Difference between revisions of "Details of 2023 Reference Genome Annotation Update R64.4"
(Created page with "The ''S. cerevisiae'' strain S288C reference genome annotation was updated. The new genome annotation is release R64.4.1, dated 2023-08-23. Note that the underlying genome seq...") |
(No difference)
|
Latest revision as of 08:48, 11 September 2023
The S. cerevisiae strain S288C reference genome annotation was updated. The new genome annotation is release R64.4.1, dated 2023-08-23. Note that the underlying genome sequence itself was not altered in any way.
R64.4 Annotation update summary
This annotation update included (details in table below):
- new uORFs for 3 ORFs:
- 8 new ncRNAs:
- 3 ORFs demoted from 'Uncharacterized' to 'Dubious' based on request from NCBI because they overlap tRNAs:
R64.4 Annotation update details
Chr | Feature | Description of change | Reference |
---|---|---|---|
III | SUT035/YNCC0015W | New ncRNA chrIII:205766..205942 (+ strand) |
Xu Z, et al. (2009) PMID:19169243,
Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
IV | YDR278C | Change ORF qualifier from Uncharacterized to Dubious | Requested by NCBI |
IV | SUT053/YNCD0033W | New ncRNA chrIV:506334..507774 (+ strand) |
Xu Z, et al. (2009) PMID:19169243,
Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
IV | SUT468/YNCD0034C | New ncRNA chrIV:506546..507450 (- strand) |
Xu Z, et al. (2009) PMID:19169243,
Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
VII | SUT532/YNCG0047C | New ncRNA chrVII:17213..17709 (- strand) |
Xu Z, et al. (2009) PMID:19169243,
Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
VII | SUT125/YNCG0048W | New ncRNA chrVII:650855..651159 (+ strand) |
Xu Z, et al. (2009) PMID:19169243,
Balarezo-Cisneros LN, et al. (2021) PMID:33493158, Feng MW, et al. (2022) PMID:36712349 |
VII | SUT126/YNCG0049W | New ncRNA chrVII:660087..661399 (+ strand) |
Xu Z, et al. (2009) PMID:19169243,
Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
XII | FPS1/YLL043W | New uORF uORF2 3 codons chrXII:49924..49932 (+ strand) ATGCATTAA |
Cartwright SP, et al. (2017) PMID:28279185 |
XIV | ACC1/YNR016C | New uORF 4 codons chrXIV:661704..661715 (- strand) ATGTGTTTATAA |
Blank HM, et al. (2017) PMID:28057705 |
XIV | HOL1/YNR055C | New uORF 7 codons chrXIV:730381..730401 (- strand) ATGCTATTACTACCAAGTTGA |
Vindu A, et al. (2021) PMID:34375581 |
XV | YOL013W-A | Change ORF qualifier from Uncharacterized to Dubious | Requested by NCBI |
XVI | SUT390/YNCP0025W | New ncRNA chrXVI:52977..53465 (+ strand) |
Xu Z, et al. (2009) PMID:19169243, Feng MW, et al. (2022) PMID:36712349 |
XVI | SUT418/YNCP0026W | New ncRNA chrXVI:588998..589830 (+ strand) |
Xu Z, et al. (2009) PMID:19169243, Feng MW, et al. (2022) PMID:36712349 |
XVI | YPR108W-A | Change ORF qualifier from Uncharacterized to Dubious | Requested by NCBI |