Difference between revisions of "Chromosome XV History"

From SGD-Wiki
Jump to: navigation, search
(→‎Sequence Changes)
(→‎Sequence Changes)
 
(13 intermediate revisions by the same user not shown)
Line 59: Line 59:
 
                 |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
 
                 |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
 
Old    55990    CTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTCAATTTCGCACGCC  56049</pre>
 
Old    55990    CTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTCAATTTCGCACGCC  56049</pre>
 +
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2011-02-03
 +
| [https://www.yeastgenome.org/locus/YOL141W YOL141W]
 +
| 57699
 +
| 57699
 +
| Substitution
 +
| A
 +
| T
 +
|-
 +
| || colspan="6" | Nucleotide change(s) in the coding region of PPM2/YOL141W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 417 is now Leucine rather than Methionine.
 +
<pre>New    57661    GGAGGTAGTAACCCATACAGAGTAAACGAAATATTACAGTTGAGTATACACTACGACAAA  57720
 +
                ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
 +
Old    57660    GGAGGTAGTAACCCATACAGAGTAAACGAAATATTACAGATGAGTATACACTACGACAAA  57719</pre>
 
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
Line 669: Line 685:
 
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2011-02-03
 +
| [https://www.yeastgenome.org/locus/YOR045W YOR045W], [https://www.yeastgenome.org/locus/YOR046C YOR046C]
 +
| 414326
 +
| 414326
 +
| Deletion
 +
| T
 +
|
 +
|-
 +
| || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs TOM6/YOR045W and DBP5/YOR046C.
 +
<pre>New    414297  ATATGCTGTGTTTGTATTTATATAAGCTT-GCCTCACAAGTAAAAGTGGATCAACAAACT  414355
 +
                ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
 +
Old    414297  ATATGCTGTGTTTGTATTTATATAAGCTTTGCCTCACAAGTAAAAGTGGATCAACAAACT  414356</pre>
 +
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2011-02-03
 +
| [https://www.yeastgenome.org/locus/YOL163W YOL163W], [https://www.yeastgenome.org/locus/YOL164W YOL164W]
 +
| 8476
 +
| 8476
 +
| Insertion
 +
|
 +
| T
 +
|-
 +
| || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs BDS1/YOL164W and YOL163W.
 +
<pre>New    8461    AGAGCTTTTCGTATATTCTGTTTTCCTAATAACATTTACTATTGTGAATTGAAATTTAAA  8520
 +
                |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
 +
Old    8461    AGAGCTTTTCGTATAT-CTGTTTTCCTAATAACATTTACTATTGTGAATTGAAATTTAAA  8519</pre>
 +
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2011-02-03
 +
| [https://www.yeastgenome.org/locus/YOR049C YOR049C], [https://www.yeastgenome.org/locus/YOR050C YOR050C]
 +
| 423752
 +
| 423752
 +
| Deletion
 +
| T
 +
|
 +
|-
 +
| || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs RSB1/YOR049C and YOR050C.
 +
<pre>New    423716  CGAAGGTTCGGTACCATACCACCATAAAGGGAATT-ACTGTTAGCTGCTGCTTCTAACTG  423774
 +
                ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
 +
Old    423717  CGAAGGTTCGGTACCATACCACCATAAAGGGAATTTACTGTTAGCTGCTGCTTCTAACTG  423776</pre>
 +
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 +
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2006-01-05
 +
| [https://www.yeastgenome.org/locus/YOL152W YOL152W]
 +
| 42535
 +
| 42535
 +
| Insertion
 +
|
 +
| G
 +
|-
 +
| || colspan="6" | A sequencing error was demonstrated in BY4741 (a derivative of S288C) by Mark Rinnerthaler and Michael Breitenbach, and SGD has updated the sequence accordingly. As a consequence of this change, the stop codon has been moved 27 nts upstream, shortening the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 629 to 620 amino acids. (Personal communication from MIPS, Mark Rinnerthaler and Michael Breitenbach)
 +
<pre>New: 42507 AAGGTATACCGTCGGAAATTCCGTGGCAGGTTTACAGGCC 42546
 +
          ||||||||||||||||||||||||||||| ||||||||||
 +
Old: 42507 AAGGTATACCGTCGGAAATTCCGTGGCAG-TTTACAGGCC 42545</pre>
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2006-01-05
 +
| [https://www.yeastgenome.org/locus/YOR252W YOR252W]
 +
| 803745
 +
| 803745
 +
| Insertion
 +
|
 +
| G
 +
|-
 +
| || colspan="6" | SGD confirmed the sequence error predicted by the work of Kellis, et al, and have updated the systematic sequence accordingly.
 +
<pre>New: 803730 ACGGTTCATCCGAAGGGTAGAAAGTATGAAAAGCT 803764
 +
            |||||||||||||||| ||||||||||||||||||
 +
Old: 803730 ACGGTTCATCCGAAGG-TAGAAAGTATGAAAAGCT 803763</pre>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2004-02-13
 +
| [https://www.yeastgenome.org/locus/YOR298C-A YOR298C-A]
 +
| 877622
 +
| 877622
 +
| Insertion
 +
|
 +
| GC
 +
|-
 +
| || colspan="6" | Two nucleotides GC were inserted after the G at coordinate 877622 in what had previously been annotated as the intergenic region between YOR298C-A and YOR299W. This region is now part of YOR298C-A, as the start for this ORF was moved 279 bp upstream from 877403 to 877682 (note that YOR298C-A is encoded on the Crick strand). As a result, YOR298C-Ap was increased from 58 aa to 151 aa. See Brachat et al. 2003 and GenBank AY260886. This change was also predicted by Kellis et al. and Cliften et al.
 +
<pre>Query:    361 AATTTGGCCTTGAGATCTGGCAACGTTGGCCCTTGGGCCAGAACCACCAGCTCTTGCTCT 420             
 +
              ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||
 +
Sbjct: 877587 AATTTGGCCTTGAGATCTGGCAACGTTGGCCCTTGG--CAGAACCACCAGCTCTTGCTCT 877644</pre>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
 +
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2003-01-09
 +
| [https://www.yeastgenome.org/locus/YOR087W YOR087W], [https://www.yeastgenome.org/locus/YOR088W YOR088W]
 +
| 488439
 +
| 488439
 +
| Insertion
 +
|
 +
| T
 +
|-
 +
| || colspan="6" | Due to the insertion of a T after the A at 488439 on chromosome 15, YOR087W and YOR088W have been merged to one single ORF - YVC1/YOR087W, with YOR088W as an alias. The old chromosomal coordinates for YOR087W were 487708-488451, and for YOR088W were 488286-489734. The new chromosomal coordinates for the fused ORF are 487708-489735. The old relative coordinates for YOR087W were 1-744, and for YOR088W were 1-1449. The new relative coordinates for the fused ORF are 1-2028.<br><br>
 +
'''Denis V and Cyert MS''' (2002) Internal Ca(2+) release in yeast is triggered by hypertonic shock and mediated by a TRP channel homologue. J Cell Biol 156(1):29-34.<br>
 +
[https://www.yeastgenome.org/reference/S000069157 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11781332 PubMed] | [http://jcb.rupress.org/content/156/1/29.long Full-Text] <br>
 +
'''Palmer CP, et al.''' (2001)  A TRP homolog in Saccharomyces cerevisiae forms an intracellular Ca(2+)-permeable channel in the yeast vacuolar membrane. Proc Natl Acad Sci U S A 98(14):7801-5. <br>
 +
[https://www.yeastgenome.org/reference/S000069248 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11427713 PubMed] | [https://www.pnas.org/content/98/14/7801.long Full-Text] <br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 2001-05-31
 +
| [https://www.yeastgenome.org/locus/YOR068C YOR068C], [https://www.yeastgenome.org/locus/YOR069W YOR069W]
 +
| 453804
 +
| 453804
 +
| Insertion
 +
|
 +
| G
 +
|-
 +
| || colspan="6" | Inserted one G nucleotide after the G at chromosomal coordinate 453805, in the intergenic region to the left of overlapping ORFs YOR068C and YOR068W:
 +
<pre>Old: 453752 ATCCTGCAATAACAAGCCATGGACTACGAGGATAATCTAGAAGCACCTGTTTGG-ACGAA 453810
 +
            |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
 +
New: 453752 ATCCTGCAATAACAAGCCATGGACTACGAGGATAATCTAGAAGCACCTGTTTGGGACGAA 453811</pre>
 +
 +
|- style="height:30px; width:30px; text-align:center;"
 +
| 1997-08-11
 +
| [https://www.yeastgenome.org/locus/YOL025W YOL025W]
 +
| 276609
 +
| 276609
 +
| Substitution
 +
| G
 +
| A
 +
|-
 +
| || colspan="6" | A single nucleotide substitution was made in the systematic sequence in the region covering the ORF LAG2/YOL025W. The G at 276609 was changed to an A.
 +
<pre>New: 276601 AAAGCAGGAAATTTTACCCAAAAAATTGATGAAGGAGTGACCTTAAGAACAATGATTCTT 276660
 +
            |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
 +
Old: 276601 AAAGCAGGGAATTTTACCCAAAAAATTGATGAAGGAGTGACCTTAAGAACAATGATTCTT 276660</pre>
 +
 +
|}
 +
 +
<br><br>
 +
 +
=Annotation Changes ''without sequence changes''=
 +
{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
 +
! Date  !! Affected Features
 +
|-
 +
| 2014-11-19
 +
| [https://www.yeastgenome.org/locus/ARS1501 ARS1501], [https://www.yeastgenome.org/locus/ARS1507 ARS1507], [https://www.yeastgenome.org/locus/ARS1508 ARS1508], [https://www.yeastgenome.org/locus/ARS1509 ARS1509], [https://www.yeastgenome.org/locus/ARS1513 ARS1513], [https://www.yeastgenome.org/locus/ARS1519 ARS1519], [https://www.yeastgenome.org/locus/ARS1523 ARS1523], [https://www.yeastgenome.org/locus/ARS1526 ARS1526] <br>
 +
The chromosomal coordinates of the following ARS elements on Chromosome XV were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1507, ARS1508, ARS1509, ARS1513, ARS1501, ARS1519, ARS1523, ARS1526. <br> <br>
 +
'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
 +
[https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text]
 +
|-
 +
| 2014-11-19
 +
| [https://www.yeastgenome.org/locus/ARS1501 ARS1501], [https://www.yeastgenome.org/locus/ARS1507 ARS1507], [https://www.yeastgenome.org/locus/ARS1508 ARS1508], [https://www.yeastgenome.org/locus/ARS1509 ARS1509], [https://www.yeastgenome.org/locus/ARS1510 ARS1510], [https://www.yeastgenome.org/locus/ARS1511 ARS1511], [https://www.yeastgenome.org/locus/ARS1521 ARS1521], [https://www.yeastgenome.org/locus/ARS1524 ARS1524], [https://www.yeastgenome.org/locus/ARS1528 ARS1528], [https://www.yeastgenome.org/locus/ARS1531 ARS1531] <br>
 +
As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome XV based on Liachko et al. 2013: ARS1531, ARS1507, ARS1508, ARS1509, ARS1510, ARS1511, ARS1501, ARS1521, ARS1524, ARS1528. <br> <br>
 +
'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
 +
[https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text]
 +
|-
 +
| 2014-11-19
 +
| [https://www.yeastgenome.org/locus/YOR031W YOR031W] <br>
 +
The feature_type annotation of CRS5/YOR031W was changed from ORF to blocked_reading_frame (SO:0000718) as part of SGD's genome annotation revision R64.2.<br><br>
 +
|-
 +
| 2014-11-19
 +
| [https://www.yeastgenome.org/locus/YOL153C YOL153C] <br>
 +
The feature_type annotation of YOL153C was changed from pseudogene to blocked_reading_frame (SO:0000718) as part of SGD's genome annotation revision R64.2.<br><br>
 +
|-
 +
| 2014-11-18
 +
| [https://www.yeastgenome.org/locus/ETC2 ETC2], [https://www.yeastgenome.org/locus/ETC7 ETC7] <br>
 +
The following previously unmapped features were identified as nuclear matrix attachment sites and assigned chromosomal coordinates based on Hiraga et al. 2012 as part of SGD's genome annotation revision R64.2: ETC1, ETC2, ETC3, ETC4, ETC6, ETC7, ETC8.<br><br>
 +
'''Hiraga SI, et al.''' (2012) TFIIIC localizes budding yeast ETC sites to the nuclear periphery. Mol Biol Cell 23(14):2741-54. <br>
 +
[https://www.yeastgenome.org/reference/S000149071 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/22496415 PubMed] | [https://www.molbiolcell.org/doi/10.1091/mbc.e11-04-0365 Full-Text]<br>
 +
|-
 +
| 2010-01-05
 +
| [https://www.yeastgenome.org/locus/YOR080W YOR080W] <br>
 +
The annotated start ATG of ORF YOR080W/DIA2 has been moved to Met15, based on Morohashi et al. 2009. Old chromosomal coordinates were 474554..476794; the new chromosomal coordinates are 474596..476794. ''Thanks to Karim Labib for bringing this annotation correction to the attention of SGD.''<br><br>
 +
'''Morohashi H, et al.''' (2009) The amino-terminal TPR domain of Dia2 tethers SCF(Dia2) to the replisome progression complex. Curr Biol 19(22):1943-9. <br>
 +
[https://www.yeastgenome.org/reference/S000132241 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/19913425 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0960982209018223?via%3Dihub Full-Text] <br>
 +
|-
 +
| 2009-05-05
 +
| [https://www.yeastgenome.org/locus/ARS1512 ARS1512], [https://www.yeastgenome.org/locus/ARS1518 ARS1518] <br>
 +
The following ARS elements on Chromosome XV were added to the genome annotation based on Raveendranathan et al. 2006: ARS1512 and ARS1518.<br><br>
 +
'''Raveendranathan M, et al.''' (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39. <br>
 +
[https://www.yeastgenome.org/reference/S000117571 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16888628 PubMed] | [https://www.embopress.org/cgi/doi/10.1038/sj.emboj.7601251 Full-Text] <br>
 +
[https://www.yeastgenome.org/reference/S000132241 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/19913425 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0960982209018223?via%3Dihub Full-Text] <br>
 +
|-
 +
| 2007-07-10
 +
| [https://www.yeastgenome.org/locus/YOR312C YOR312C] <br>
 +
The start of ORF RPL20B/YOR312C was moved 13 nt upstream, and the 5' end of the intron was moved 19 nt upstream, based on GenBank EF138822, Miura et al. 2006, and Zhang et al. 2007. The ORF had been annotated as 932 nt with a 407-nt intron (174 aa), but is now 945 nt long with a 426-nt intron (172 aa).<br><br>
 +
'''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br>
 +
[https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br>
 +
'''Zhang Z, et al.''' (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9. <br>
 +
[https://www.yeastgenome.org/reference/S000121920 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17351133 PubMed] | [https://genome.cshlp.org/content/17/4/503 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=17351133&db=pmid YFGdb]<br>
 +
|-
 +
| 2007-05-10
 +
| [https://www.yeastgenome.org/locus/snR36 snR36] <br>
 +
Updated coordinates of snR36 based on Samarsky et al. 1995 and GenBank L33804. ''Old coordinates were 680997..680643 (355 nt), new coordinates are 680867..680686 (182 nt).''<br><br>
 +
'''Samarsky DA, et al.''' (1995) Characterization of three new snRNAs from Saccharomyces cerevisiae: snR34, snR35 and snR36. Nucleic Acids Res 23(13):2548-54. <br>
 +
[https://www.yeastgenome.org/reference/S000048238 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/7630735 PubMed] | [https://academic.oup.com/nar/article/23/13/2548/2400622 Full-Text]<br>
 +
|-
 +
| 2007-05-10
 +
| [https://www.yeastgenome.org/locus/snR35 snR35] <br>
 +
Updated coordinates of snR35 based on Samarsky et al. 1995 and GenBank L33803. ''Old coordinates were 759730..759191 (540 nt) and new coordinates are 759530..759327 (204 nt)''.<br><br>
 +
'''Samarsky DA, et al.''' (1995) Characterization of three new snRNAs from Saccharomyces cerevisiae: snR34, snR35 and snR36. Nucleic Acids Res 23(13):2548-54. <br>
 +
[https://www.yeastgenome.org/reference/S000048238 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/7630735 PubMed] | [https://academic.oup.com/nar/article/23/13/2548/2400622 Full-Text]<br>
 +
|-
 +
| 2007-02-07
 +
| [https://www.yeastgenome.org/locus/YOR396W YOR396W] <br>
 +
The start site for YOR396W/YRF1-8, one of several telomeric Y' element-encoded helicases, was moved 1716 bp (572 codons) upstream.
 +
The gene model of YOR396W was shorter and lacked a substantial N-terminal part when compared to the other Y' helicases encoded by the YRF1 genes, although the reading frame could be extended at the N-terminus to match the other genes without problem. The shorter gene model may have originated from Louis & Haber 1992 and the prediction found in EMBL:U23472. The strain (YP1) sequenced in this study has a frameshift at position 1520 (aa-507) disrupting the gene and producing two ORFs, one of which was the original shorter version of YOR396W used by SGD. In contrary, a later sequence submission (EMBL:Z75302) submitted on behalf of the Chromosome XV Sequencing Project does not contain this frameshift, matching the chromosomal sequence for reference strain S288C stored in SGD. ''Thank you to Ivo Pedruzzi of Swiss-Prot for bringing this annotation error to the attention of SGD.''<br><br>
 +
'''Louis EJ and Haber JE''' (1992) The structure and evolution of subtelomeric Y' repeats in Saccharomyces cerevisiae. Genetics 131(3):559-74. <br>
 +
[https://www.yeastgenome.org/reference/S000065737 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/1628806 PubMed] | [https://www.genetics.org/content/131/3/559.long Full-Text] <br>
 +
|-
 +
| 2006-10-06
 +
| [https://www.yeastgenome.org/locus/YOL126C YOL126C] <br>
 +
Based on N-terminal sequencing (Kopetzki E. et al., Minard K.I. et al) and mapping of the transcription start site (Roth S. and Schuller H.J.), the start site for MDH2/YOL126C has been moved 141 bp (47 codons) downstream. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Special thanks to Ivo Pedruzzi and the team at Swiss-prot for bringing this to our attention.<br><br>
 +
'''Minard KI and McAlister-Henn L''' (1991) Isolation, nucleotide sequence analysis, and disruption of the MDH2 gene from Saccharomyces cerevisiae: evidence for three isozymes of yeast malate dehydrogenase. Mol Cell Biol 11(1):370-80. <br>
 +
[https://www.yeastgenome.org/reference/S000039783 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/1986231 PubMed] | [https://mcb.asm.org/content/11/1/370.long Full-Text] <br>
 +
'''Roth S and Schuller HJ''' (2001) Cat8 and Sip4 mediate regulated transcriptional activation of the yeast malate dehydrogenase gene MDH2 by three carbon source-responsive promoter elements. Yeast 18(2):151-62. <br>
 +
[https://www.yeastgenome.org/reference/S000059497 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11169757 PubMed] | [https://onlinelibrary.wiley.com/doi/full/10.1002/1097-0061%2820010130%2918%3A2%3C151%3A%3AAID-YEA662%3E3.0.CO%3B2-Q Full-Text] <br>
 +
'''Ghaemmaghami S, et al.''' (2003) Global analysis of protein expression in yeast. Nature 425(6959):737-41. <br>
 +
[https://www.yeastgenome.org/reference/S000074186 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/14562106 PubMed] | [https://www.nature.com/articles/nature02046 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=14562106&db=pmid YFGdb] | [https://www.yeastgenome.org/reference/S000139820 Comments & Errata] <br>
 +
|-
 +
| 2006-10-05
 +
| [https://www.yeastgenome.org/locus/YOR173W YOR173W] <br>
 +
Based on N-terminal sequencing and mapping of the transcription start site (Malys N. et al.), the start site for DCS2/YOR173W has been moved 132 bp (44 codons) downstream. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Special thanks to Ivo Pedruzzi and the team at SwissProt for bringing this to our attention.<br><br>
 +
'''Malys N, et al.''' (2004) The 'scavenger' m7GpppX pyrophosphatase activity of Dcs1 modulates nutrient-induced responses in yeast. Nucleic Acids Res 32(12):3590-600. <br>
 +
[https://www.yeastgenome.org/reference/S000076812 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/15240832 PubMed] | [https://academic.oup.com/nar/article/32/12/3590/2375813 Full-Text] <br>
 +
|-
 +
| 2006-10-03
 +
| [https://www.yeastgenome.org/locus/YOR211C YOR211C] <br>
 +
Based on genetic analyses done by Shepard K.A. et al. (1999), the start site for MGM1/YOR211C has been moved 63 bp (21 codons) downstream. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Special thanks to Ivo Pedruzzi and the team at Swiss-Prot for bringing this change to our attention.<br><br>
 +
'''Shepard KA and Yaffe MP''' (1999) The yeast dynamin-like protein, Mgm1p, functions on the mitochondrial outer membrane to mediate mitochondrial inheritance. J Cell Biol 144(4):711-20. <br>
 +
[https://www.yeastgenome.org/reference/S000047437 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10037792 PubMed] | [http://jcb.rupress.org/content/144/4/711.long Full-Text] <br>
 +
|-
 +
| 2006-10-02
 +
| [https://www.yeastgenome.org/locus/ARS1531 ARS1531] <br>
 +
ARS1531, also known as ARS1506.5, was added to the genome annotation based on Nieduszynski et al. 2006.<br><br>
 +
'''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br>
 +
[https://www.yeastgenome.org/reference/S000117321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] | [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br>
 +
|-
 +
| 2006-09-08
 +
| [https://www.yeastgenome.org/locus/ARS1507 ARS1507], [https://www.yeastgenome.org/locus/ARS1508 ARS1508], [https://www.yeastgenome.org/locus/ARS1509 ARS1509], [https://www.yeastgenome.org/locus/ARS1510 ARS1510], [https://www.yeastgenome.org/locus/ARS1511 ARS1511], [https://www.yeastgenome.org/locus/ARS1513 ARS1513], [https://www.yeastgenome.org/locus/ARS1519 ARS1519], [https://www.yeastgenome.org/locus/ARS1521 ARS1521], [https://www.yeastgenome.org/locus/ARS1523 ARS1523], [https://www.yeastgenome.org/locus/ARS1524 ARS1524], [https://www.yeastgenome.org/locus/ARS1526 ARS1526], [https://www.yeastgenome.org/locus/ARS1528 ARS1528], [https://www.yeastgenome.org/locus/ARS1529 ARS1529] <br>
 +
The following new ARS elements on Chromosome XV were added to SGD based on Nieduszynski et al. 2006: ARS1507, ARS1508, ARS1509, ARS1510, ARS1511, ARS1513, ARS1519, ARS1521, ARS1523, ARS1524, ARS1526, ARS1528, ARS1529. <br> <br>
 +
'''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br>
 +
[https://www.yeastgenome.org/reference/S000117321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] | [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br>
 +
|-
 +
| 2006-09-08
 +
| [https://www.yeastgenome.org/locus/ARS1516 ARS1516] <br>
 +
The coordinates of ARS1516 were updated based on Nieduszynski et al. 2006.<br><br>
 +
'''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br>
 +
[https://www.yeastgenome.org/reference/S000117321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] | [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br>
 +
|-
 +
| 2006-05-11
 +
| [https://www.yeastgenome.org/locus/YOR197W YOR197W] <br>
 +
The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for MCA1/YOR197W was moved 57 nt (19 amino acids) downstream.<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
 +
|-
 +
| 2006-04-12
 +
| [https://www.yeastgenome.org/locus/ARS1516 ARS1516] <br>
 +
ARS1516, also known as "ADE2 ARS", was added to the genome annotation for Chromosome XV at coordinates 566191-566877 based on Wyrick et al. 2001 and Sasnauskas et al. 1987.<br><br>
 +
'''Sasnauskas KV, et al.''' (1987)  [Cloning of the ADE2 gene of Saccharomyces cerevisiae and localization of the ARS-sequence] Genetika 23(7):1141-8. <br>
 +
[https://www.yeastgenome.org/reference/S000048074 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/2888707 PubMed] <br>
 +
'''Wyrick JJ, et al.''' (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60. <br>
 +
[https://www.yeastgenome.org/reference/S000069019 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11743203 PubMed] | [https://science.sciencemag.org/content/294/5550/2357.long Full-Text] | [https://www.ncbi.nlm.nih.gov/pubmed/11743187 Comments & Errata]<br>
 +
|-
 +
| 2006-01-24
 +
| [https://www.yeastgenome.org/locus/snR81 snR81] <br>
 +
New snoRNA added to genome annotation (GenBank accession # AY679769).<br><br>
 +
'''Schattner P, et al.''' (2004) Genome-wide searching for pseudouridylation guide snoRNAs: analysis of the Saccharomyces cerevisiae genome. Nucleic Acids Res 32(14):4281-96. <br>
 +
[https://www.yeastgenome.org/reference/S000081218 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/15306656 PubMed] | [https://academic.oup.com/nar/article/32/14/4281/1279684 Full-Text] <br>
 +
|-
 +
| 2005-12-01
 +
| [https://www.yeastgenome.org/locus/YOR091W YOR091W] <br>
 +
Based on on 5' SAGE TSS data and multiple orthologous sequence alignments published by Zhang and Dietrich, the start site for YOR091W was moved 168 nt (56 codons) downstream.<br><br>
 +
'''Zhang Z and Dietrich FS''' (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51. <br>
 +
[https://www.yeastgenome.org/reference/S000082006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/15905473 PubMed] | [https://academic.oup.com/nar/article/33/9/2838/2401448 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=15905473&db=pmid YFGdb]<br>
 +
|-
 +
| 2005-12-01
 +
| [https://www.yeastgenome.org/locus/YOR221C YOR221C] <br>
 +
Based on multiple sequence alignments and on data published by Davis et al., the intron and first exon have been removed from this gene. This change effectively moves the MCT1/YOR221C start site 273 nts downstream, but does not alter the translation frame of this gene, resulting in a shortened, altered N-terminus.<br><br>
 +
'''Davis CA, et al.''' (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6. <br>
 +
[https://www.yeastgenome.org/reference/S000042737 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10734188 PubMed] | [https://academic.oup.com/nar/article/28/8/1700/1009222 Full-Text] <br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
|-
 +
| 2005-12-01
 +
| [https://www.yeastgenome.org/locus/YOR074C YOR074C] <br>
 +
Based on multiple sequence alignments and on data published by Taylor et al., Davis et al., and Poon et al., the intron has been removed from CDC21/YOR074C. The start codon, stop codon, and frame of translation all remain the same, but the sequence previously annotated as an intron is included in the translation.<br><br>
 +
'''Davis CA, et al.''' (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6. <br>
 +
[https://www.yeastgenome.org/reference/S000042737 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10734188 PubMed] | [https://academic.oup.com/nar/article/28/8/1700/1009222 Full-Text] <br>
 +
'''Taylor GR, et al.''' (1987) Molecular characterization of the cell cycle-regulated thymidylate synthase gene of Saccharomyces cerevisiae. J Biol Chem 262(11):5298-307. <br>
 +
[https://www.yeastgenome.org/reference/S000049320 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/3031048 PubMed] | [http://www.jbc.org/content/262/11/5298.long Full-Text] <br>
 +
'''Poon PP and Storms RK''' (1994) Thymidylate synthase is localized to the nuclear periphery in the yeast Saccharomyces cerevisiae. J Biol Chem 269(11):8341-7. <br>
 +
[https://www.yeastgenome.org/reference/S000058478 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/8132557 PubMed] | [http://www.jbc.org/content/269/11/8341.long Full-Text] <br>
 +
|-
 +
| 2005-11-30
 +
| [https://www.yeastgenome.org/locus/YOR147W YOR147W] <br>
 +
Based on on 5' SAGE TSS data and multiple orthologous sequence alignments published by Zhang and Dietrich, the start site for MDM32/YOR147W was moved 93 nt (31 codons) downstream.<br><br>
 +
'''Zhang Z and Dietrich FS''' (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51. <br>
 +
[https://www.yeastgenome.org/reference/S000082006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/15905473 PubMed] | [https://academic.oup.com/nar/article/33/9/2838/2401448 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=15905473&db=pmid YFGdb]<br>
 +
|-
 +
| 2005-11-30
 +
| [https://www.yeastgenome.org/locus/YOR330C YOR330C] <br>
 +
Based on 5' end mapping published by Francoise Foury, the start site for MIP1/YOR330C was moved 78 nt (26 codons) downstream.<br><br>
 +
'''Foury F''' (1989) Cloning and sequencing of the nuclear gene MIP1 encoding the catalytic subunit of the yeast mitochondrial DNA polymerase. J Biol Chem 264(34):20552-60. <br>
 +
[https://www.yeastgenome.org/reference/S000048961 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/2684980 PubMed] | [http://www.jbc.org/content/264/34/20552.long Full-Text] <br>
 +
|-
 +
| 2004-10-12
 +
| [https://www.yeastgenome.org/locus/CEN12 CEN12] <br>
 +
The orientation of this centromere was reversed (from Watson to Crick) to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. and Espelin et al.<br><br>
 +
'''Wieland G, et al.''' (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60. <br>
 +
[https://www.yeastgenome.org/reference/S000059647 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11222754 PubMed] | [https://academic.oup.com/nar/article/29/5/1054/2381189 Full-Text]<br>
 +
'''Espelin CW, et al.''' (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68. <br>
 +
[https://www.yeastgenome.org/reference/S000074756 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/13679521 PubMed] | [https://www.molbiolcell.org/doi/full/10.1091/mbc.e02-08-0533?url_ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed Full-Text]<br>
 +
|-
 +
| 2004-04-21
 +
| [https://www.yeastgenome.org/locus/YOR069W YOR069W] <br>
 +
Based on the automated comparison of related fungi, Cliften et al. and Brachat et al. suggest that the start site for VPS5/YOR069W be moved 1089 nt upstream, extending the 5' end of the protein an additional 363 amino acids. This suggestion was reviewed and accepted by SGD curators. Evidence supporting this change includes: (1) this is the predicted start methionine in all Saccharomyces species sequenced by Cliften et al. and/or Kellis et al. and (2) this is the start site described in literature characterizing VPS5/YOR069W (Horazdovsky BF, et al.,(1997) Mol Biol Cell. Aug; 8(8):1529-41),(Nothwehr ST, Hindes AE (1997) J Cell Sci. May;110 (Pt 9):1063-72.).<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
 +
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>
 +
|-
 +
| 2003-09-27
 +
| [https://www.yeastgenome.org/locus/YOL048C YOL048C] <br>
 +
Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 5' exon for YOL048C. Brachat et al. confirmed this intron using 5' RACE. The resulting ORF is in the same frame, but has a 236-residue extension at the N-terminus. This change was reviewed and accepted by SGD curators.<br><br>
 +
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
 +
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>
 +
|-
 +
| 2003-09-22
 +
| [https://www.yeastgenome.org/locus/YOR125C YOR125C] <br>
 +
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for CAT5/YOR125C be moved 117 nt (39 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The start site predicted previously for S. cerevisiae is not conserved in S. paradoxus (AGG), S. mikatae (AGG), and S. bayanus (AGG); 4) Insertions in S. mikatae and S. bayanus create frame shifts between the up and downstream ATGs; 5) the MitoProt (http://www.mips.biochem.mpg.de/cgi-bin/proj/medgen/mitofilter) program predicts that the shorter protein is localized to the mitochondria, which is confirmed by the literature (see for example Jonassen et al (1998) J Biol Chem 273:3351-7); the longer protein has a lower probability (.97 vs. .55) of mitochondrial localization according to the program; 6) homology to related proteins and conserved domains are downstream of the region between the two ATGs.<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>
 +
|-
 +
| 2003-09-22
 +
| [https://www.yeastgenome.org/locus/YOL096C YOL096C] <br>
 +
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for COQ3/YOL096C be moved 12 nt (4 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The start site is not conserved in the closely related species S. paradoxus (CTA), S. mikatae (TTA), or S. bayanus (CCA).<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>
 +
|-
 +
| 2003-09-22
 +
| [https://www.yeastgenome.org/locus/YOR037W YOR037W] <br>
 +
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for CYC2/YOR037W be moved 114 nt (38 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The start site predicted previously for ''S. cerevisiae'' is not conserved in ''S. paradoxus'' (GTA), ''S. mikatae'' (ATA), and ''S. bayanus'' (ATA); 4) InDels create frame shifts between the upstream start site and the proposed downstream start site; 5) The MitoProt program predicts that the shorter protein is localized to the mitochondria, which is confirmed by the literature (e.g. Dumont et al); the longer protein has a much lower probability of mitochondrial localization according to the program..<br><br>
 +
'''Dumont ME, et al.''' (1993) CYC2 encodes a factor involved in mitochondrial import of yeast cytochrome c. Mol Cell Biol 13(10):6442-51. <br>
 +
[https://www.yeastgenome.org/reference/S000040996 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/8413243 PubMed] | [https://mcb.asm.org/content/13/10/6442.long Full-Text] <br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>
 +
|-
 +
| 2003-09-22
 +
| [https://www.yeastgenome.org/locus/YOR103C YOR103C] <br>
 +
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for OST2/YOR103C be moved 9 nt (3 codons) downstream. This suggestion was reviewed by SGD curators and incorporated on September 22, 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The current start site is not conserved in ''S. paradoxus'' (ATA), ''S. mikatae'' (ACG), and ''S. bayanus'' (ACG).<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>
 +
|-
 +
| 2003-09-22
 +
| [https://www.yeastgenome.org/locus/YOL146W YOL146W] <br>
 +
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PSF3/YOL146W be moved 126 nt (42 codons) downstream. This suggestion was reviewed by SGD curators and incorporated on September 22, 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The upstream ATG is conserved in ''S. paradoxus'' and ''S. mikatae'', but insertions create stops between the two ATGs in these species. The upstream ATG (ATA in ''S. bayanus'') and the frame are not conserved in S. bayanus; 4) Protein sequence comparisons against the nr dataset at NCBI show that there is no sequence similarity between ''S. cerevisiae'' and other species between the first and the second ATG; sequence similarity begins after the second methionine. Supporting evidence for this change has also been published by Takayama et al. who showed that the originally annotated upstream start site is not conserved in the ''S. pombe'' or human genes and that the apparent molecular mass of Psf3p is more consistent with the downstream start site.<br><br>
 +
'''Takayama Y, et al.''' (2003) GINS, a novel multiprotein complex required for chromosomal DNA replication in budding yeast. Genes Dev 17(9):1153-65. <br>
 +
[https://www.yeastgenome.org/reference/S000073092 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12730134 PubMed] | [http://genesdev.cshlp.org/content/17/9/1153.long Full-Text] <br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>
 +
|-
 +
| 2003-09-22
 +
| [https://www.yeastgenome.org/locus/YOR238W YOR238W] <br>
 +
The automated comparison of closely related ''Saccharomyces'' species suggests that the start site for YOR238W be moved 9 nt (3 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>
 +
|-
 +
| 2003-09-22
 +
| [https://www.yeastgenome.org/locus/YOL103W YOL103W] <br>
 +
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for ITR2/YOL103W be moved 9 nt (3 codons) downstream. This suggestion was reviewed and accpeted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of ''Saccharomyces'' species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The upstream start site predicted previously for S. cerevisiae is not conserved in ''S. paradoxus'', ''S. mikatae'', or ''S. bayanus''.<br><br>
 +
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 +
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 +
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 +
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>
 +
|-
 +
| 2003-09-09
 +
| [https://www.yeastgenome.org/locus/TEL15L TEL15L], [https://www.yeastgenome.org/locus/TEL15R TEL15R] <br>
 +
The chromosomal locations for TEL15L, TEL15L-TR, TEL15L-XC, TEL15L-XR, TEL15R, TEL15R-TR, TEL15R-XC, TEL15R-XR, and TEL15R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).<br><br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YOL083C-A YOL083C-A], [https://www.yeastgenome.org/locus/YOL097W-A YOL097W-A], [https://www.yeastgenome.org/locus/YOL155W-A YOL155W-A], [https://www.yeastgenome.org/locus/YOR034C-A YOR034C-A], [https://www.yeastgenome.org/locus/YOR072W-B YOR072W-B], [https://www.yeastgenome.org/locus/YOR192C-C YOR192C-C], [https://www.yeastgenome.org/locus/YOR293C-A YOR293C-A] <br>
 +
Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XV ORFs: YOR072W-B, YOL083C-A, YOL097W-A, YOL155W-A, YOR034C-A, YOR192C-C, and YOR293C-A.<br><br>
 +
'''Basrai MA, et al.''' (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9. <br>
 +
[https://www.yeastgenome.org/reference/S000042214 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10490641 PubMed] | [https://mcb.asm.org/content/19/10/7041.long Full-Text] <br>
 +
'''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br>
 +
[https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br>
 +
'''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br>
 +
[https://www.yeastgenome.org/reference/S000073672 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] | [https://genome.cshlp.org/content/12/8/1210.long Full-Text] | [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YOL013W-A YOL013W-A], [https://www.yeastgenome.org/locus/YOL038C-A YOL038C-A]
 +
Thanks to [https://bioinformatik.wzw.tum.de/index.php?id=63 MIPS] for providing the coordinates of the following Chromosome XV ORFs: YOL013W-B and YOL038C-A.<br><br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YOL019W-A YOL019W-A], [https://www.yeastgenome.org/locus/YOL085W-A YOL085W-A], [https://www.yeastgenome.org/locus/YOL166W-A YOL166W-A], [https://www.yeastgenome.org/locus/YOR032W-A YOR032W-A], [https://www.yeastgenome.org/locus/YOR108C-A YOR108C-A], [https://www.yeastgenome.org/locus/YOR161C-C YOR161C-C], [https://www.yeastgenome.org/locus/YOR161W-A YOR161W-A], [https://www.yeastgenome.org/locus/YOR161W-B YOR161W-B], [https://www.yeastgenome.org/locus/YOR186C-A YOR186C-A], [https://www.yeastgenome.org/locus/YOR231C-A YOR231C-A], [https://www.yeastgenome.org/locus/YOR335W-A YOR335W-A], [https://www.yeastgenome.org/locus/YOR394C-A YOR394C-A], [https://www.yeastgenome.org/locus/YOR396C-A YOR396C-A] <br>
 +
Thanks to Kumar et al. for providing the coordinates of the following Chromosome XV ORFs: YOL019W-A, YOR394C-A, YOR396C-A, YOL166W-A, YOR032W-A, YOR108C-A, YOR161C-C, YOR161W-A, YOR161W-B, YOR186C-A, YOR231C-A, YOR335W-A, and YOL085W-A.<br><br>
 +
'''Kumar A, et al.''' (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63. <br>
 +
[https://www.yeastgenome.org/reference/S000073673 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11753363 PubMed] | [https://www.nature.com/articles/nbt0102-58 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11753363&db=pmid YFGdb] | [https://www.yeastgenome.org/reference/S000141796 Comments & Errata] <br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YOR020W-A YOR020W-A] <br>
 +
Thanks to Brachat et al. for providing the coordinates of YOR020W-A.<br><br>
 +
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
 +
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br>
 +
|-
 +
| 2003-07-29
 +
| [https://www.yeastgenome.org/locus/YOL164W-A YOL164W-A], [https://www.yeastgenome.org/locus/YOR011W-A YOR011W-A], [https://www.yeastgenome.org/locus/YOR072W-A YOR072W-A], [https://www.yeastgenome.org/locus/YOR073W-A YOR073W-A], [https://www.yeastgenome.org/locus/YOR316C-A YOR316C-A], [https://www.yeastgenome.org/locus/YOR329W-A YOR329W-A], [https://www.yeastgenome.org/locus/YOR376W-A YOR376W-A], [https://www.yeastgenome.org/locus/YOR381W-A YOR381W-A] <br>
 +
Thanks to Kessler et al. for providing the coordinates for the following Chromosome XV ORFs: YOR072W-A, YOR316C-A, YOR376W-A, YOR381W-A, YOR329W-A, YOR073W-A, YOR011W-A, and YOL164W-A.<br><br>
 +
'''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br>
 +
[https://www.yeastgenome.org/reference/S000073671 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] | [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br>
 +
|-
 +
| 2003-01-09
 +
| [https://www.yeastgenome.org/locus/YOL002C YOL002C] <br>
 +
The start site of YOL002C has been moved 30 nt downstream from 324394 to 324364. Chromosomal coordinates change from old:324394-323441 to new:324364-323411. Relative coordinates go from old:1-984 to new:1-954. Thanks to Gillian Small for reporting this sequence annotation change to SGD.<br><br>
 +
'''Karpichev IV, et al.''' (2002) Multiple regulatory roles of a novel Saccharomyces cerevisiae protein, encoded by YOL002c, in lipid and phosphate metabolism. J Biol Chem 277(22):19609-17. <br>
 +
[https://www.yeastgenome.org/reference/S000069897 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11916977 PubMed] | [http://www.jbc.org/content/277/22/19609.long Full-Text] <br>
 +
|-
 +
| 2001-03-08
 +
| [https://www.yeastgenome.org/locus/snR31 snR31] <br>
 +
Changed the orientation of SNR31 from Watson to Crick (old start coord = 841953; old stop coord = 842177; new start coord = 842177; new stop coord = 841953).<br><br>
 +
'''Dandekar T and Tollervey D''' (1993)  Identification and functional analysis of a novel yeast small nucleolar RNA. Nucleic Acids Res 21(23):5386-90. <br>
 +
[https://www.yeastgenome.org/reference/S000050561 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/8265353 PubMed] | [https://academic.oup.com/nar/article/21/23/5386/1050939 Full-Text] <br>
 +
'''Balakin AG, et al.'''  (1993) SnR31, snR32, and snR33: three novel, non-essential snRNAs from Saccharomyces cerevisiae. Nucleic Acids Res 21(23):5391-7. <br>
 +
[https://www.yeastgenome.org/reference/S000050562 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/8265354 PubMed] | [https://academic.oup.com/nar/article/21/23/5391/1050948 Full-Text] <br>
 +
|-
 +
| 2001-03-06
 +
| [https://www.yeastgenome.org/locus/ARS1502 ARS1502] <br>
 +
Courtesy of Prof. BiK Tye; based on Ph. D. thesis of Dr. Clarence Chan <br><br>
 +
|-
 +
| 2000-10-17
 +
| [https://www.yeastgenome.org/locus/ARS1501 ARS1501] <br>
 +
ARS1021 (aka ARS121) and ARS1501 were added to the genome annotation after personal communication from Shlomo Eisenberg. See Walker et al. 1991 for ARS1021 and Raychaudhuri et al. 1997 for ARS1501. <br><br>
 +
'''Raychaudhuri S, et al.''' (1997) Functional analysis of a replication origin from Saccharomyces cerevisiae: identification of a new replication enhancer. Nucleic Acids Res 25(24):5057-64. <br>
 +
[https://www.yeastgenome.org/reference/S000044083 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9396816 Full-Text] | [https://academic.oup.com/nar/article/25/24/5057/1749133 Full-Text] <br>
 +
'''Walker SS, et al.''' (1991) Analysis of the interactions of functional domains of a nuclear origin of replication from Saccharomyces cerevisiae. Nucleic Acids Res 19(22):6255-62. <br>
 +
[https://www.yeastgenome.org/reference/S000049529 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/1956786 PubMed] | [https://academic.oup.com/nar/article/19/22/6255/1015625 Full-Text] <br>
 +
|-
 +
| 2000-08-14
 +
| [https://www.yeastgenome.org/locus/YOR239W YOR239W], [https://www.yeastgenome.org/locus/YOR240W YOR240W] <br>
 +
Annotation change: it has been reported in Asakura et al. 1998 that a +1 translational frameshift merges YOR239W and YOR240W into one ORF. YOR240W is now an alias for YOR239W and YOR239W encompasses both the ORFs.<br><br>
 +
'''Asakura T, et al.''' (1998) Isolation and characterization of a novel actin filament-binding protein from Saccharomyces cerevisiae. Oncogene 16(1):121-30. <br>
 +
[https://www.yeastgenome.org/reference/S000041861 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9467951 PubMed] | [https://www.nature.com/articles/1201487 Full-Text] <br>
 +
|-
 +
| 2000-08-11
 +
| [https://www.yeastgenome.org/locus/YOL052C-A YOL052C-A] <br>
 +
Old name: YOL053C-A; new name: YOL052C-A; date: 11/1998; old coord: ChrXV 231753 231568; SGDID: S0005413; Name changed due to nomenclature <br><br>
 +
|-
 +
| 2000-07-14
 +
| [https://www.yeastgenome.org/locus/YOL047C YOL047C] <br>
 +
The annotations of the start site and 3' intron boundary of YOL047C were both changed, so that the relative coding coordinates change from 1-1..189-892 to 1-243..307-1134. Note that the stop site and the 5' boundary of the intron were not changed. ''Chromosomal coordinates for the coding region change from 242503-242503..242315-241612 to 242745-242503..242439-241612.'' <br><br>
 +
|-
 +
| 1999-07-17
 +
| [https://www.yeastgenome.org/locus/YOL075C YOL075C] <br>
 +
The start site of YOL075C was moved 597 bases upstream. ''Chromosomal coordinates change from 194944-189657 to 193541-189657.'' <br><br>
 +
|-
 +
| 1998-05-21
 +
| [https://www.yeastgenome.org/locus/YOL013W-A YOL013W-A], [https://www.yeastgenome.org/locus/YOR298C-A YOR298C-A] <br>
 +
The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. <br><br>
 +
The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD. <br><br>
 +
'''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br>
 +
[https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br>
 +
|-
 +
| 1997-07-01
 +
| [https://www.yeastgenome.org/locus/YOR304C-A YOR304C-A] <br>
 +
The original annotation of the YOR304C-A ORF was incorrect because it included one additional nucleotide past the stop codon. The stop coordinate has now been corrected so that this extra "G" nucleotide is no longer included. <br><br>
 +
 +
|}

Latest revision as of 16:14, 2 October 2019

This page lists all sequence and annotation changes that have been made to the Chromosome XV systematic reference sequence since its intial release on 1996-07-31.

  • The sequence of Chromosome XV has been updated 63 times, affecting 53 features.
  • The annotation of Chromosome XV has been updated 51 times, affecting 90 features.
  • Current and past versions can be obtained from SGD's Download site.


Sequence Changes

Date Affected Features Start Coordinate of Change End Coordinate of Change Type of Change Old Sequence New Sequence
2011-02-03 YOL138C 64173 64173 Substitution G C
61985 61985 Substitution A T
63708 63708 Substitution C T
Nucleotide change(s) in the coding region of RTC1/YOL138C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 393 is now Cysteine rather than Serine, and residue 548 is now Aspartic Acid rather than Glycine. 
New    61970    CGCATGTCTGGGCGATCCGATTATTGGTGCTGTATGGGAAGAAAGCTTTTTAAAAGTTTC  62029
                ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    61970    CGCATGTCTGGGCGAACCGATTATTGGTGCTGTATGGGAAGAAAGCTTTTTAAAAGTTTC  62029

New    63660    GTAGGTTGAAGCTCCGGTTCTACCACCTCATATGAGCCTATCTCTTGGTCAACTGAAAGT  63719
                |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    63660    GTAGGTTGAAGCTCCGGTTCTACCACCTCATATGAGCCTATCTCTTGGCCAACTGAAAGT  63719

New    64140    GCATTGGCATTGTCGCCAACAAACCAGAGGCAGCATTTACCGTCTCTACCACCTGTAGCA  64199
                ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old    64140    GCATTGGCATTGTCGCCAACAAACCAGAGGCAGGATTTACCGTCTCTACCACCTGTAGCA  64199

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOL142W 56036 56036 Substitution C G
Nucleotide change(s) in the coding region of RRP40/YOL142W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 160 is now Leucine rather than Phenylalanine. 
New    55991    CTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTGAATTTCGCACGCC  56050
                |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    55990    CTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTCAATTTCGCACGCC  56049

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOL141W 57699 57699 Substitution A T
Nucleotide change(s) in the coding region of PPM2/YOL141W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 417 is now Leucine rather than Methionine. 
New    57661    GGAGGTAGTAACCCATACAGAGTAAACGAAATATTACAGTTGAGTATACACTACGACAAA  57720
                ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old    57660    GGAGGTAGTAACCCATACAGAGTAAACGAAATATTACAGATGAGTATACACTACGACAAA  57719

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOL077C 186243 186243 Substitution A C
Nucleotide change(s) in the coding region of BRX1/YOL077C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 161 is now Glycine rather than Cysteine. 
New    186230   TTTGGTGGTACACCAAAATTATGCACTAGCAACTCCTTAATTAATTGGTAGTGTGGGGAG  186289
                ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old    186230   TTTGGTGGTACACAAAAATTATGCACTAGCAACTCCTTAATTAATTGGTAGTGTGGGGAG  1862890

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOL075C 190052 190052 Substitution CG GC
Nucleotide change(s) in the coding region of YOL075C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1164 is now Alanine rather than Arginine. 
New    190020   TTTCGAAAAATGTATTTGTCATTATACCAAGAGCTTCGCCACAACAGGTAACAATAAAGG  190079
                ||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||
Old    190020   TTTCGAAAAATGTATTTGTCATTATACCAAGACGTTCGCCACAACAGGTAACAATAAAGG  190079

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOR306C 889947 889947 Substitution G C
Nucleotide change(s) in the coding region of MCH5/YOR306C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 495 is now Cysteine rather than Serine. 
New    889913   ATGTAGCAAACAGCGCTTACAAAAGTTGCCAAACCGCAAAAAATAATATAGTGTTGGTAA  889972
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old    889911   ATGTAGCAAACAGCGCTTACAAAAGTTGCCAAACCGGAAAAAATAATATAGTGTTGGTAA  889970

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOR149C 611036 611036 Substitution A G
611023 611024 Substitution GC TG
Nucleotide change(s) in the coding region of SMP3/YOR149C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 122-123 are now IK rather than MQ. 
New    610993   TACGTAAGAAGTTAAAAGTAGACTTTTTTTGATGAATTGTACGGCCTTTCTCTCATCCCT  611052
                |||||||||||||||||||||||||||||  ||||||||||| |||||||||||||||||
Old    610994   TACGTAAGAAGTTAAAAGTAGACTTTTTTGCATGAATTGTACAGCCTTTCTCTCATCCCT  611053

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOR140W 588363 588365 Substitution GCG AGC
588344 588344 Deletion C
588318 588318 Insertion T
Nucleotide change(s) in the coding region of SFL1/YOR140W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 446-462 are now FVQYQPQSQQHVTYAKQ rather than LYNTNRSRNQHVTYASE. 
New    588314   TTTTTGTACAATACCAACCGCAGTCGCAAC-AACATGTGACTTATGCGAAGCAACCGGCA  588372
                |||| ||||||||||||||||||||||||| ||||||||||||||||||   ||||||||
Old    588315   TTTT-GTACAATACCAACCGCAGTCGCAACCAACATGTGACTTATGCGAGCGAACCGGCA  588373

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOL058W 220195 220195 Deletion T
220207 220207 Insertion C
Nucleotide change(s) in the coding region of ARG1/YOL058W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 329-332 are now SYFT rather than FLLH. 
New    220179   TTGATATATAACGGTT-CCTACTTCACCCCAGAGTGTGAGTACATCAGATCTATGATCCA  220238
                |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||
Old    220179   TTGATATATAACGGTTTCCTACTTCACCC-AGAGTGTGAGTACATCAGATCTATGATCCA  220237

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOR130C 570495 570495 Substitution A G
Nucleotide change(s) in the coding region of ORT1/YOR130C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 105 is now Serine rather than Phenylalanine. 
New    570474   TCAGGATTTGCCCCAACGGGGAAACGTTTGTATGTTTTTCTAAAAATTTAGAACATTGGT  570533
                |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Old    570475   TCAGGATTTGCCCCAACGGGAAAACGTTTGTATGTTTTTCTAAAAATTTAGAACATTGGT  570534

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOR297C 874911 874911 Substitution C T
Nucleotide change(s) in the coding region of TIM18/YOR297C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 137 is now Glutamic Acid rather than Glycine. 
New    874863   TCCTCCATAGAGGCAATAAAGGGCGAGCTTATGCCATCTTGGATACTTTTCCTTCGGTAT  874922
                ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    874862   TCCTCCATAGAGGCAATAAAGGGCGAGCTTATGCCATCTTGGATACTTTCCCTTCGGTAT  874921

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOL022C 280393 280393 Substitution A G
A single nucleotide substitution was made within ORF TSR4/YOL022C. Note that the protein sequence was not changed. 
New    280377   GGTACCCCATTCCATGCCGTTATCGACAGACACTACTTCTTCCAGATCAAAAATCATCTT  280436
                ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    280378   GGTACCCCATTCCATACCGTTATCGACAGACACTACTTCTTCCAGATCAAAAATCATCTT  280437

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOR255W, YOR256C 808197 808197 Insertion A
A single nucleotide insertion was made in the intergenic region between ORFs OSW1/YOR255W and TRE2/YOR256C. 
New    808183   TTACATAATTAAAGAAAAAATTTTATTAACATACTTCCTTATACTTACAATATGTATTCT  808242
                |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Old    808184   TTACATAATTAAAG-AAAAATTTTATTAACATACTTCCTTATACTTACAATATGTATTCT  808242

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOR298C-A, YOR299W 877795 877795 Insertion G
A single nucleotide insertion was made in the intergenic region between ORFs MBF1/YOR298C-A and BUD7/YOR299W. 
New    877783   CTATTATTGGTTAAGCGACAGGCGCCTTTCCAGCTACCTAATATATACCACCACCGTCAA  877842
                |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Old    877782   CTATTATTGGTTAA-CGACAGGCGCCTTTCCAGCTACCTAATATATACCACCACCGTCAA  877840

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 ARS1531 35765 35765 Substitution G C
A single nucleotide substitution was made within ARS1531. 
New    35751    TTTTCAAAATCCGCGCAAAATTATAGAATTCATCATATATAATGAAGGAACTGTGTTCCT  35810
                ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    35750    TTTTCAAAATCCGCGGAAAATTATAGAATTCATCATATATAATGAAGGAACTGTGTTCCT  35809

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2004-01-23 ARS1531, YOL152W 36149 36149 Substitution G A
36119 36119 Substitution G C
36056 36056 Substitution G A
36013 36013 Substitution T A
Four separate single nucleotide substitutions were made in the intergenic region between ARS1531 and ORF FRE7/YOL152W. 
New    36001    AAAACTTGAGAATAACATAACCCTTTAATAGGCCAATGCAACTGATAGAACACCAGAAAA  36060
                ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||
Old    36000    AAAACTTGAGAATTACATAACCCTTTAATAGGCCAATGCAACTGATAGAACACCAGGAAA  36059
New    36061    AGTTGTAATGCCAGTGCGGCTGAACAGAATCTGTGGTAATAGATTTCGGGTATAATGCGC  36120
                |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    36060    AGTTGTAATGCCAGTGCGGCTGAACAGAATCTGTGGTAATAGATTTCGGGTATAATGCGG  36119
New    36121    AAATTAGGAATACTCATATGTTCAGATAGAATAAATAATAAAGAGACCTTCAACATAAAA  36180
                ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Old    36120    AAATTAGGAATACTCATATGTTCAGATAGGATAAATAATAAAGAGACCTTCAACATAAAA  36179

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOR256C 809751 809751 Substitution C T
A single nucleotide substitution was made within ORF TRE2/YOR256C. Note that the protein sequence was not changed. 
New    809693   GTCTATATTCTCACCATATGGCTCAGATATGAAGATTACAGCTTTAGCTCCGAATTTCTC  809762
                |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    809693   GTCTATATTCTCACCATATGGCTCAGATATGAAGATTACAGCTTTAGCCCCGAATTTCTC  809762

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOL125W 84121 84121 Substitution T C
A single nucleotide substitution was made within ORF TRM13/YOL125W. 
New    84110    AAAAAATGCAACAAGACCAAACTAAGCCATTTAAACGATGATAAGCCATACTATGAACCG  84169
                ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old    84110    AAAAAATGCAATAAGACCAAACTAAGCCATTTAAACGATGATAAGCCATACTATGAACCG  84169

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOL058W, YOL059W 219000 219000 Insertion G
A single nucleotide insertion was made in the intergenic region between ORFs GPD2/YOL059W and ARG1/YOL058W. 
New    218990   ATGACTGCGTAGCGGCAGATAGTGTAATCTGAGCAGTTGCGAGACCCAGACTGGCACTGT  219049
                ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old    218990   ATGACTGCGTA-CGGCAGATAGTGTAATCTGAGCAGTTGCGAGACCCAGACTGGCACTGT  219048

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOL036W, snR50 259235 259235 Deletion A
259230 259230 Deletion T
Two single nucleotide deletions were made in the intergenic region between ORF YOL036W and snoRNA SNR50. 
New    259199   ATTAGGATGGTAGCCCTACCTTTTTTTTTTTT-GGCA-CACATGGTCAACTTTTCTTCTC  259256
                |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||
Old    259198   ATTAGGATGGTAGCCCTACCTTTTTTTTTTTTTGGCAACACATGGTCAACTTTTCTTCTC  259257

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOR106W, YOR107W 521099 521099 Deletion C
521071 521071 Insertion A
A single nucleotide insertion and a single nucleotide deletion were made in the intergenic region between ORFs VAM3/YOR106W and RGS2/YOR107W. 
New    521055   TGGAGATGAAAAAAAAACTTGCTGAATAAAGATAGTTAAGGCGC-TAGTAATCAAATTAA  521113
                |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||
Old    521056   TGGAGATGAAAAAAAA-CTTGCTGAATAAAGATAGTTAAGGCGCCTAGTAATCAAATTAA  521114

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOR090C, YOR091W 492979 492979 Insertion T
A single nucleotide insertion was made in the intergenic region between ORFs PTC5/YOR090C and TMA46/YOR091W. 
New    492955   TACCCTCCAATCGATCCTTTTTTTCTTTTTTGTATCTTGTGTAGAAAGAAGTGAATCCTG  493014
                ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old    492957   TACCCTCCAATCGATCCTTTTTT-CTTTTTTGTATCTTGTGTAGAAAGAAGTGAATCCTG  493015

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOL145C 52199 52199 Substitution C T
50767 50767 Substitution C T
50430 50431 Substitution GG CC
50081 50081 Substitution T C
50069 50069 Substitution G T
49941 49941 Substitution G T
49922 49922 Substitution T A
49919 49919 Substitution A T
49912 49912 Substitution A T
49829 49829 Substitution G T
Several nucleotide changes were made in the coding region of CTR9/YOL145C, resulting in an altered protein sequence. The start, stop, and reading frame remain the same, but with the following changes: Gly197->Lys, Gly674->Glu, Thr786->Arg, Lys903->Glu, Arg907->Ser, residues 956-959 are now LIQE not IFQV, and Glu987->Lys. 
New    49811    GTCTTGGCTTTTCTTCGTCATATTCATTGTCTTTATCAGACAGATCTGAA  49870
                ||||||||| ||||||||||||||||||||||||||||||||||||||||
Old    49820    GTCTTGGCTGTTCTTCGTCATATTCATTGTCTTTATCAGACAGATCTGAA  49869
New    49871    TCATCTTTAACATTATGTTCACTTATGGCCATGGCTTCTCGCTCCTGGAT  49920
                |||||||||||||||||||||||||||||||||||||||||| ||||||
Old    49870    TCATCTTTAACATTATGTTCACTTATGGCCATGGCTTCTCGCACCTGGAA  49919
New    49921    TAACTTTTGTGCCTCATCTTGTAGTTTCCTATACTCCTCTGCCTGTTTTT  49970
                || |||||||||||||||||| ||||||||||||||||||||||||||||
Old    49920    TATCTTTTGTGCCTCATCTTGGAGTTTCCTATACTCCTCTGCCTGTTTTT  49969
New    50041    AATTTTACGTGCTTCATCAATTTTGGCGCTTTGTTCCTTCTCAAATTCTT  50090
                ||||||||||||||||||||||||||||| ||||||||||| ||||||||
Old    50040    AATTTTACGTGCTTCATCAATTTTGGCGCGTTGTTCCTTCTTAAATTCTT  50089
New    50401    TTCCAAGGCTTTTTGATAAAAATTCACAGACCTTTCCTTAATGGCACGTG  50450
                ||||||||||||||||||||||||||||||  ||||||||||||||||||
Old    50400    TTCCAAGGCTTTTTGATAAAAATTCACAGAGGTTTCCTTAATGGCACGTG  50449
New    50761    TGATTTTTCCTGTTCCTTTGGATTCCTGGACTTTTTACCGTCTCTGGCAA  50810
                ||||||| ||||||||||||||||||||||||||||||||||||||||||
Old    50760    TGATTTTCCCTGTTCCTTTGGATTCCTGGACTTTTTACCGTCTCTGGCAA  50809
New    52161    GCAATTCTTGAAAAATTTTCAGACTGGCCATATAATTTTTCTTCTGATAA  52210
                ||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    52160    GCAATTCTTGAAAAATTTTCAGACTGGCCATATAATTTTCCTTCTGATAA  52209

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOL140W, YOL141W 58601 58601 Substitution C G
58558 58558 Deletion T
A single nucleotide deletion and a single nucleotide substitution were made in the intergenic region between ORFs PPM2/YOL141W and ARG8/YOL140W. 
New    58550    GGATTCGA-ATGGTTGCCAGCTCGCTATGTGACTCACTTAAAGTACATGATGCGTCATTG  58609
                ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Old    58550    GGATTCGATATGGTTGCCAGCTCGCTATGTGACTCACTTAAAGTACATGATCCGTCATTG  58609

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOL139C, YOL140W 60173 60173 Substitution A G
A single nucleotide substitution was made in the intergenic region between ORFs ARG8/YOL140W and CDC33/YOL139C. 
New    60130    CTTACGTGATATGTACATGTGGTGCGTCTTTCATACCTTGAATGATATAATTAATAAGAG  60189
                ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old    60130    CTTACGTGATATGTACATGTGGTGCGTCTTTCATACCTTGAATAATATAATTAATAAGAG  60189

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOL135C, YOL136C 69084 69084 Substitution C T
A single nucleotide substitution was made in the intergenic region between ORFs PFK27/YOL136C and MED7/YOL135C. 
New    69060    AACCGAGTAATCCAATTTACTTTTTCTACTTTTTTTTCATTATCAATCGATTCAGATGCC  69119
                |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old    69060    AACCGAGTAATCCAATTTACTTTTCCTACTTTTTTTTCATTATCAATCGATTCAGATGCC  69119

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOR008C-A, YOR008W-B 343142 343142 Insertion A
A single nucleotide insertion was made in the intergenic region between ORFs YOR008C-A and YOR008W-B. 
New    343127   GAAGTATGTAAAAAAATTACACACCATTAAGTTCTTATGTAAACCGAAGTCTGGAAGAGA  343186
                ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    343128   GAAGTATGTAAAAAA-TTACACACCATTAAGTTCTTATGTAAACCGAAGTCTGGAAGAGA  343186

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOR261C, YOR262W 816959 816959 Insertion T
A single nucleotide insertion was made in the intergenic region between ORFs RPN8/YOR261C and YOR262W. 
New    816943   TTTCCTTTCTTTCTTTCTTTTTTTAAATTCGAAAAATGCCCTCAATCAGTAGCAGTTGTA  817002
                ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old    816943   TTTCCTTTCTTTCTTTC-TTTTTTAAATTCGAAAAATGCCCTCAATCAGTAGCAGTTGTA  817001

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOL076W, YOL077C 186978 186979 Substitution CG GC
A single nucleotide substitution was made in the intergenic region between ORFs BRX1/YOL077C and MDM20/YOL076W. 
New    186960   ACAGAATTCATTGGCGAAGCAACGATACATAACGAGCTCGGTACAGCAATCATCGCATCG  187019
                ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||
Old    186960   ACAGAATTCATTGGCGAACGAACGATACATAACGAGCTCGGTACAGCAATCATCGCATCG  187019

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOL062C, YOL063C 210486 210487 Substitution AC CA
210453 210454 Substitution AC CA
Two separate dinucleotide substitutions were made in the intergenic region between ORFs CRT10/YOL063C and APM4/YOL062C. 
New    210440   TTAACAAAATGTGCATTCTAAAGGAAATTACTATAAAAAATACAGGCATGATAAAAATAT  210499
                |||||||||||||  |||||||||||||||||||||||||||||||  ||||||||||||
Old    210440   TTAACAAAATGTGACTTCTAAAGGAAATTACTATAAAAAATACAGGACTGATAAAAATAT  210499

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOR306C, YOR307C 892173 892173 Insertion C
A single nucleotide insertion was made in the intergenic region between ORFs MCH5/YOR306C and SLY41/YOR307C. 
New    892133   TTTCTCTCAACCTTTCGAGTACTTGGAAAAAGGAGTAGATCCGCTTTCAGCAATCGAAGC  892192
                ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old    892131   TTTCTCTCAACCTTTCGAGTACTTGGAAAAAGGAGTAGATCCG-TTTCAGCAATCGAAGC  892189

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOR354C, YOR355W 1004737 1004737 Deletion T
A single nucleotide deletion was made in the intergenic region between ORFs MSC6/YOR354C and GDS1/YOR355W. 
New    1004693  TCAGCATTCCATTATTGAAGGCTTTAAAATAATAGTTTCTTTTTTCC-TATTATTTTATT  1004751
                ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    1004690  TCAGCATTCCATTATTGAAGGCTTTAAAATAATAGTTTCTTTTTTCCTTATTATTTTATT  1004749

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOR045W, YOR046C 414326 414326 Deletion T
A single nucleotide deletion was made in the intergenic region between ORFs TOM6/YOR045W and DBP5/YOR046C. 
New    414297   ATATGCTGTGTTTGTATTTATATAAGCTT-GCCTCACAAGTAAAAGTGGATCAACAAACT  414355
                ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Old    414297   ATATGCTGTGTTTGTATTTATATAAGCTTTGCCTCACAAGTAAAAGTGGATCAACAAACT  414356

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOL163W, YOL164W 8476 8476 Insertion T
A single nucleotide insertion was made in the intergenic region between ORFs BDS1/YOL164W and YOL163W. 
New    8461     AGAGCTTTTCGTATATTCTGTTTTCCTAATAACATTTACTATTGTGAATTGAAATTTAAA  8520
                |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old    8461     AGAGCTTTTCGTATAT-CTGTTTTCCTAATAACATTTACTATTGTGAATTGAAATTTAAA  8519

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2011-02-03 YOR049C, YOR050C 423752 423752 Deletion T
A single nucleotide deletion was made in the intergenic region between ORFs RSB1/YOR049C and YOR050C. 
New    423716   CGAAGGTTCGGTACCATACCACCATAAAGGGAATT-ACTGTTAGCTGCTGCTTCTAACTG  423774
                ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Old    423717   CGAAGGTTCGGTACCATACCACCATAAAGGGAATTTACTGTTAGCTGCTGCTTCTAACTG  423776

Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD paper | PubMed | Full-Text

2006-01-05 YOL152W 42535 42535 Insertion G
A sequencing error was demonstrated in BY4741 (a derivative of S288C) by Mark Rinnerthaler and Michael Breitenbach, and SGD has updated the sequence accordingly. As a consequence of this change, the stop codon has been moved 27 nts upstream, shortening the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 629 to 620 amino acids. (Personal communication from MIPS, Mark Rinnerthaler and Michael Breitenbach) 
New: 42507 AAGGTATACCGTCGGAAATTCCGTGGCAGGTTTACAGGCC 42546
           ||||||||||||||||||||||||||||| ||||||||||
Old: 42507 AAGGTATACCGTCGGAAATTCCGTGGCAG-TTTACAGGCC 42545
2006-01-05 YOR252W 803745 803745 Insertion G
SGD confirmed the sequence error predicted by the work of Kellis, et al, and have updated the systematic sequence accordingly. 
New: 803730 ACGGTTCATCCGAAGGGTAGAAAGTATGAAAAGCT 803764
            |||||||||||||||| ||||||||||||||||||
Old: 803730 ACGGTTCATCCGAAGG-TAGAAAGTATGAAAAGCT 803763

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata

2004-02-13 YOR298C-A 877622 877622 Insertion GC
Two nucleotides GC were inserted after the G at coordinate 877622 in what had previously been annotated as the intergenic region between YOR298C-A and YOR299W. This region is now part of YOR298C-A, as the start for this ORF was moved 279 bp upstream from 877403 to 877682 (note that YOR298C-A is encoded on the Crick strand). As a result, YOR298C-Ap was increased from 58 aa to 151 aa. See Brachat et al. 2003 and GenBank AY260886. This change was also predicted by Kellis et al. and Cliften et al. 
Query:    361 AATTTGGCCTTGAGATCTGGCAACGTTGGCCCTTGGGCCAGAACCACCAGCTCTTGCTCT 420              
              ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||
Sbjct: 877587 AATTTGGCCTTGAGATCTGGCAACGTTGGCCCTTGG--CAGAACCACCAGCTCTTGCTCT 877644

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-01-09 YOR087W, YOR088W 488439 488439 Insertion T
Due to the insertion of a T after the A at 488439 on chromosome 15, YOR087W and YOR088W have been merged to one single ORF - YVC1/YOR087W, with YOR088W as an alias. The old chromosomal coordinates for YOR087W were 487708-488451, and for YOR088W were 488286-489734. The new chromosomal coordinates for the fused ORF are 487708-489735. The old relative coordinates for YOR087W were 1-744, and for YOR088W were 1-1449. The new relative coordinates for the fused ORF are 1-2028.

Denis V and Cyert MS (2002) Internal Ca(2+) release in yeast is triggered by hypertonic shock and mediated by a TRP channel homologue. J Cell Biol 156(1):29-34.
SGD paper | PubMed | Full-Text
Palmer CP, et al. (2001) A TRP homolog in Saccharomyces cerevisiae forms an intracellular Ca(2+)-permeable channel in the yeast vacuolar membrane. Proc Natl Acad Sci U S A 98(14):7801-5.
SGD paper | PubMed | Full-Text
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata

2001-05-31 YOR068C, YOR069W 453804 453804 Insertion G
Inserted one G nucleotide after the G at chromosomal coordinate 453805, in the intergenic region to the left of overlapping ORFs YOR068C and YOR068W: 
Old: 453752 ATCCTGCAATAACAAGCCATGGACTACGAGGATAATCTAGAAGCACCTGTTTGG-ACGAA 453810
            |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
New: 453752 ATCCTGCAATAACAAGCCATGGACTACGAGGATAATCTAGAAGCACCTGTTTGGGACGAA 453811
1997-08-11 YOL025W 276609 276609 Substitution G A
A single nucleotide substitution was made in the systematic sequence in the region covering the ORF LAG2/YOL025W. The G at 276609 was changed to an A. 
New: 276601 AAAGCAGGAAATTTTACCCAAAAAATTGATGAAGGAGTGACCTTAAGAACAATGATTCTT 276660
            |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Old: 276601 AAAGCAGGGAATTTTACCCAAAAAATTGATGAAGGAGTGACCTTAAGAACAATGATTCTT 276660



Annotation Changes without sequence changes

Date Affected Features
2014-11-19 ARS1501, ARS1507, ARS1508, ARS1509, ARS1513, ARS1519, ARS1523, ARS1526

The chromosomal coordinates of the following ARS elements on Chromosome XV were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1507, ARS1508, ARS1509, ARS1513, ARS1501, ARS1519, ARS1523, ARS1526.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704.
SGD paper | PubMed | Full-Text

2014-11-19 ARS1501, ARS1507, ARS1508, ARS1509, ARS1510, ARS1511, ARS1521, ARS1524, ARS1528, ARS1531

As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome XV based on Liachko et al. 2013: ARS1531, ARS1507, ARS1508, ARS1509, ARS1510, ARS1511, ARS1501, ARS1521, ARS1524, ARS1528.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704.
SGD paper | PubMed | Full-Text

2014-11-19 YOR031W

The feature_type annotation of CRS5/YOR031W was changed from ORF to blocked_reading_frame (SO:0000718) as part of SGD's genome annotation revision R64.2.

2014-11-19 YOL153C

The feature_type annotation of YOL153C was changed from pseudogene to blocked_reading_frame (SO:0000718) as part of SGD's genome annotation revision R64.2.

2014-11-18 ETC2, ETC7

The following previously unmapped features were identified as nuclear matrix attachment sites and assigned chromosomal coordinates based on Hiraga et al. 2012 as part of SGD's genome annotation revision R64.2: ETC1, ETC2, ETC3, ETC4, ETC6, ETC7, ETC8.

Hiraga SI, et al. (2012) TFIIIC localizes budding yeast ETC sites to the nuclear periphery. Mol Biol Cell 23(14):2741-54.
SGD paper | PubMed | Full-Text

2010-01-05 YOR080W

The annotated start ATG of ORF YOR080W/DIA2 has been moved to Met15, based on Morohashi et al. 2009. Old chromosomal coordinates were 474554..476794; the new chromosomal coordinates are 474596..476794. Thanks to Karim Labib for bringing this annotation correction to the attention of SGD.

Morohashi H, et al. (2009) The amino-terminal TPR domain of Dia2 tethers SCF(Dia2) to the replisome progression complex. Curr Biol 19(22):1943-9.
SGD paper | PubMed | Full-Text

2009-05-05 ARS1512, ARS1518

The following ARS elements on Chromosome XV were added to the genome annotation based on Raveendranathan et al. 2006: ARS1512 and ARS1518.

Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39.
SGD paper | PubMed | Full-Text
SGD paper | PubMed | Full-Text

2007-07-10 YOR312C

The start of ORF RPL20B/YOR312C was moved 13 nt upstream, and the 5' end of the intron was moved 19 nt upstream, based on GenBank EF138822, Miura et al. 2006, and Zhang et al. 2007. The ORF had been annotated as 932 nt with a 407-nt intron (174 aa), but is now 945 nt long with a 426-nt intron (172 aa).

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51.
SGD paper | PubMed | Full-Text
Zhang Z, et al. (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9.
SGD paper | PubMed | Full-Text | YFGdb

2007-05-10 snR36

Updated coordinates of snR36 based on Samarsky et al. 1995 and GenBank L33804. Old coordinates were 680997..680643 (355 nt), new coordinates are 680867..680686 (182 nt).

Samarsky DA, et al. (1995) Characterization of three new snRNAs from Saccharomyces cerevisiae: snR34, snR35 and snR36. Nucleic Acids Res 23(13):2548-54.
SGD paper | PubMed | Full-Text

2007-05-10 snR35

Updated coordinates of snR35 based on Samarsky et al. 1995 and GenBank L33803. Old coordinates were 759730..759191 (540 nt) and new coordinates are 759530..759327 (204 nt).

Samarsky DA, et al. (1995) Characterization of three new snRNAs from Saccharomyces cerevisiae: snR34, snR35 and snR36. Nucleic Acids Res 23(13):2548-54.
SGD paper | PubMed | Full-Text

2007-02-07 YOR396W

The start site for YOR396W/YRF1-8, one of several telomeric Y' element-encoded helicases, was moved 1716 bp (572 codons) upstream. The gene model of YOR396W was shorter and lacked a substantial N-terminal part when compared to the other Y' helicases encoded by the YRF1 genes, although the reading frame could be extended at the N-terminus to match the other genes without problem. The shorter gene model may have originated from Louis & Haber 1992 and the prediction found in EMBL:U23472. The strain (YP1) sequenced in this study has a frameshift at position 1520 (aa-507) disrupting the gene and producing two ORFs, one of which was the original shorter version of YOR396W used by SGD. In contrary, a later sequence submission (EMBL:Z75302) submitted on behalf of the Chromosome XV Sequencing Project does not contain this frameshift, matching the chromosomal sequence for reference strain S288C stored in SGD. Thank you to Ivo Pedruzzi of Swiss-Prot for bringing this annotation error to the attention of SGD.

Louis EJ and Haber JE (1992) The structure and evolution of subtelomeric Y' repeats in Saccharomyces cerevisiae. Genetics 131(3):559-74.
SGD paper | PubMed | Full-Text

2006-10-06 YOL126C

Based on N-terminal sequencing (Kopetzki E. et al., Minard K.I. et al) and mapping of the transcription start site (Roth S. and Schuller H.J.), the start site for MDH2/YOL126C has been moved 141 bp (47 codons) downstream. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Special thanks to Ivo Pedruzzi and the team at Swiss-prot for bringing this to our attention.

Minard KI and McAlister-Henn L (1991) Isolation, nucleotide sequence analysis, and disruption of the MDH2 gene from Saccharomyces cerevisiae: evidence for three isozymes of yeast malate dehydrogenase. Mol Cell Biol 11(1):370-80.
SGD paper | PubMed | Full-Text
Roth S and Schuller HJ (2001) Cat8 and Sip4 mediate regulated transcriptional activation of the yeast malate dehydrogenase gene MDH2 by three carbon source-responsive promoter elements. Yeast 18(2):151-62.
SGD paper | PubMed | Full-Text
Ghaemmaghami S, et al. (2003) Global analysis of protein expression in yeast. Nature 425(6959):737-41.
SGD paper | PubMed | Full-Text | YFGdb | Comments & Errata

2006-10-05 YOR173W

Based on N-terminal sequencing and mapping of the transcription start site (Malys N. et al.), the start site for DCS2/YOR173W has been moved 132 bp (44 codons) downstream. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Special thanks to Ivo Pedruzzi and the team at SwissProt for bringing this to our attention.

Malys N, et al. (2004) The 'scavenger' m7GpppX pyrophosphatase activity of Dcs1 modulates nutrient-induced responses in yeast. Nucleic Acids Res 32(12):3590-600.
SGD paper | PubMed | Full-Text

2006-10-03 YOR211C

Based on genetic analyses done by Shepard K.A. et al. (1999), the start site for MGM1/YOR211C has been moved 63 bp (21 codons) downstream. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Special thanks to Ivo Pedruzzi and the team at Swiss-Prot for bringing this change to our attention.

Shepard KA and Yaffe MP (1999) The yeast dynamin-like protein, Mgm1p, functions on the mitochondrial outer membrane to mediate mitochondrial inheritance. J Cell Biol 144(4):711-20.
SGD paper | PubMed | Full-Text

2006-10-02 ARS1531

ARS1531, also known as ARS1506.5, was added to the genome annotation based on Nieduszynski et al. 2006.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9.
SGD paper | PubMed | Full-Text | Web Supplement

2006-09-08 ARS1507, ARS1508, ARS1509, ARS1510, ARS1511, ARS1513, ARS1519, ARS1521, ARS1523, ARS1524, ARS1526, ARS1528, ARS1529

The following new ARS elements on Chromosome XV were added to SGD based on Nieduszynski et al. 2006: ARS1507, ARS1508, ARS1509, ARS1510, ARS1511, ARS1513, ARS1519, ARS1521, ARS1523, ARS1524, ARS1526, ARS1528, ARS1529.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9.
SGD paper | PubMed | Full-Text | Web Supplement

2006-09-08 ARS1516

The coordinates of ARS1516 were updated based on Nieduszynski et al. 2006.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9.
SGD paper | PubMed | Full-Text | Web Supplement

2006-05-11 YOR197W

The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for MCA1/YOR197W was moved 57 nt (19 amino acids) downstream.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2006-04-12 ARS1516

ARS1516, also known as "ADE2 ARS", was added to the genome annotation for Chromosome XV at coordinates 566191-566877 based on Wyrick et al. 2001 and Sasnauskas et al. 1987.

Sasnauskas KV, et al. (1987) [Cloning of the ADE2 gene of Saccharomyces cerevisiae and localization of the ARS-sequence] Genetika 23(7):1141-8.
SGD paper | PubMed
Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60.
SGD paper | PubMed | Full-Text | Comments & Errata

2006-01-24 snR81

New snoRNA added to genome annotation (GenBank accession # AY679769).

Schattner P, et al. (2004) Genome-wide searching for pseudouridylation guide snoRNAs: analysis of the Saccharomyces cerevisiae genome. Nucleic Acids Res 32(14):4281-96.
SGD paper | PubMed | Full-Text

2005-12-01 YOR091W

Based on on 5' SAGE TSS data and multiple orthologous sequence alignments published by Zhang and Dietrich, the start site for YOR091W was moved 168 nt (56 codons) downstream.

Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51.
SGD paper | PubMed | Full-Text | YFGdb

2005-12-01 YOR221C

Based on multiple sequence alignments and on data published by Davis et al., the intron and first exon have been removed from this gene. This change effectively moves the MCT1/YOR221C start site 273 nts downstream, but does not alter the translation frame of this gene, resulting in a shortened, altered N-terminus.

Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6.
SGD paper | PubMed | Full-Text
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata

2005-12-01 YOR074C

Based on multiple sequence alignments and on data published by Taylor et al., Davis et al., and Poon et al., the intron has been removed from CDC21/YOR074C. The start codon, stop codon, and frame of translation all remain the same, but the sequence previously annotated as an intron is included in the translation.

Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6.
SGD paper | PubMed | Full-Text
Taylor GR, et al. (1987) Molecular characterization of the cell cycle-regulated thymidylate synthase gene of Saccharomyces cerevisiae. J Biol Chem 262(11):5298-307.
SGD paper | PubMed | Full-Text
Poon PP and Storms RK (1994) Thymidylate synthase is localized to the nuclear periphery in the yeast Saccharomyces cerevisiae. J Biol Chem 269(11):8341-7.
SGD paper | PubMed | Full-Text

2005-11-30 YOR147W

Based on on 5' SAGE TSS data and multiple orthologous sequence alignments published by Zhang and Dietrich, the start site for MDM32/YOR147W was moved 93 nt (31 codons) downstream.

Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51.
SGD paper | PubMed | Full-Text | YFGdb

2005-11-30 YOR330C

Based on 5' end mapping published by Francoise Foury, the start site for MIP1/YOR330C was moved 78 nt (26 codons) downstream.

Foury F (1989) Cloning and sequencing of the nuclear gene MIP1 encoding the catalytic subunit of the yeast mitochondrial DNA polymerase. J Biol Chem 264(34):20552-60.
SGD paper | PubMed | Full-Text

2004-10-12 CEN12

The orientation of this centromere was reversed (from Watson to Crick) to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. and Espelin et al.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60.
SGD paper | PubMed | Full-Text
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68.
SGD paper | PubMed | Full-Text

2004-04-21 YOR069W

Based on the automated comparison of related fungi, Cliften et al. and Brachat et al. suggest that the start site for VPS5/YOR069W be moved 1089 nt upstream, extending the 5' end of the protein an additional 363 amino acids. This suggestion was reviewed and accepted by SGD curators. Evidence supporting this change includes: (1) this is the predicted start methionine in all Saccharomyces species sequenced by Cliften et al. and/or Kellis et al. and (2) this is the start site described in literature characterizing VPS5/YOR069W (Horazdovsky BF, et al.,(1997) Mol Biol Cell. Aug; 8(8):1529-41),(Nothwehr ST, Hindes AE (1997) J Cell Sci. May;110 (Pt 9):1063-72.).

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-27 YOL048C

Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 5' exon for YOL048C. Brachat et al. confirmed this intron using 5' RACE. The resulting ORF is in the same frame, but has a 236-residue extension at the N-terminus. This change was reviewed and accepted by SGD curators.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YOR125C

Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for CAT5/YOR125C be moved 117 nt (39 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The start site predicted previously for S. cerevisiae is not conserved in S. paradoxus (AGG), S. mikatae (AGG), and S. bayanus (AGG); 4) Insertions in S. mikatae and S. bayanus create frame shifts between the up and downstream ATGs; 5) the MitoProt (http://www.mips.biochem.mpg.de/cgi-bin/proj/medgen/mitofilter) program predicts that the shorter protein is localized to the mitochondria, which is confirmed by the literature (see for example Jonassen et al (1998) J Biol Chem 273:3351-7); the longer protein has a lower probability (.97 vs. .55) of mitochondrial localization according to the program; 6) homology to related proteins and conserved domains are downstream of the region between the two ATGs.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YOL096C

Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for COQ3/YOL096C be moved 12 nt (4 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The start site is not conserved in the closely related species S. paradoxus (CTA), S. mikatae (TTA), or S. bayanus (CCA).

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YOR037W

Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for CYC2/YOR037W be moved 114 nt (38 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The start site predicted previously for S. cerevisiae is not conserved in S. paradoxus (GTA), S. mikatae (ATA), and S. bayanus (ATA); 4) InDels create frame shifts between the upstream start site and the proposed downstream start site; 5) The MitoProt program predicts that the shorter protein is localized to the mitochondria, which is confirmed by the literature (e.g. Dumont et al); the longer protein has a much lower probability of mitochondrial localization according to the program..

Dumont ME, et al. (1993) CYC2 encodes a factor involved in mitochondrial import of yeast cytochrome c. Mol Cell Biol 13(10):6442-51.
SGD paper | PubMed | Full-Text
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YOR103C

Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for OST2/YOR103C be moved 9 nt (3 codons) downstream. This suggestion was reviewed by SGD curators and incorporated on September 22, 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The current start site is not conserved in S. paradoxus (ATA), S. mikatae (ACG), and S. bayanus (ACG).

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YOL146W

Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PSF3/YOL146W be moved 126 nt (42 codons) downstream. This suggestion was reviewed by SGD curators and incorporated on September 22, 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The upstream ATG is conserved in S. paradoxus and S. mikatae, but insertions create stops between the two ATGs in these species. The upstream ATG (ATA in S. bayanus) and the frame are not conserved in S. bayanus; 4) Protein sequence comparisons against the nr dataset at NCBI show that there is no sequence similarity between S. cerevisiae and other species between the first and the second ATG; sequence similarity begins after the second methionine. Supporting evidence for this change has also been published by Takayama et al. who showed that the originally annotated upstream start site is not conserved in the S. pombe or human genes and that the apparent molecular mass of Psf3p is more consistent with the downstream start site.

Takayama Y, et al. (2003) GINS, a novel multiprotein complex required for chromosomal DNA replication in budding yeast. Genes Dev 17(9):1153-65.
SGD paper | PubMed | Full-Text
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YOR238W

The automated comparison of closely related Saccharomyces species suggests that the start site for YOR238W be moved 9 nt (3 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-22 YOL103W

Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for ITR2/YOL103W be moved 9 nt (3 codons) downstream. This suggestion was reviewed and accpeted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The upstream start site predicted previously for S. cerevisiae is not conserved in S. paradoxus, S. mikatae, or S. bayanus.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54.
SGD paper | PubMed | Full-Text | Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6.
SGD paper | PubMed | Full-Text | Web Supplement

2003-09-09 TEL15L, TEL15R

The chromosomal locations for TEL15L, TEL15L-TR, TEL15L-XC, TEL15L-XR, TEL15R, TEL15R-TR, TEL15R-XC, TEL15R-XR, and TEL15R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).

2003-07-29 YOL083C-A, YOL097W-A, YOL155W-A, YOR034C-A, YOR072W-B, YOR192C-C, YOR293C-A

Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XV ORFs: YOR072W-B, YOL083C-A, YOL097W-A, YOL155W-A, YOR034C-A, YOR192C-C, and YOR293C-A.

Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9.
SGD paper | PubMed | Full-Text
Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51.
SGD paper | PubMed | Full-Text | YFGdb
Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20.
SGD paper | PubMed | Full-Text | Web Supplement | YFGdb

2003-07-29 YOL013W-A, YOL038C-A

Thanks to MIPS for providing the coordinates of the following Chromosome XV ORFs: YOL013W-B and YOL038C-A.

2003-07-29 YOL019W-A, YOL085W-A, YOL166W-A, YOR032W-A, YOR108C-A, YOR161C-C, YOR161W-A, YOR161W-B, YOR186C-A, YOR231C-A, YOR335W-A, YOR394C-A, YOR396C-A

Thanks to Kumar et al. for providing the coordinates of the following Chromosome XV ORFs: YOL019W-A, YOR394C-A, YOR396C-A, YOL166W-A, YOR032W-A, YOR108C-A, YOR161C-C, YOR161W-A, YOR161W-B, YOR186C-A, YOR231C-A, YOR335W-A, and YOL085W-A.

Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63.
SGD paper | PubMed | Full-Text | YFGdb | Comments & Errata

2003-07-29 YOR020W-A

Thanks to Brachat et al. for providing the coordinates of YOR020W-A.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45.
SGD paper | PubMed | Full-Text

2003-07-29 YOL164W-A, YOR011W-A, YOR072W-A, YOR073W-A, YOR316C-A, YOR329W-A, YOR376W-A, YOR381W-A

Thanks to Kessler et al. for providing the coordinates for the following Chromosome XV ORFs: YOR072W-A, YOR316C-A, YOR376W-A, YOR381W-A, YOR329W-A, YOR073W-A, YOR011W-A, and YOL164W-A.

Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71.
SGD paper | PubMed | Full-Text

2003-01-09 YOL002C

The start site of YOL002C has been moved 30 nt downstream from 324394 to 324364. Chromosomal coordinates change from old:324394-323441 to new:324364-323411. Relative coordinates go from old:1-984 to new:1-954. Thanks to Gillian Small for reporting this sequence annotation change to SGD.

Karpichev IV, et al. (2002) Multiple regulatory roles of a novel Saccharomyces cerevisiae protein, encoded by YOL002c, in lipid and phosphate metabolism. J Biol Chem 277(22):19609-17.
SGD paper | PubMed | Full-Text

2001-03-08 snR31

Changed the orientation of SNR31 from Watson to Crick (old start coord = 841953; old stop coord = 842177; new start coord = 842177; new stop coord = 841953).

Dandekar T and Tollervey D (1993) Identification and functional analysis of a novel yeast small nucleolar RNA. Nucleic Acids Res 21(23):5386-90.
SGD paper | PubMed | Full-Text
Balakin AG, et al. (1993) SnR31, snR32, and snR33: three novel, non-essential snRNAs from Saccharomyces cerevisiae. Nucleic Acids Res 21(23):5391-7.
SGD paper | PubMed | Full-Text

2001-03-06 ARS1502

Courtesy of Prof. BiK Tye; based on Ph. D. thesis of Dr. Clarence Chan

2000-10-17 ARS1501

ARS1021 (aka ARS121) and ARS1501 were added to the genome annotation after personal communication from Shlomo Eisenberg. See Walker et al. 1991 for ARS1021 and Raychaudhuri et al. 1997 for ARS1501.

Raychaudhuri S, et al. (1997) Functional analysis of a replication origin from Saccharomyces cerevisiae: identification of a new replication enhancer. Nucleic Acids Res 25(24):5057-64.
SGD paper | Full-Text | Full-Text
Walker SS, et al. (1991) Analysis of the interactions of functional domains of a nuclear origin of replication from Saccharomyces cerevisiae. Nucleic Acids Res 19(22):6255-62.
SGD paper | PubMed | Full-Text

2000-08-14 YOR239W, YOR240W

Annotation change: it has been reported in Asakura et al. 1998 that a +1 translational frameshift merges YOR239W and YOR240W into one ORF. YOR240W is now an alias for YOR239W and YOR239W encompasses both the ORFs.

Asakura T, et al. (1998) Isolation and characterization of a novel actin filament-binding protein from Saccharomyces cerevisiae. Oncogene 16(1):121-30.
SGD paper | PubMed | Full-Text

2000-08-11 YOL052C-A

Old name: YOL053C-A; new name: YOL052C-A; date: 11/1998; old coord: ChrXV 231753 231568; SGDID: S0005413; Name changed due to nomenclature

2000-07-14 YOL047C

The annotations of the start site and 3' intron boundary of YOL047C were both changed, so that the relative coding coordinates change from 1-1..189-892 to 1-243..307-1134. Note that the stop site and the 5' boundary of the intron were not changed. Chromosomal coordinates for the coding region change from 242503-242503..242315-241612 to 242745-242503..242439-241612.

1999-07-17 YOL075C

The start site of YOL075C was moved 597 bases upstream. Chromosomal coordinates change from 194944-189657 to 193541-189657.

1998-05-21 YOL013W-A, YOR298C-A

The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A.

The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.

Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51.
SGD paper | PubMed | Full-Text | YFGdb

1997-07-01 YOR304C-A

The original annotation of the YOR304C-A ORF was incorrect because it included one additional nucleotide past the stop codon. The stop coordinate has now been corrected so that this extra "G" nucleotide is no longer included.

Retrieved from "https://wiki.yeastgenome.org/index.php?title=Chromosome_XV_History&oldid=401388"