTACTTTTATTTTTACATAAT 25859
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old 25798 ATGCAAGGGTTATGGGCATGCGCATCCATGTGGCGTTTCCTACTTTTATTTTTACATAAT 25857
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YHL047C | 8358 | 8358 | Insertion | G | |
A single nucleotide was inserted within the ORF ARN2/YHL047C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids shorter.
New 8341 TAAATCTTTCTTATGACCTGCCTAAGGCCTTTGCAAAACGTTTCGCGATCCAGTCATTGA 8400
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Old 8340 TAAATCTTTCTTATGACCT-CCTAAGGCCTTTGCAAAACGTTTCGCGATCCAGTCATTGA 8398
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YHR056C, YHR056W-A | 217753 | 217753 | Substitution | G | T |
A single nucleotide substitution within the coding region of YHR056W-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 116 is now Cysteine rather than Glycine. This nucleotide change also altered the DNA sequence, but not the amino acid sequence, of overlapping ORF RSC30/YHR056C.
New 217731 CAATTCCCACATATCGGTTTTGCCCTGTCGCACCCGATCTTTCTCTTCCTGCATTGGGTG 217790
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Old 217733 CAATTCCCACATATCGGTTTGGCCCTGTCGCACCCGATCTTTCTCTTCCTGCATTGGGTG 217792
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YHR072W | 240687 | 240687 | Substitution | G | A |
A single nucleotide substitution within the coding region of ERG7/YHR072W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 530 is now Asparagine rather than Aspartic Acid.
New 240651 AATGGAAACCTTGAATCCTGCTGAAGTTTTTGGTAACATAATGGTAGAATACCCATACGT 240710
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Old 240653 AATGGAAACCTTGAATCCTGCTGAAGTTTTTGGTGACATAATGGTAGAATACCCATACGT 240712
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YHR197W | 496180 | 496180 | Substitution | G | A |
A single nucleotide substitution within the coding region of RIX1/YHR197W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 762 is now Glutamic Acid rather than Glycine.
New 496127 GTTTGAAATTCCCGCTATCGAATTAAGTGATGACGAAGAGGAGGAGGAAGAAGAAGAATA 496186
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Old 496127 GTTTGAAATTCCCGCTATCGAATTAAGTGATGACGAAGAGGAGGAGGAAGAAGGAGAATA 496186
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YHL040C, YHL041W | 18567 | 18567 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs YHL041W and ARN1/YHL040C.
New 18541 CTATCTCTTTACAAGCTGAATGGAATGGGGCTTAGCCGACTGGAAGGATAGGCTTGCCAA 18600
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Old 18539 CTATCTCTTTACAAGCTGAATGGAATGGG-CTTAGCCGACTGGAAGGATAGGCTTGCCAA 18597
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | TEL08L-YP, YHL050C | 2251 | 2251 | Insertion | C | |
A single nucleotide insertion was made in the left telomere of chromosome 8, specifically within Y' element TEL08L-YP and the intron of overlapping ORF YHL050C.
New 2221 CTTAATTGGTGGCAATTCACCCTTACGATTCCTTGCGGCCCAACTGTTTTTTCTAGATAA 2280
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old 2221 CTTAATTGGTGGCAATTCACCCTTACGATTC-TTGCGGCCCAACTGTTTTTTCTAGATAA 2279
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YHR095W, YHR096C | 294437 | 294437 | Deletion | A | |
A single nucleotide deletion was made in the intergenic region between ORFs YHR095W and HXT5/YHR096C.
New 294409 ATCCTACTTAAAATAAAGAAAAAAAA-CAAAAACGTCATGATGATTTTGATATTATTAGA 294467
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Old 294411 ATCCTACTTAAAATAAAGAAAAAAAAACAAAAACGTCATGATGATTTTGATATTATTAGA 294470
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YHR009C, YHR010W | 126326 | 126326 | Insertion | C | |
A single nucleotide insertion was made in the intergenic region between ORFs YHR009C and RPL27A/YHR010W.
New 126300 GAACTGTCTGAGACAAAGTCTTTCCAGCAGAGCTCCGCCTACGCTCTTGCTGCAGAGATT 126359
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Old 126295 GAACTGTCTGAGACAAAGTCTTTCCAGCAGAG-TCCGCCTACGCTCTTGCTGCAGAGATT 126353
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YHR013C, YHR014W | 131454 | 131454 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs ARD1/YHR013C and SPO13/YHR014W.
New 131450 TGACGAAGTTTTATTTTGGAGCTTGATCGTATGTATTTAGGTTTCCCTTTTCACTTGGCAATTACTCGTT 131519
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old 131444 TGACGAAGTTT-ATTTTGGAGCTTGATCGTATGTATTTAGGTTTCCCTTTTCACTTGGCAATTACTCGTT 131512
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YHL023C, tH(GUG)H | 62687 | 62687 | Substitution | G | A |
A single nucleotide substitution was made in the intergenic region between ORF NPR3/YHL023C and tRNA tH(GUG)H.
New 62640 CTATGTTTAATGGTATTTCAAGATATCACAAGCGAAAAAGTTACTTAAGAAAAAAGACTA 62699
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old 62638 CTATGTTTAATGGTATTTCAAGATATCACAAGCGAAAAAGTTACTTAAGGAAAAAGACTA 62697
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YHL012W, YHL013C | 78734 | 78734 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs OTU2/YHL013C and YHL012W.
New 78720 ATTAAAAAAAGAATGCAGGAATAGCACCTTATAGTAAAAAAAGTAAATTTAAGTAATTAA 78779
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old 78717 ATTAAAAAAAGAATGCAG-AATAGCACCTTATAGTAAAAAAAGTAAATTTAAGTAATTAA 78775
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | ARS805 | 64392 | 64392 | Insertion | A | |
A single nucleotide insertion was made within ARS805.
New 64380 AACATTAAAAAAAAAATTGTCACTACACAGAGAGAAAATAAATAAATATAAAGAATCACA 64439
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old 64378 AACATTAAAAAAAAA-TTGTCACTACACAGAGAGAAAATAAATAAATATAAAGAATCACA 64436
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YHR132C, YHR132W-A | 369889 | 369889 | Insertion | A | |
| 369987 | 369987 | Deletion | T | |||
A single nucleotide insertion and a single nucleotide deletion were made in the intergenic region between ORFs ECM14/YHR132C and IGO2/YHR132W-A.
New 369838 GTCTTTTAAACCGTCGAAAATATTTTATCCTTCCTTCCATTTAGTTGGAACCATTTTCTA 369897
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old 369841 GTCTTTTAAACCGTCGAAAATATTTTATCCTTCCTTCCATTTAGTTGGA-CCATTTTCTA 369899
New 369948 TGATCTTTTAAATTACAGGTTATCGCGGGAGAATATT-GGGGTTCAGAAATACAACACAT 370006
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Old 369950 TGATCTTTTAAATTACAGGTTATCGCGGGAGAATATTTGGGGTTCAGAAATACAACACAT 370009
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | RUF5-1, YHR052W | 212258 | 212258 | Deletion | A | |
| 212270 | 212276 | Deletion | TTTTTTT | |||
A single nucleotide deletion and a heptanucleotide deletion were made in the intergenic region between ORF YHR052W and ncRNA RUF5-1.
New 212229 ACGTTCTCATAATACATTTTAGGATTAATACATAT-GCTTTTTTTTT-------ATTCGAAATCT 212285
||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||
Old 212223 ACGTTCTCATAATACATTTTAGGATTAATACATATAGCTTTTTTTTTTTTTTTTATTCGAAATCT 212287
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YHR170W, YHR171W | 445615 | 445615 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between NMD3/YHR170W and ATG7/YHR171W.
New 445607 CCGGCACGGCAAAACAAAAAAATTAAGGGAACTCATTATTTTACGATGCTACTTAGATAA 445666
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Old 445608 CCGGCACG-CAAAACAAAAAAATTAAGGGAACTCATTATTTTACGATGCTACTTAGATAA 445666
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YHR162W, YHR163W | 423723 | 423723 | Insertion | C | |
A single nucleotide insertion was made in the intergenic region between ORFs YHR162W and SOL3/YHR163W.
New 423707 CCCTGGTCCGCGACCAAATGGTGACAGTCGGTGTGTTTTCTGAGAGGGCTAGTTTGACCC 423766
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Old 423710 CCCTGGTCCGCGAC-AAATGGTGACAGTCGGTGTGTTTTCTGAGAGGGCTAGTTTGACCC 423768
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2011-02-03 | YHL002W, YHL003C | 102564 | 102564 | Insertion | C | |
A single nucleotide insertion was made in the intergenic region between ORFs LAG1/YHL003C and HSE1/YHL002W.
New 102540 ATTCTAACTGTTAAATATAGGGGCCATGCCAGAGGCAATGCGTAAATCTATCTAAGGAAA 102599
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Old 102536 ATTCTAACTGTTAAATATAGGGGCCATGC-AGAGGCAATGCGTAAATCTATCTAAGGAAA 102594
Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
| 2005-11-08 | YHL026C | 54135 | 54135 | Insertion | G | |
Based on the automated comparison of closely related Saccharomyces species, Cliften et al. suggest that the start site for YHL026C be moved 141 nt upstream. SGD confirmed the insertion of a single G nt between the G at 54135 and the T at 54136. As a consequence of this sequence change, YHL026C will be extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 268 to 315 amino acids.
New: ATGGAATTTCTGAACCCGGTCGGGGTCGCTGGCGCTGGCTCTGAGGATTTCATATATGTG
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old: 54112 ATGGAATTTCTGAACCCGGTCGGG-TCGCTGGCGCTGGCTCTGAGGATTTCATATATGTG 54170
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. | ||||||
| 2004-07-26 | YHR131C, YHR131W-A | 367891 | 367891 | Insertion | C | |
The work of Kellis et al. proposed an insertion that would extend the YHR131C reading frame. This sequence error was confirmed in S288C by SGD. As a consequence of this change, YHR131C was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 840 to 850 amino acids. In addition, YHR131W-A was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 115 to 81 amino acids.
New: TAATTTGCCCTCTATTGGCAGAGCCATCCTTAACAAACGAACAACTTGTATGCACGATGT
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old: 367868 TAATTTGCCCTCTATTGGCAGAGC-ATCCTTAACAAACGAACAACTTGTATGCACGATGT 367926
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
| 2004-07-26 | YHL006C | 98461 | 98461 | Insertion | C | |
Kellis et al. predicted and confirmed the insertion of a single C nt. As a consequence of this sequence change, YHL006C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 159 to 150 amino acids.
New: 98439 GCCGTAACACAAGGCTAAGTAGCCGCAGCTGTTGCGGTCCATCTTGTGTCGCGGTGAGAT 98498
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old: 98439 GCCGTAACACAAGGCTAAGTAGC-GCAGCTGTTGCGGTCCATCTTGTGTCGCGGTGAGAT 98497
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
| 2004-02-01 | YHR176W | 455503 | 455503 | Insertion | C | |
| 455307 | 455307 | Insertion | G | |||
Based on the comparison of related fungi, Brachat et al. suggested that the C-terminus of Fmo1p/YHR176Wp be extended at the C-Terminus. Zhang and Robertus resequenced this gene (in 2 S288C derived strains, X2180 and TR2), confirming the insertion of two nucleotides. As a consequence of these sequence changes, FMO1/YHR176W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 373 to 432 amino acids.
New: 455286 GGAACGCACAACTTCCCAAAGGGAAAGGACCTGGAATACTATGCAGAACTACAGGAACTA 455345
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old: 455286 GGAACGCACAACTTCCCAAAGG-AAAGGACCTGGAATACTATGCAGAACTACAGGAACTA 455344
New: 455346 CTGAATAGCATTCCACGTAGGGTCGGTCATTTCGAACCAGTTGTATGGGATGATAGACTG 455405
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old: 455345 CTGAATAGCATTCCACGTAGGGTCGGTCATTTCGAACCAGTTGTATGGGATGATAGACTG 455404
New: 455406 ATCGATCTAAGAAACAGTAGTTATACAGACAAAGAAGAAAGAAATGTGCTTCTAGCGGAA 455465
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old: 455405 ATCGATCTAAGAAACAGTAGTTATACAGACAAAGAAGAAAGAAATGTGCTTCTAGCGGAA 455464
New: 455466 CACGCACAAGCCCTAAAGAAAAAAAAAGCACCATACTTCCTTCCGGCGCCACATACTTAA 455525
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old: 455465 CACGCACAAGCCCTAAAGAAAAAAAAAGCACCATACTTC-TTCCGGCGCCACATACTTAA 455523
Zhang M and Robertus JD (2002) Molecular cloning and characterization of a full-length flavin-dependent monooxygenase from yeast. Arch Biochem Biophys 403(2):277-83. | ||||||
| 2004-07-26 | YHR056C, YHR056W-A | 217751 | 217751 | Deletion | T | |
Based on the automated comparison of related fungi, Cliften et al. and Brachat et al. both suggest that the start site for RSC30/YHR056C be moved 155 nt upstream. Based on experimental evidence, Angus-Hill et al. proposed the deletion of a single T nt upstream of RSC30/YHR056C, allowing a 51 amino acid N-terminal extension. This sequence change was confirmed in S288c by SGD. As a consequence of this sequence change, two ORFs were extended: (1) RSC30/YHR056C was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 832 to 883 amino acids; (2) YHR056W-A was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 143 to 144 amino acids.
New: 217704 AAAACAGTCCGGCTTGTTATACTTGACGCAATTCCCACATATCGGTTT-GGCCCTGTCGC 217762
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old: 217704 AAAACAGTCCGGCTTGTTATACTTGACGCAATTCCCACATATCGGTTTTGGCCCTGTCGC 217763
Angus-Hill ML, et al. (2001) A Rsc3/Rsc30 zinc cluster dimer reveals novel roles for the chromatin remodeler RSC in gene expression and cell cycle control. Mol Cell 7(4):741-51. | ||||||
| 2000-01-21 | YHR132W-A | 370332 | 370332 | Insertion | C | |
A single C nucleotide was inserted after the C at chromosomal coordinate 370331, resulting in the creation of a new ORF YHR132W-A spanning coordinates 370055-370450. See GenBank files: YSCH9315 GenBank entry, accession U10398, U00093. Thank you to Atsuko Horiuchi for alerting SGD to this omission.
New: aatcctagcggtttaagagag
|||| ||||||||||||||||
Old: aatc-tagcggtttaagagag
| ||||||
Annotation Changes without sequence changes
| Date | Affected Features |
|---|---|
| 2021-04-21 | YHR052C-B New ORF
|
| 2021-04-21 | YHR054C-B New ORF
|
| 2021-04-21 | SUT169/YNCH0011W New ncRNA
|
| 2014-11-19 | ARS802, ARS805, ARS807, ARS813, ARS818, ARS820 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome VIII based on Liachko et al. 2013: ARS802, ARS805, ARS807, ARS813, ARS818, ARS820. |
| 2014-11-19 | ARS802, ARS805, ARS807, ARS809, ARS813, ARS815, ARS818, ARS820 The chromosomal coordinates of the following ARS elements on Chromosome VIII were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS802, ARS805, ARS807, ARS809, ARS813, ARS815, ARS818, ARS820. |
| 2009-05-06 | ARS801, ARS806, ARS810, ARS811, ARS814, ARS815 The following ARS elements on Chromosome 8 were added to the genome annotation based on Raveendranathan et al. 2006: ARS801, ARS806, ARS810, ARS811, ARS814, and ARS815. |
| 2007-07-09 | YHR076W An intron was annotated within PTC7/YHR076W at relative coordinates 56..148 based on GenBank EF123135, Juneau et al. 2007, and Zhang et al. 2007. According to Juneau et al. 2007, the intron is "inefficiently spliced" (splicing rate = 55%). Note that the currently annotated start and stop remain the same. |
| 2006-09-07 | ARS802, ARS807, ARS809, ARS813, ARS818, ARS820, ARS822, ARS824 The following new ARS elements on Chromosome VIII were added to SGD based on Nieduszynski et al. 2006: ARS802, ARS807, ARS809, ARS813, ARS818, ARS820, ARS822, ARS824. |
| 2006-09-07 | ARS805 The coordinates of ARS805 were updated based on Nieduszynski et al. 2006. |
| 2006-04-13 | ARS808 ARS808, also known as ARS2, was added to the genome annotation for Chromosome VII at coordinates 140342-141267 based on Wyrick et al. 2001 and Hsiao & Carbon 1981. "ARS2" is being retained as the Standard Gene Name for historical reasons, but the systematic name "ARS808" is being used for consistency purposes, to indicate that this ARS is part of Chromosome VIII. |
| 2006-04-13 | ARS805 ARS805, also known as "SPO11 ARS", was added to the genome annotation for Chromosome VIII at coordinates 64155-64459 based on Wyrick et al. 2001 and Atcheson et al. 1987. |
| 2005-11-07 | YHR163W High-throughput identification of transcription start sites by Zhang and Dietrich 2005 confirmed that the start site for YHR163W should be moved 93 nt downstream from 423632 to 423725. As a consequence of this annotation change, YHR163W was shortened at the 5' end, decreasing the size of the predicted protein from 280 amino acids to 249 amino acids. |
| 2005-11-03 | YHR079C-A The following intron predicted by Brachat, et al was added to SAE3/YHR079C-A on the basis of experimental evidence provided by Hayase, et al and Tsubouchi and Roeder:
exon 1: ...tgtctaaaga aaagaaaaa intron: g tatgtagcta ttttttccag tcggcaaaaa tcggtataac aaacaaaaaa tatttagttt ctgttattaa cagaacttgt caaag exon2: tgatg agacaccaaa aaaaatttcc tcgacgtaca ttaaagagtt...
|
| 2004-10-12 | CEN8 The orientation of this centromere was reversed (from Watson to Crick) to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. and Espelin et al. |
| 2004-04-01 | RUF5-1, RUF5-2 Start and stop coordinates updated per McCutcheon & Eddy 2004. |
| 2004-02-20 | YHR199C-A Thanks to Cliften et al. for providing the coordinates of YHR199C-A. |
| 2003-09-22 | YHR065C Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for RRP3/YHR065C be moved 126 nt (42 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
| 2003-09-22 | YHR064C Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for SSZ1/YHR064C be moved 102 nt (34 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) protein sequence conservation with other chaperone homologs in S. cerevisiae begins sharply at about 30 amino acids from the current start. |
| 2003-09-22 | YHR128W Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for FUR1/YHR128W be moved 106 nt (35 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
| 2003-09-09 | TEL08L, TEL08R The chromosomal locations for TEL08L, TEL08L-TR, TEL08L-XC, TEL08L-XR, TEL08L-YP, TEL08R, TEL08R-TR1 , TEL08R-TR2, TEL08R-XC, TEL08R-XR, and TEL08R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK). |
| 2003-07-29 | YHL015W-A, YHL048C-A, YHR007C-A, YHR032W-A, YHR050W-A, YHR073C-B, YHR073W-A Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome VIII ORFs: YHL015W-A, YHL048C-A, YHR007C-A, YHR032W-A, YHR050W-A, YHR073C-B, and YHR073W-A. |
| 2003-07-29 | YHL002C-A, YHL006W-A, YHL019W-A, YHL030W-A, YHL034W-A, YHL046W-A, YHR028W-A, YHR056W-A, YHR063W-A, YHR069C-A, YHR070C-A, YHR071C-A, YHR131W-A, YHR165W-A, YHR182C-A, YHR193C-A, YHR218W-A Thanks to MIPS for providing the coordinates for the following Chromosome VIII ORFs: YHL002C-A, YHL006W-A, YHL019W-A, YHL030W-A, YHL034W-A, YHL046W-A, YHR028W-A, YHR032C-A, YHR056W-A, YHR063W-A, YHR069C-A, YHR070C-A, YHR071C-A, YHR131W-A, YHR165W-A, YHR182C-A, YHR193C-A, and YHR218W-A. |
| 2003-07-29 | YHR086W-A, YHR175W-A, YHR180C-B, YHR180W-A Thanks to Kessler et al. for providing the coordinates of the following Chromosome VIII ORFs: YHR180C-B, YHR180W-A, YHR175W-A, and YHR086W-A. |
| 2003-07-29 | YHL050W-A, YHR022C-A, YHR032C-A, YHR052W-A, YHR054W-A, YHR137C-A, YHR212W-A, YHR213W-A, YHR213W-B, YHR214C-D, YHR214C-E, YHR219C-A Thanks to Kumar et al. for providing the coordinates of the followinc Chromosome VIII ORFs: YHL050W-A, YHR052W-A, YHR137C-A, YHR213W-A, YHR213W-B, YHR214C-D, YHR214C-E, YHR219C-A, YHR212W-A, YHR054W-A, YHR032C-A, and YHR022C-A. |
| 2003-03-06 | RUF5-1, RUF5-2 Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8. |
| 2000-08-11 | YHR039C-A Old name: YHR039C-B; new name: YHR039C-A; date: 11/1998; old coord: ChrVIII 187670 187164; SGDID: S0002100; Name changed due to nomenclature. |
| 2000-08-11 | YHR079C-A Old name: YHR079C-B; new name: YHR079C-A; date: 11/1998; old coord: ChrVIII 262554 262402; SGDID: S0001957; Name changed due to nomenclature. |