Difference between revisions of "Chromosome XV History"
(→Sequence Changes) |
(→Sequence Changes) |
||
(15 intermediate revisions by the same user not shown) | |||
Line 59: | Line 59: | ||
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||
Old 55990 CTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTCAATTTCGCACGCC 56049</pre> | Old 55990 CTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTCAATTTCGCACGCC 56049</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YOL141W YOL141W] | ||
+ | | 57699 | ||
+ | | 57699 | ||
+ | | Substitution | ||
+ | | A | ||
+ | | T | ||
+ | |- | ||
+ | | || colspan="6" | Nucleotide change(s) in the coding region of PPM2/YOL141W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 417 is now Leucine rather than Methionine. | ||
+ | <pre>New 57661 GGAGGTAGTAACCCATACAGAGTAAACGAAATATTACAGTTGAGTATACACTACGACAAA 57720 | ||
+ | ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | ||
+ | Old 57660 GGAGGTAGTAACCCATACAGAGTAAACGAAATATTACAGATGAGTATACACTACGACAAA 57719</pre> | ||
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
Line 365: | Line 381: | ||
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | rowspan="2"| 2011-02-03 | ||
+ | | rowspan="2"| [https://www.yeastgenome.org/locus/YOL036W YOL036W], [https://www.yeastgenome.org/locus/snR50 snR50] | ||
+ | | 259235 | ||
+ | | 259235 | ||
+ | | Deletion | ||
+ | | A | ||
+ | | | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 259230 | ||
+ | | 259230 | ||
+ | | Deletion | ||
+ | | T | ||
+ | | | ||
+ | |- | ||
+ | | || colspan="6" | Two single nucleotide deletions were made in the intergenic region between ORF YOL036W and snoRNA SNR50. | ||
+ | <pre>New 259199 ATTAGGATGGTAGCCCTACCTTTTTTTTTTTT-GGCA-CACATGGTCAACTTTTCTTCTC 259256 | ||
+ | |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| | ||
+ | Old 259198 ATTAGGATGGTAGCCCTACCTTTTTTTTTTTTTGGCAACACATGGTCAACTTTTCTTCTC 259257</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | rowspan="2"| 2011-02-03 | ||
+ | | rowspan="2"| [https://www.yeastgenome.org/locus/YOR106W YOR106W], [https://www.yeastgenome.org/locus/YOR107W YOR107W] | ||
+ | | 521099 | ||
+ | | 521099 | ||
+ | | Deletion | ||
+ | | C | ||
+ | | | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 521071 | ||
+ | | 521071 | ||
+ | | Insertion | ||
+ | | | ||
+ | | A | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide insertion and a single nucleotide deletion were made in the intergenic region between ORFs VAM3/YOR106W and RGS2/YOR107W. | ||
+ | <pre>New 521055 TGGAGATGAAAAAAAAACTTGCTGAATAAAGATAGTTAAGGCGC-TAGTAATCAAATTAA 521113 | ||
+ | |||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| | ||
+ | Old 521056 TGGAGATGAAAAAAAA-CTTGCTGAATAAAGATAGTTAAGGCGCCTAGTAATCAAATTAA 521114</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YOR090C YOR090C], [https://www.yeastgenome.org/locus/YOR091W YOR091W] | ||
+ | | 492979 | ||
+ | | 492979 | ||
+ | | Insertion | ||
+ | | | ||
+ | | T | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs PTC5/YOR090C and TMA46/YOR091W. | ||
+ | <pre>New 492955 TACCCTCCAATCGATCCTTTTTTTCTTTTTTGTATCTTGTGTAGAAAGAAGTGAATCCTG 493014 | ||
+ | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | ||
+ | Old 492957 TACCCTCCAATCGATCCTTTTTT-CTTTTTTGTATCTTGTGTAGAAAGAAGTGAATCCTG 493015</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | rowspan="10"| 2011-02-03 | ||
+ | | rowspan="10"| [https://www.yeastgenome.org/locus/YOL145C YOL145C] | ||
+ | | 52199 | ||
+ | | 52199 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | T | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 50767 | ||
+ | | 50767 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | T | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 50430 | ||
+ | | 50431 | ||
+ | | Substitution | ||
+ | | GG | ||
+ | | CC | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 50081 | ||
+ | | 50081 | ||
+ | | Substitution | ||
+ | | T | ||
+ | | C | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 50069 | ||
+ | | 50069 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | T | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 49941 | ||
+ | | 49941 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | T | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 49922 | ||
+ | | 49922 | ||
+ | | Substitution | ||
+ | | T | ||
+ | | A | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 49919 | ||
+ | | 49919 | ||
+ | | Substitution | ||
+ | | A | ||
+ | | T | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 49912 | ||
+ | | 49912 | ||
+ | | Substitution | ||
+ | | A | ||
+ | | T | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 49829 | ||
+ | | 49829 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | T | ||
+ | |- | ||
+ | | || colspan="6" | Several nucleotide changes were made in the coding region of CTR9/YOL145C, resulting in an altered protein sequence. The start, stop, and reading frame remain the same, but with the following changes: Gly197->Lys, Gly674->Glu, Thr786->Arg, Lys903->Glu, Arg907->Ser, residues 956-959 are now LIQE not IFQV, and Glu987->Lys. | ||
+ | <pre>New 49811 GTCTTGGCTTTTCTTCGTCATATTCATTGTCTTTATCAGACAGATCTGAA 49870 | ||
+ | ||||||||| |||||||||||||||||||||||||||||||||||||||| | ||
+ | Old 49820 GTCTTGGCTGTTCTTCGTCATATTCATTGTCTTTATCAGACAGATCTGAA 49869 | ||
+ | New 49871 TCATCTTTAACATTATGTTCACTTATGGCCATGGCTTCTCGCTCCTGGAT 49920 | ||
+ | |||||||||||||||||||||||||||||||||||||||||| |||||| | ||
+ | Old 49870 TCATCTTTAACATTATGTTCACTTATGGCCATGGCTTCTCGCACCTGGAA 49919 | ||
+ | New 49921 TAACTTTTGTGCCTCATCTTGTAGTTTCCTATACTCCTCTGCCTGTTTTT 49970 | ||
+ | || |||||||||||||||||| |||||||||||||||||||||||||||| | ||
+ | Old 49920 TATCTTTTGTGCCTCATCTTGGAGTTTCCTATACTCCTCTGCCTGTTTTT 49969 | ||
+ | New 50041 AATTTTACGTGCTTCATCAATTTTGGCGCTTTGTTCCTTCTCAAATTCTT 50090 | ||
+ | ||||||||||||||||||||||||||||| ||||||||||| |||||||| | ||
+ | Old 50040 AATTTTACGTGCTTCATCAATTTTGGCGCGTTGTTCCTTCTTAAATTCTT 50089 | ||
+ | New 50401 TTCCAAGGCTTTTTGATAAAAATTCACAGACCTTTCCTTAATGGCACGTG 50450 | ||
+ | |||||||||||||||||||||||||||||| |||||||||||||||||| | ||
+ | Old 50400 TTCCAAGGCTTTTTGATAAAAATTCACAGAGGTTTCCTTAATGGCACGTG 50449 | ||
+ | New 50761 TGATTTTTCCTGTTCCTTTGGATTCCTGGACTTTTTACCGTCTCTGGCAA 50810 | ||
+ | ||||||| |||||||||||||||||||||||||||||||||||||||||| | ||
+ | Old 50760 TGATTTTCCCTGTTCCTTTGGATTCCTGGACTTTTTACCGTCTCTGGCAA 50809 | ||
+ | New 52161 GCAATTCTTGAAAAATTTTCAGACTGGCCATATAATTTTTCTTCTGATAA 52210 | ||
+ | ||||||||||||||||||||||||||||||||||||||| |||||||||| | ||
+ | Old 52160 GCAATTCTTGAAAAATTTTCAGACTGGCCATATAATTTTCCTTCTGATAA 52209</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | rowspan="2"| 2011-02-03 | ||
+ | | rowspan="2"| [https://www.yeastgenome.org/locus/YOL140W YOL140W], [https://www.yeastgenome.org/locus/YOL141W YOL141W] | ||
+ | | 58601 | ||
+ | | 58601 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | G | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 58558 | ||
+ | | 58558 | ||
+ | | Deletion | ||
+ | | T | ||
+ | | | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide deletion and a single nucleotide substitution were made in the intergenic region between ORFs PPM2/YOL141W and ARG8/YOL140W. | ||
+ | <pre>New 58550 GGATTCGA-ATGGTTGCCAGCTCGCTATGTGACTCACTTAAAGTACATGATGCGTCATTG 58609 | ||
+ | ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||
+ | Old 58550 GGATTCGATATGGTTGCCAGCTCGCTATGTGACTCACTTAAAGTACATGATCCGTCATTG 58609</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YOL139C YOL139C], [https://www.yeastgenome.org/locus/YOL140W YOL140W] | ||
+ | | 60173 | ||
+ | | 60173 | ||
+ | | Substitution | ||
+ | | A | ||
+ | | G | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide substitution was made in the intergenic region between ORFs ARG8/YOL140W and CDC33/YOL139C. | ||
+ | <pre>New 60130 CTTACGTGATATGTACATGTGGTGCGTCTTTCATACCTTGAATGATATAATTAATAAGAG 60189 | ||
+ | ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | ||
+ | Old 60130 CTTACGTGATATGTACATGTGGTGCGTCTTTCATACCTTGAATAATATAATTAATAAGAG 60189</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YOL135C YOL135C], [https://www.yeastgenome.org/locus/YOL136C YOL136C] | ||
+ | | 69084 | ||
+ | | 69084 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | T | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide substitution was made in the intergenic region between ORFs PFK27/YOL136C and MED7/YOL135C. | ||
+ | <pre>New 69060 AACCGAGTAATCCAATTTACTTTTTCTACTTTTTTTTCATTATCAATCGATTCAGATGCC 69119 | ||
+ | |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||
+ | Old 69060 AACCGAGTAATCCAATTTACTTTTCCTACTTTTTTTTCATTATCAATCGATTCAGATGCC 69119</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YOR008C-A YOR008C-A], [https://www.yeastgenome.org/locus/YOR008W-B YOR008W-B] | ||
+ | | 343142 | ||
+ | | 343142 | ||
+ | | Insertion | ||
+ | | | ||
+ | | A | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs YOR008C-A and YOR008W-B. | ||
+ | <pre>New 343127 GAAGTATGTAAAAAAATTACACACCATTAAGTTCTTATGTAAACCGAAGTCTGGAAGAGA 343186 | ||
+ | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | ||
+ | Old 343128 GAAGTATGTAAAAAA-TTACACACCATTAAGTTCTTATGTAAACCGAAGTCTGGAAGAGA 343186</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YOR261C YOR261C], [https://www.yeastgenome.org/locus/YOR262W YOR262W] | ||
+ | | 816959 | ||
+ | | 816959 | ||
+ | | Insertion | ||
+ | | | ||
+ | | T | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs RPN8/YOR261C and YOR262W. | ||
+ | <pre>New 816943 TTTCCTTTCTTTCTTTCTTTTTTTAAATTCGAAAAATGCCCTCAATCAGTAGCAGTTGTA 817002 | ||
+ | ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | ||
+ | Old 816943 TTTCCTTTCTTTCTTTC-TTTTTTAAATTCGAAAAATGCCCTCAATCAGTAGCAGTTGTA 817001</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YOL076W YOL076W], [https://www.yeastgenome.org/locus/YOL077C YOL077C] | ||
+ | | 186978 | ||
+ | | 186979 | ||
+ | | Substitution | ||
+ | | CG | ||
+ | | GC | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide substitution was made in the intergenic region between ORFs BRX1/YOL077C and MDM20/YOL076W. | ||
+ | <pre>New 186960 ACAGAATTCATTGGCGAAGCAACGATACATAACGAGCTCGGTACAGCAATCATCGCATCG 187019 | ||
+ | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | ||
+ | Old 186960 ACAGAATTCATTGGCGAACGAACGATACATAACGAGCTCGGTACAGCAATCATCGCATCG 187019</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | rowspan="2"| 2011-02-03 | ||
+ | | rowspan="2"| [https://www.yeastgenome.org/locus/YOL062C YOL062C], [https://www.yeastgenome.org/locus/YOL063C YOL063C] | ||
+ | | 210486 | ||
+ | | 210487 | ||
+ | | Substitution | ||
+ | | AC | ||
+ | | CA | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 210453 | ||
+ | | 210454 | ||
+ | | Substitution | ||
+ | | AC | ||
+ | | CA | ||
+ | |- | ||
+ | | || colspan="6" | Two separate dinucleotide substitutions were made in the intergenic region between ORFs CRT10/YOL063C and APM4/YOL062C. | ||
+ | <pre>New 210440 TTAACAAAATGTGCATTCTAAAGGAAATTACTATAAAAAATACAGGCATGATAAAAATAT 210499 | ||
+ | ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| | ||
+ | Old 210440 TTAACAAAATGTGACTTCTAAAGGAAATTACTATAAAAAATACAGGACTGATAAAAATAT 210499</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YOR306C YOR306C], [https://www.yeastgenome.org/locus/YOR307C YOR307C] | ||
+ | | 892173 | ||
+ | | 892173 | ||
+ | | Insertion | ||
+ | | | ||
+ | | C | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs MCH5/YOR306C and SLY41/YOR307C. | ||
+ | <pre>New 892133 TTTCTCTCAACCTTTCGAGTACTTGGAAAAAGGAGTAGATCCGCTTTCAGCAATCGAAGC 892192 | ||
+ | ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | ||
+ | Old 892131 TTTCTCTCAACCTTTCGAGTACTTGGAAAAAGGAGTAGATCCG-TTTCAGCAATCGAAGC 892189</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YOR354C YOR354C], [https://www.yeastgenome.org/locus/YOR355W YOR355W] | ||
+ | | 1004737 | ||
+ | | 1004737 | ||
+ | | Deletion | ||
+ | | T | ||
+ | | | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs MSC6/YOR354C and GDS1/YOR355W. | ||
+ | <pre>New 1004693 TCAGCATTCCATTATTGAAGGCTTTAAAATAATAGTTTCTTTTTTCC-TATTATTTTATT 1004751 | ||
+ | ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | ||
+ | Old 1004690 TCAGCATTCCATTATTGAAGGCTTTAAAATAATAGTTTCTTTTTTCCTTATTATTTTATT 1004749</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YOR045W YOR045W], [https://www.yeastgenome.org/locus/YOR046C YOR046C] | ||
+ | | 414326 | ||
+ | | 414326 | ||
+ | | Deletion | ||
+ | | T | ||
+ | | | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs TOM6/YOR045W and DBP5/YOR046C. | ||
+ | <pre>New 414297 ATATGCTGTGTTTGTATTTATATAAGCTT-GCCTCACAAGTAAAAGTGGATCAACAAACT 414355 | ||
+ | ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | ||
+ | Old 414297 ATATGCTGTGTTTGTATTTATATAAGCTTTGCCTCACAAGTAAAAGTGGATCAACAAACT 414356</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YOL163W YOL163W], [https://www.yeastgenome.org/locus/YOL164W YOL164W] | ||
+ | | 8476 | ||
+ | | 8476 | ||
+ | | Insertion | ||
+ | | | ||
+ | | T | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs BDS1/YOL164W and YOL163W. | ||
+ | <pre>New 8461 AGAGCTTTTCGTATATTCTGTTTTCCTAATAACATTTACTATTGTGAATTGAAATTTAAA 8520 | ||
+ | |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | ||
+ | Old 8461 AGAGCTTTTCGTATAT-CTGTTTTCCTAATAACATTTACTATTGTGAATTGAAATTTAAA 8519</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YOR049C YOR049C], [https://www.yeastgenome.org/locus/YOR050C YOR050C] | ||
+ | | 423752 | ||
+ | | 423752 | ||
+ | | Deletion | ||
+ | | T | ||
+ | | | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs RSB1/YOR049C and YOR050C. | ||
+ | <pre>New 423716 CGAAGGTTCGGTACCATACCACCATAAAGGGAATT-ACTGTTAGCTGCTGCTTCTAACTG 423774 | ||
+ | ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||
+ | Old 423717 CGAAGGTTCGGTACCATACCACCATAAAGGGAATTTACTGTTAGCTGCTGCTTCTAACTG 423776</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2006-01-05 | ||
+ | | [https://www.yeastgenome.org/locus/YOL152W YOL152W] | ||
+ | | 42535 | ||
+ | | 42535 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
+ | |- | ||
+ | | || colspan="6" | A sequencing error was demonstrated in BY4741 (a derivative of S288C) by Mark Rinnerthaler and Michael Breitenbach, and SGD has updated the sequence accordingly. As a consequence of this change, the stop codon has been moved 27 nts upstream, shortening the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 629 to 620 amino acids. (Personal communication from MIPS, Mark Rinnerthaler and Michael Breitenbach) | ||
+ | <pre>New: 42507 AAGGTATACCGTCGGAAATTCCGTGGCAGGTTTACAGGCC 42546 | ||
+ | ||||||||||||||||||||||||||||| |||||||||| | ||
+ | Old: 42507 AAGGTATACCGTCGGAAATTCCGTGGCAG-TTTACAGGCC 42545</pre> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2006-01-05 | ||
+ | | [https://www.yeastgenome.org/locus/YOR252W YOR252W] | ||
+ | | 803745 | ||
+ | | 803745 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
+ | |- | ||
+ | | || colspan="6" | SGD confirmed the sequence error predicted by the work of Kellis, et al, and have updated the systematic sequence accordingly. | ||
+ | <pre>New: 803730 ACGGTTCATCCGAAGGGTAGAAAGTATGAAAAGCT 803764 | ||
+ | |||||||||||||||| |||||||||||||||||| | ||
+ | Old: 803730 ACGGTTCATCCGAAGG-TAGAAAGTATGAAAAGCT 803763</pre> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2004-02-13 | ||
+ | | [https://www.yeastgenome.org/locus/YOR298C-A YOR298C-A] | ||
+ | | 877622 | ||
+ | | 877622 | ||
+ | | Insertion | ||
+ | | | ||
+ | | GC | ||
+ | |- | ||
+ | | || colspan="6" | Two nucleotides GC were inserted after the G at coordinate 877622 in what had previously been annotated as the intergenic region between YOR298C-A and YOR299W. This region is now part of YOR298C-A, as the start for this ORF was moved 279 bp upstream from 877403 to 877682 (note that YOR298C-A is encoded on the Crick strand). As a result, YOR298C-Ap was increased from 58 aa to 151 aa. See Brachat et al. 2003 and GenBank AY260886. This change was also predicted by Kellis et al. and Cliften et al. | ||
+ | <pre>Query: 361 AATTTGGCCTTGAGATCTGGCAACGTTGGCCCTTGGGCCAGAACCACCAGCTCTTGCTCT 420 | ||
+ | |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||
+ | Sbjct: 877587 AATTTGGCCTTGAGATCTGGCAACGTTGGCCCTTGG--CAGAACCACCAGCTCTTGCTCT 877644</pre> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br> | ||
+ | '''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2003-01-09 | ||
+ | | [https://www.yeastgenome.org/locus/YOR087W YOR087W], [https://www.yeastgenome.org/locus/YOR088W YOR088W] | ||
+ | | 488439 | ||
+ | | 488439 | ||
+ | | Insertion | ||
+ | | | ||
+ | | T | ||
+ | |- | ||
+ | | || colspan="6" | Due to the insertion of a T after the A at 488439 on chromosome 15, YOR087W and YOR088W have been merged to one single ORF - YVC1/YOR087W, with YOR088W as an alias. The old chromosomal coordinates for YOR087W were 487708-488451, and for YOR088W were 488286-489734. The new chromosomal coordinates for the fused ORF are 487708-489735. The old relative coordinates for YOR087W were 1-744, and for YOR088W were 1-1449. The new relative coordinates for the fused ORF are 1-2028.<br><br> | ||
+ | '''Denis V and Cyert MS''' (2002) Internal Ca(2+) release in yeast is triggered by hypertonic shock and mediated by a TRP channel homologue. J Cell Biol 156(1):29-34.<br> | ||
+ | [https://www.yeastgenome.org/reference/S000069157 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11781332 PubMed] | [http://jcb.rupress.org/content/156/1/29.long Full-Text] <br> | ||
+ | '''Palmer CP, et al.''' (2001) A TRP homolog in Saccharomyces cerevisiae forms an intracellular Ca(2+)-permeable channel in the yeast vacuolar membrane. Proc Natl Acad Sci U S A 98(14):7801-5. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000069248 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11427713 PubMed] | [https://www.pnas.org/content/98/14/7801.long Full-Text] <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2001-05-31 | ||
+ | | [https://www.yeastgenome.org/locus/YOR068C YOR068C], [https://www.yeastgenome.org/locus/YOR069W YOR069W] | ||
+ | | 453804 | ||
+ | | 453804 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
+ | |- | ||
+ | | || colspan="6" | Inserted one G nucleotide after the G at chromosomal coordinate 453805, in the intergenic region to the left of overlapping ORFs YOR068C and YOR068W: | ||
+ | <pre>Old: 453752 ATCCTGCAATAACAAGCCATGGACTACGAGGATAATCTAGAAGCACCTGTTTGG-ACGAA 453810 | ||
+ | |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||
+ | New: 453752 ATCCTGCAATAACAAGCCATGGACTACGAGGATAATCTAGAAGCACCTGTTTGGGACGAA 453811</pre> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 1997-08-11 | ||
+ | | [https://www.yeastgenome.org/locus/YOL025W YOL025W] | ||
+ | | 276609 | ||
+ | | 276609 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | A | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide substitution was made in the systematic sequence in the region covering the ORF LAG2/YOL025W. The G at 276609 was changed to an A. | ||
+ | <pre>New: 276601 AAAGCAGGAAATTTTACCCAAAAAATTGATGAAGGAGTGACCTTAAGAACAATGATTCTT 276660 | ||
+ | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||
+ | Old: 276601 AAAGCAGGGAATTTTACCCAAAAAATTGATGAAGGAGTGACCTTAAGAACAATGATTCTT 276660</pre> | ||
+ | |||
+ | |} | ||
+ | |||
+ | <br><br> | ||
+ | |||
+ | =Annotation Changes ''without sequence changes''= | ||
+ | {| border="1" style="border-collapse:collapse; width:90%" cellpadding="6" | ||
+ | ! Date !! Affected Features | ||
+ | |- | ||
+ | | 2014-11-19 | ||
+ | | [https://www.yeastgenome.org/locus/ARS1501 ARS1501], [https://www.yeastgenome.org/locus/ARS1507 ARS1507], [https://www.yeastgenome.org/locus/ARS1508 ARS1508], [https://www.yeastgenome.org/locus/ARS1509 ARS1509], [https://www.yeastgenome.org/locus/ARS1513 ARS1513], [https://www.yeastgenome.org/locus/ARS1519 ARS1519], [https://www.yeastgenome.org/locus/ARS1523 ARS1523], [https://www.yeastgenome.org/locus/ARS1526 ARS1526] <br> | ||
+ | The chromosomal coordinates of the following ARS elements on Chromosome XV were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1507, ARS1508, ARS1509, ARS1513, ARS1501, ARS1519, ARS1523, ARS1526. <br> <br> | ||
+ | '''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text] | ||
+ | |- | ||
+ | | 2014-11-19 | ||
+ | | [https://www.yeastgenome.org/locus/ARS1501 ARS1501], [https://www.yeastgenome.org/locus/ARS1507 ARS1507], [https://www.yeastgenome.org/locus/ARS1508 ARS1508], [https://www.yeastgenome.org/locus/ARS1509 ARS1509], [https://www.yeastgenome.org/locus/ARS1510 ARS1510], [https://www.yeastgenome.org/locus/ARS1511 ARS1511], [https://www.yeastgenome.org/locus/ARS1521 ARS1521], [https://www.yeastgenome.org/locus/ARS1524 ARS1524], [https://www.yeastgenome.org/locus/ARS1528 ARS1528], [https://www.yeastgenome.org/locus/ARS1531 ARS1531] <br> | ||
+ | As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome XV based on Liachko et al. 2013: ARS1531, ARS1507, ARS1508, ARS1509, ARS1510, ARS1511, ARS1501, ARS1521, ARS1524, ARS1528. <br> <br> | ||
+ | '''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text] | ||
+ | |- | ||
+ | | 2014-11-19 | ||
+ | | [https://www.yeastgenome.org/locus/YOR031W YOR031W] <br> | ||
+ | The feature_type annotation of CRS5/YOR031W was changed from ORF to blocked_reading_frame (SO:0000718) as part of SGD's genome annotation revision R64.2.<br><br> | ||
+ | |- | ||
+ | | 2014-11-19 | ||
+ | | [https://www.yeastgenome.org/locus/YOL153C YOL153C] <br> | ||
+ | The feature_type annotation of YOL153C was changed from pseudogene to blocked_reading_frame (SO:0000718) as part of SGD's genome annotation revision R64.2.<br><br> | ||
+ | |- | ||
+ | | 2014-11-18 | ||
+ | | [https://www.yeastgenome.org/locus/ETC2 ETC2], [https://www.yeastgenome.org/locus/ETC7 ETC7] <br> | ||
+ | The following previously unmapped features were identified as nuclear matrix attachment sites and assigned chromosomal coordinates based on Hiraga et al. 2012 as part of SGD's genome annotation revision R64.2: ETC1, ETC2, ETC3, ETC4, ETC6, ETC7, ETC8.<br><br> | ||
+ | '''Hiraga SI, et al.''' (2012) TFIIIC localizes budding yeast ETC sites to the nuclear periphery. Mol Biol Cell 23(14):2741-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000149071 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/22496415 PubMed] | [https://www.molbiolcell.org/doi/10.1091/mbc.e11-04-0365 Full-Text]<br> | ||
+ | |- | ||
+ | | 2010-01-05 | ||
+ | | [https://www.yeastgenome.org/locus/YOR080W YOR080W] <br> | ||
+ | The annotated start ATG of ORF YOR080W/DIA2 has been moved to Met15, based on Morohashi et al. 2009. Old chromosomal coordinates were 474554..476794; the new chromosomal coordinates are 474596..476794. ''Thanks to Karim Labib for bringing this annotation correction to the attention of SGD.''<br><br> | ||
+ | '''Morohashi H, et al.''' (2009) The amino-terminal TPR domain of Dia2 tethers SCF(Dia2) to the replisome progression complex. Curr Biol 19(22):1943-9. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000132241 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/19913425 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0960982209018223?via%3Dihub Full-Text] <br> | ||
+ | |- | ||
+ | | 2009-05-05 | ||
+ | | [https://www.yeastgenome.org/locus/ARS1512 ARS1512], [https://www.yeastgenome.org/locus/ARS1518 ARS1518] <br> | ||
+ | The following ARS elements on Chromosome XV were added to the genome annotation based on Raveendranathan et al. 2006: ARS1512 and ARS1518.<br><br> | ||
+ | '''Raveendranathan M, et al.''' (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000117571 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16888628 PubMed] | [https://www.embopress.org/cgi/doi/10.1038/sj.emboj.7601251 Full-Text] <br> | ||
+ | [https://www.yeastgenome.org/reference/S000132241 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/19913425 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0960982209018223?via%3Dihub Full-Text] <br> | ||
+ | |- | ||
+ | | 2007-07-10 | ||
+ | | [https://www.yeastgenome.org/locus/YOR312C YOR312C] <br> | ||
+ | The start of ORF RPL20B/YOR312C was moved 13 nt upstream, and the 5' end of the intron was moved 19 nt upstream, based on GenBank EF138822, Miura et al. 2006, and Zhang et al. 2007. The ORF had been annotated as 932 nt with a 407-nt intron (174 aa), but is now 945 nt long with a 426-nt intron (172 aa).<br><br> | ||
+ | '''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000119659 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.pnas.org/content/103/47/17846.long Full-Text] <br> | ||
+ | '''Zhang Z, et al.''' (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000121920 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17351133 PubMed] | [https://genome.cshlp.org/content/17/4/503 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=17351133&db=pmid YFGdb]<br> | ||
+ | |- | ||
+ | | 2007-05-10 | ||
+ | | [https://www.yeastgenome.org/locus/snR36 snR36] <br> | ||
+ | Updated coordinates of snR36 based on Samarsky et al. 1995 and GenBank L33804. ''Old coordinates were 680997..680643 (355 nt), new coordinates are 680867..680686 (182 nt).''<br><br> | ||
+ | '''Samarsky DA, et al.''' (1995) Characterization of three new snRNAs from Saccharomyces cerevisiae: snR34, snR35 and snR36. Nucleic Acids Res 23(13):2548-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000048238 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/7630735 PubMed] | [https://academic.oup.com/nar/article/23/13/2548/2400622 Full-Text]<br> | ||
+ | |- | ||
+ | | 2007-05-10 | ||
+ | | [https://www.yeastgenome.org/locus/snR35 snR35] <br> | ||
+ | Updated coordinates of snR35 based on Samarsky et al. 1995 and GenBank L33803. ''Old coordinates were 759730..759191 (540 nt) and new coordinates are 759530..759327 (204 nt)''.<br><br> | ||
+ | '''Samarsky DA, et al.''' (1995) Characterization of three new snRNAs from Saccharomyces cerevisiae: snR34, snR35 and snR36. Nucleic Acids Res 23(13):2548-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000048238 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/7630735 PubMed] | [https://academic.oup.com/nar/article/23/13/2548/2400622 Full-Text]<br> | ||
+ | |- | ||
+ | | 2007-02-07 | ||
+ | | [https://www.yeastgenome.org/locus/YOR396W YOR396W] <br> | ||
+ | The start site for YOR396W/YRF1-8, one of several telomeric Y' element-encoded helicases, was moved 1716 bp (572 codons) upstream. | ||
+ | The gene model of YOR396W was shorter and lacked a substantial N-terminal part when compared to the other Y' helicases encoded by the YRF1 genes, although the reading frame could be extended at the N-terminus to match the other genes without problem. The shorter gene model may have originated from Louis & Haber 1992 and the prediction found in EMBL:U23472. The strain (YP1) sequenced in this study has a frameshift at position 1520 (aa-507) disrupting the gene and producing two ORFs, one of which was the original shorter version of YOR396W used by SGD. In contrary, a later sequence submission (EMBL:Z75302) submitted on behalf of the Chromosome XV Sequencing Project does not contain this frameshift, matching the chromosomal sequence for reference strain S288C stored in SGD. ''Thank you to Ivo Pedruzzi of Swiss-Prot for bringing this annotation error to the attention of SGD.''<br><br> | ||
+ | '''Louis EJ and Haber JE''' (1992) The structure and evolution of subtelomeric Y' repeats in Saccharomyces cerevisiae. Genetics 131(3):559-74. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000065737 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/1628806 PubMed] | [https://www.genetics.org/content/131/3/559.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2006-10-06 | ||
+ | | [https://www.yeastgenome.org/locus/YOL126C YOL126C] <br> | ||
+ | Based on N-terminal sequencing (Kopetzki E. et al., Minard K.I. et al) and mapping of the transcription start site (Roth S. and Schuller H.J.), the start site for MDH2/YOL126C has been moved 141 bp (47 codons) downstream. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Special thanks to Ivo Pedruzzi and the team at Swiss-prot for bringing this to our attention.<br><br> | ||
+ | '''Minard KI and McAlister-Henn L''' (1991) Isolation, nucleotide sequence analysis, and disruption of the MDH2 gene from Saccharomyces cerevisiae: evidence for three isozymes of yeast malate dehydrogenase. Mol Cell Biol 11(1):370-80. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000039783 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/1986231 PubMed] | [https://mcb.asm.org/content/11/1/370.long Full-Text] <br> | ||
+ | '''Roth S and Schuller HJ''' (2001) Cat8 and Sip4 mediate regulated transcriptional activation of the yeast malate dehydrogenase gene MDH2 by three carbon source-responsive promoter elements. Yeast 18(2):151-62. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000059497 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11169757 PubMed] | [https://onlinelibrary.wiley.com/doi/full/10.1002/1097-0061%2820010130%2918%3A2%3C151%3A%3AAID-YEA662%3E3.0.CO%3B2-Q Full-Text] <br> | ||
+ | '''Ghaemmaghami S, et al.''' (2003) Global analysis of protein expression in yeast. Nature 425(6959):737-41. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000074186 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/14562106 PubMed] | [https://www.nature.com/articles/nature02046 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=14562106&db=pmid YFGdb] | [https://www.yeastgenome.org/reference/S000139820 Comments & Errata] <br> | ||
+ | |- | ||
+ | | 2006-10-05 | ||
+ | | [https://www.yeastgenome.org/locus/YOR173W YOR173W] <br> | ||
+ | Based on N-terminal sequencing and mapping of the transcription start site (Malys N. et al.), the start site for DCS2/YOR173W has been moved 132 bp (44 codons) downstream. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Special thanks to Ivo Pedruzzi and the team at SwissProt for bringing this to our attention.<br><br> | ||
+ | '''Malys N, et al.''' (2004) The 'scavenger' m7GpppX pyrophosphatase activity of Dcs1 modulates nutrient-induced responses in yeast. Nucleic Acids Res 32(12):3590-600. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000076812 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/15240832 PubMed] | [https://academic.oup.com/nar/article/32/12/3590/2375813 Full-Text] <br> | ||
+ | |- | ||
+ | | 2006-10-03 | ||
+ | | [https://www.yeastgenome.org/locus/YOR211C YOR211C] <br> | ||
+ | Based on genetic analyses done by Shepard K.A. et al. (1999), the start site for MGM1/YOR211C has been moved 63 bp (21 codons) downstream. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Special thanks to Ivo Pedruzzi and the team at Swiss-Prot for bringing this change to our attention.<br><br> | ||
+ | '''Shepard KA and Yaffe MP''' (1999) The yeast dynamin-like protein, Mgm1p, functions on the mitochondrial outer membrane to mediate mitochondrial inheritance. J Cell Biol 144(4):711-20. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000047437 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10037792 PubMed] | [http://jcb.rupress.org/content/144/4/711.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2006-10-02 | ||
+ | | [https://www.yeastgenome.org/locus/ARS1531 ARS1531] <br> | ||
+ | ARS1531, also known as ARS1506.5, was added to the genome annotation based on Nieduszynski et al. 2006.<br><br> | ||
+ | '''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000117321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] | [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br> | ||
+ | |- | ||
+ | | 2006-09-08 | ||
+ | | [https://www.yeastgenome.org/locus/ARS1507 ARS1507], [https://www.yeastgenome.org/locus/ARS1508 ARS1508], [https://www.yeastgenome.org/locus/ARS1509 ARS1509], [https://www.yeastgenome.org/locus/ARS1510 ARS1510], [https://www.yeastgenome.org/locus/ARS1511 ARS1511], [https://www.yeastgenome.org/locus/ARS1513 ARS1513], [https://www.yeastgenome.org/locus/ARS1519 ARS1519], [https://www.yeastgenome.org/locus/ARS1521 ARS1521], [https://www.yeastgenome.org/locus/ARS1523 ARS1523], [https://www.yeastgenome.org/locus/ARS1524 ARS1524], [https://www.yeastgenome.org/locus/ARS1526 ARS1526], [https://www.yeastgenome.org/locus/ARS1528 ARS1528], [https://www.yeastgenome.org/locus/ARS1529 ARS1529] <br> | ||
+ | The following new ARS elements on Chromosome XV were added to SGD based on Nieduszynski et al. 2006: ARS1507, ARS1508, ARS1509, ARS1510, ARS1511, ARS1513, ARS1519, ARS1521, ARS1523, ARS1524, ARS1526, ARS1528, ARS1529. <br> <br> | ||
+ | '''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000117321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] | [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br> | ||
+ | |- | ||
+ | | 2006-09-08 | ||
+ | | [https://www.yeastgenome.org/locus/ARS1516 ARS1516] <br> | ||
+ | The coordinates of ARS1516 were updated based on Nieduszynski et al. 2006.<br><br> | ||
+ | '''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000117321 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] | [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br> | ||
+ | |- | ||
+ | | 2006-05-11 | ||
+ | | [https://www.yeastgenome.org/locus/YOR197W YOR197W] <br> | ||
+ | The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for MCA1/YOR197W was moved 57 nt (19 amino acids) downstream.<br><br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | |- | ||
+ | | 2006-04-12 | ||
+ | | [https://www.yeastgenome.org/locus/ARS1516 ARS1516] <br> | ||
+ | ARS1516, also known as "ADE2 ARS", was added to the genome annotation for Chromosome XV at coordinates 566191-566877 based on Wyrick et al. 2001 and Sasnauskas et al. 1987.<br><br> | ||
+ | '''Sasnauskas KV, et al.''' (1987) [Cloning of the ADE2 gene of Saccharomyces cerevisiae and localization of the ARS-sequence] Genetika 23(7):1141-8. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000048074 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/2888707 PubMed] <br> | ||
+ | '''Wyrick JJ, et al.''' (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000069019 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11743203 PubMed] | [https://science.sciencemag.org/content/294/5550/2357.long Full-Text] | [https://www.ncbi.nlm.nih.gov/pubmed/11743187 Comments & Errata]<br> | ||
+ | |- | ||
+ | | 2006-01-24 | ||
+ | | [https://www.yeastgenome.org/locus/snR81 snR81] <br> | ||
+ | New snoRNA added to genome annotation (GenBank accession # AY679769).<br><br> | ||
+ | '''Schattner P, et al.''' (2004) Genome-wide searching for pseudouridylation guide snoRNAs: analysis of the Saccharomyces cerevisiae genome. Nucleic Acids Res 32(14):4281-96. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000081218 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/15306656 PubMed] | [https://academic.oup.com/nar/article/32/14/4281/1279684 Full-Text] <br> | ||
+ | |- | ||
+ | | 2005-12-01 | ||
+ | | [https://www.yeastgenome.org/locus/YOR091W YOR091W] <br> | ||
+ | Based on on 5' SAGE TSS data and multiple orthologous sequence alignments published by Zhang and Dietrich, the start site for YOR091W was moved 168 nt (56 codons) downstream.<br><br> | ||
+ | '''Zhang Z and Dietrich FS''' (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000082006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/15905473 PubMed] | [https://academic.oup.com/nar/article/33/9/2838/2401448 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=15905473&db=pmid YFGdb]<br> | ||
+ | |- | ||
+ | | 2005-12-01 | ||
+ | | [https://www.yeastgenome.org/locus/YOR221C YOR221C] <br> | ||
+ | Based on multiple sequence alignments and on data published by Davis et al., the intron and first exon have been removed from this gene. This change effectively moves the MCT1/YOR221C start site 273 nts downstream, but does not alter the translation frame of this gene, resulting in a shortened, altered N-terminus.<br><br> | ||
+ | '''Davis CA, et al.''' (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000042737 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10734188 PubMed] | [https://academic.oup.com/nar/article/28/8/1700/1009222 Full-Text] <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br> | ||
+ | |- | ||
+ | | 2005-12-01 | ||
+ | | [https://www.yeastgenome.org/locus/YOR074C YOR074C] <br> | ||
+ | Based on multiple sequence alignments and on data published by Taylor et al., Davis et al., and Poon et al., the intron has been removed from CDC21/YOR074C. The start codon, stop codon, and frame of translation all remain the same, but the sequence previously annotated as an intron is included in the translation.<br><br> | ||
+ | '''Davis CA, et al.''' (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000042737 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10734188 PubMed] | [https://academic.oup.com/nar/article/28/8/1700/1009222 Full-Text] <br> | ||
+ | '''Taylor GR, et al.''' (1987) Molecular characterization of the cell cycle-regulated thymidylate synthase gene of Saccharomyces cerevisiae. J Biol Chem 262(11):5298-307. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000049320 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/3031048 PubMed] | [http://www.jbc.org/content/262/11/5298.long Full-Text] <br> | ||
+ | '''Poon PP and Storms RK''' (1994) Thymidylate synthase is localized to the nuclear periphery in the yeast Saccharomyces cerevisiae. J Biol Chem 269(11):8341-7. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000058478 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/8132557 PubMed] | [http://www.jbc.org/content/269/11/8341.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2005-11-30 | ||
+ | | [https://www.yeastgenome.org/locus/YOR147W YOR147W] <br> | ||
+ | Based on on 5' SAGE TSS data and multiple orthologous sequence alignments published by Zhang and Dietrich, the start site for MDM32/YOR147W was moved 93 nt (31 codons) downstream.<br><br> | ||
+ | '''Zhang Z and Dietrich FS''' (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000082006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/15905473 PubMed] | [https://academic.oup.com/nar/article/33/9/2838/2401448 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=15905473&db=pmid YFGdb]<br> | ||
+ | |- | ||
+ | | 2005-11-30 | ||
+ | | [https://www.yeastgenome.org/locus/YOR330C YOR330C] <br> | ||
+ | Based on 5' end mapping published by Francoise Foury, the start site for MIP1/YOR330C was moved 78 nt (26 codons) downstream.<br><br> | ||
+ | '''Foury F''' (1989) Cloning and sequencing of the nuclear gene MIP1 encoding the catalytic subunit of the yeast mitochondrial DNA polymerase. J Biol Chem 264(34):20552-60. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000048961 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/2684980 PubMed] | [http://www.jbc.org/content/264/34/20552.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2004-10-12 | ||
+ | | [https://www.yeastgenome.org/locus/CEN12 CEN12] <br> | ||
+ | The orientation of this centromere was reversed (from Watson to Crick) to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. and Espelin et al.<br><br> | ||
+ | '''Wieland G, et al.''' (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000059647 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11222754 PubMed] | [https://academic.oup.com/nar/article/29/5/1054/2381189 Full-Text]<br> | ||
+ | '''Espelin CW, et al.''' (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000074756 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/13679521 PubMed] | [https://www.molbiolcell.org/doi/full/10.1091/mbc.e02-08-0533?url_ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed Full-Text]<br> | ||
+ | |- | ||
+ | | 2004-04-21 | ||
+ | | [https://www.yeastgenome.org/locus/YOR069W YOR069W] <br> | ||
+ | Based on the automated comparison of related fungi, Cliften et al. and Brachat et al. suggest that the start site for VPS5/YOR069W be moved 1089 nt upstream, extending the 5' end of the protein an additional 363 amino acids. This suggestion was reviewed and accepted by SGD curators. Evidence supporting this change includes: (1) this is the predicted start methionine in all Saccharomyces species sequenced by Cliften et al. and/or Kellis et al. and (2) this is the start site described in literature characterizing VPS5/YOR069W (Horazdovsky BF, et al.,(1997) Mol Biol Cell. Aug; 8(8):1529-41),(Nothwehr ST, Hindes AE (1997) J Cell Sci. May;110 (Pt 9):1063-72.).<br><br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br> | ||
+ | '''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br> | ||
+ | |- | ||
+ | | 2003-09-27 | ||
+ | | [https://www.yeastgenome.org/locus/YOL048C YOL048C] <br> | ||
+ | Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 5' exon for YOL048C. Brachat et al. confirmed this intron using 5' RACE. The resulting ORF is in the same frame, but has a 236-residue extension at the N-terminus. This change was reviewed and accepted by SGD curators.<br><br> | ||
+ | '''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br> | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YOR125C YOR125C] <br> | ||
+ | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for CAT5/YOR125C be moved 117 nt (39 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The start site predicted previously for S. cerevisiae is not conserved in S. paradoxus (AGG), S. mikatae (AGG), and S. bayanus (AGG); 4) Insertions in S. mikatae and S. bayanus create frame shifts between the up and downstream ATGs; 5) the MitoProt (http://www.mips.biochem.mpg.de/cgi-bin/proj/medgen/mitofilter) program predicts that the shorter protein is localized to the mitochondria, which is confirmed by the literature (see for example Jonassen et al (1998) J Biol Chem 273:3351-7); the longer protein has a lower probability (.97 vs. .55) of mitochondrial localization according to the program; 6) homology to related proteins and conserved domains are downstream of the region between the two ATGs.<br><br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br> | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YOL096C YOL096C] <br> | ||
+ | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for COQ3/YOL096C be moved 12 nt (4 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The start site is not conserved in the closely related species S. paradoxus (CTA), S. mikatae (TTA), or S. bayanus (CCA).<br><br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br> | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YOR037W YOR037W] <br> | ||
+ | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for CYC2/YOR037W be moved 114 nt (38 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The start site predicted previously for ''S. cerevisiae'' is not conserved in ''S. paradoxus'' (GTA), ''S. mikatae'' (ATA), and ''S. bayanus'' (ATA); 4) InDels create frame shifts between the upstream start site and the proposed downstream start site; 5) The MitoProt program predicts that the shorter protein is localized to the mitochondria, which is confirmed by the literature (e.g. Dumont et al); the longer protein has a much lower probability of mitochondrial localization according to the program..<br><br> | ||
+ | '''Dumont ME, et al.''' (1993) CYC2 encodes a factor involved in mitochondrial import of yeast cytochrome c. Mol Cell Biol 13(10):6442-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000040996 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/8413243 PubMed] | [https://mcb.asm.org/content/13/10/6442.long Full-Text] <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br> | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YOR103C YOR103C] <br> | ||
+ | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for OST2/YOR103C be moved 9 nt (3 codons) downstream. This suggestion was reviewed by SGD curators and incorporated on September 22, 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The current start site is not conserved in ''S. paradoxus'' (ATA), ''S. mikatae'' (ACG), and ''S. bayanus'' (ACG).<br><br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br> | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YOL146W YOL146W] <br> | ||
+ | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PSF3/YOL146W be moved 126 nt (42 codons) downstream. This suggestion was reviewed by SGD curators and incorporated on September 22, 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The upstream ATG is conserved in ''S. paradoxus'' and ''S. mikatae'', but insertions create stops between the two ATGs in these species. The upstream ATG (ATA in ''S. bayanus'') and the frame are not conserved in S. bayanus; 4) Protein sequence comparisons against the nr dataset at NCBI show that there is no sequence similarity between ''S. cerevisiae'' and other species between the first and the second ATG; sequence similarity begins after the second methionine. Supporting evidence for this change has also been published by Takayama et al. who showed that the originally annotated upstream start site is not conserved in the ''S. pombe'' or human genes and that the apparent molecular mass of Psf3p is more consistent with the downstream start site.<br><br> | ||
+ | '''Takayama Y, et al.''' (2003) GINS, a novel multiprotein complex required for chromosomal DNA replication in budding yeast. Genes Dev 17(9):1153-65. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073092 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12730134 PubMed] | [http://genesdev.cshlp.org/content/17/9/1153.long Full-Text] <br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br> | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YOR238W YOR238W] <br> | ||
+ | The automated comparison of closely related ''Saccharomyces'' species suggests that the start site for YOR238W be moved 9 nt (3 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br><br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br> | ||
+ | |- | ||
+ | | 2003-09-22 | ||
+ | | [https://www.yeastgenome.org/locus/YOL103W YOL103W] <br> | ||
+ | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for ITR2/YOL103W be moved 9 nt (3 codons) downstream. This suggestion was reviewed and accpeted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of ''Saccharomyces'' species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The upstream start site predicted previously for S. cerevisiae is not conserved in ''S. paradoxus'', ''S. mikatae'', or ''S. bayanus''.<br><br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br> | ||
+ | |- | ||
+ | | 2003-09-09 | ||
+ | | [https://www.yeastgenome.org/locus/TEL15L TEL15L], [https://www.yeastgenome.org/locus/TEL15R TEL15R] <br> | ||
+ | The chromosomal locations for TEL15L, TEL15L-TR, TEL15L-XC, TEL15L-XR, TEL15R, TEL15R-TR, TEL15R-XC, TEL15R-XR, and TEL15R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).<br><br> | ||
+ | |- | ||
+ | | 2003-07-29 | ||
+ | | [https://www.yeastgenome.org/locus/YOL083C-A YOL083C-A], [https://www.yeastgenome.org/locus/YOL097W-A YOL097W-A], [https://www.yeastgenome.org/locus/YOL155W-A YOL155W-A], [https://www.yeastgenome.org/locus/YOR034C-A YOR034C-A], [https://www.yeastgenome.org/locus/YOR072W-B YOR072W-B], [https://www.yeastgenome.org/locus/YOR192C-C YOR192C-C], [https://www.yeastgenome.org/locus/YOR293C-A YOR293C-A] <br> | ||
+ | Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XV ORFs: YOR072W-B, YOL083C-A, YOL097W-A, YOL155W-A, YOR034C-A, YOR192C-C, and YOR293C-A.<br><br> | ||
+ | '''Basrai MA, et al.''' (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000042214 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10490641 PubMed] | [https://mcb.asm.org/content/19/10/7041.long Full-Text] <br> | ||
+ | '''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br> | ||
+ | '''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073672 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] | [https://genome.cshlp.org/content/12/8/1210.long Full-Text] | [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br> | ||
+ | |- | ||
+ | | 2003-07-29 | ||
+ | | [https://www.yeastgenome.org/locus/YOL013W-A YOL013W-A], [https://www.yeastgenome.org/locus/YOL038C-A YOL038C-A] | ||
+ | Thanks to [https://bioinformatik.wzw.tum.de/index.php?id=63 MIPS] for providing the coordinates of the following Chromosome XV ORFs: YOL013W-B and YOL038C-A.<br><br> | ||
+ | |- | ||
+ | | 2003-07-29 | ||
+ | | [https://www.yeastgenome.org/locus/YOL019W-A YOL019W-A], [https://www.yeastgenome.org/locus/YOL085W-A YOL085W-A], [https://www.yeastgenome.org/locus/YOL166W-A YOL166W-A], [https://www.yeastgenome.org/locus/YOR032W-A YOR032W-A], [https://www.yeastgenome.org/locus/YOR108C-A YOR108C-A], [https://www.yeastgenome.org/locus/YOR161C-C YOR161C-C], [https://www.yeastgenome.org/locus/YOR161W-A YOR161W-A], [https://www.yeastgenome.org/locus/YOR161W-B YOR161W-B], [https://www.yeastgenome.org/locus/YOR186C-A YOR186C-A], [https://www.yeastgenome.org/locus/YOR231C-A YOR231C-A], [https://www.yeastgenome.org/locus/YOR335W-A YOR335W-A], [https://www.yeastgenome.org/locus/YOR394C-A YOR394C-A], [https://www.yeastgenome.org/locus/YOR396C-A YOR396C-A] <br> | ||
+ | Thanks to Kumar et al. for providing the coordinates of the following Chromosome XV ORFs: YOL019W-A, YOR394C-A, YOR396C-A, YOL166W-A, YOR032W-A, YOR108C-A, YOR161C-C, YOR161W-A, YOR161W-B, YOR186C-A, YOR231C-A, YOR335W-A, and YOL085W-A.<br><br> | ||
+ | '''Kumar A, et al.''' (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073673 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11753363 PubMed] | [https://www.nature.com/articles/nbt0102-58 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11753363&db=pmid YFGdb] | [https://www.yeastgenome.org/reference/S000141796 Comments & Errata] <br> | ||
+ | |- | ||
+ | | 2003-07-29 | ||
+ | | [https://www.yeastgenome.org/locus/YOR020W-A YOR020W-A] <br> | ||
+ | Thanks to Brachat et al. for providing the coordinates of YOR020W-A.<br><br> | ||
+ | '''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br> | ||
+ | |- | ||
+ | | 2003-07-29 | ||
+ | | [https://www.yeastgenome.org/locus/YOL164W-A YOL164W-A], [https://www.yeastgenome.org/locus/YOR011W-A YOR011W-A], [https://www.yeastgenome.org/locus/YOR072W-A YOR072W-A], [https://www.yeastgenome.org/locus/YOR073W-A YOR073W-A], [https://www.yeastgenome.org/locus/YOR316C-A YOR316C-A], [https://www.yeastgenome.org/locus/YOR329W-A YOR329W-A], [https://www.yeastgenome.org/locus/YOR376W-A YOR376W-A], [https://www.yeastgenome.org/locus/YOR381W-A YOR381W-A] <br> | ||
+ | Thanks to Kessler et al. for providing the coordinates for the following Chromosome XV ORFs: YOR072W-A, YOR316C-A, YOR376W-A, YOR381W-A, YOR329W-A, YOR073W-A, YOR011W-A, and YOL164W-A.<br><br> | ||
+ | '''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073671 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] | [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2003-01-09 | ||
+ | | [https://www.yeastgenome.org/locus/YOL002C YOL002C] <br> | ||
+ | The start site of YOL002C has been moved 30 nt downstream from 324394 to 324364. Chromosomal coordinates change from old:324394-323441 to new:324364-323411. Relative coordinates go from old:1-984 to new:1-954. Thanks to Gillian Small for reporting this sequence annotation change to SGD.<br><br> | ||
+ | '''Karpichev IV, et al.''' (2002) Multiple regulatory roles of a novel Saccharomyces cerevisiae protein, encoded by YOL002c, in lipid and phosphate metabolism. J Biol Chem 277(22):19609-17. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000069897 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11916977 PubMed] | [http://www.jbc.org/content/277/22/19609.long Full-Text] <br> | ||
+ | |- | ||
+ | | 2001-03-08 | ||
+ | | [https://www.yeastgenome.org/locus/snR31 snR31] <br> | ||
+ | Changed the orientation of SNR31 from Watson to Crick (old start coord = 841953; old stop coord = 842177; new start coord = 842177; new stop coord = 841953).<br><br> | ||
+ | '''Dandekar T and Tollervey D''' (1993) Identification and functional analysis of a novel yeast small nucleolar RNA. Nucleic Acids Res 21(23):5386-90. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000050561 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/8265353 PubMed] | [https://academic.oup.com/nar/article/21/23/5386/1050939 Full-Text] <br> | ||
+ | '''Balakin AG, et al.''' (1993) SnR31, snR32, and snR33: three novel, non-essential snRNAs from Saccharomyces cerevisiae. Nucleic Acids Res 21(23):5391-7. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000050562 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/8265354 PubMed] | [https://academic.oup.com/nar/article/21/23/5391/1050948 Full-Text] <br> | ||
+ | |- | ||
+ | | 2001-03-06 | ||
+ | | [https://www.yeastgenome.org/locus/ARS1502 ARS1502] <br> | ||
+ | Courtesy of Prof. BiK Tye; based on Ph. D. thesis of Dr. Clarence Chan <br><br> | ||
+ | |- | ||
+ | | 2000-10-17 | ||
+ | | [https://www.yeastgenome.org/locus/ARS1501 ARS1501] <br> | ||
+ | ARS1021 (aka ARS121) and ARS1501 were added to the genome annotation after personal communication from Shlomo Eisenberg. See Walker et al. 1991 for ARS1021 and Raychaudhuri et al. 1997 for ARS1501. <br><br> | ||
+ | '''Raychaudhuri S, et al.''' (1997) Functional analysis of a replication origin from Saccharomyces cerevisiae: identification of a new replication enhancer. Nucleic Acids Res 25(24):5057-64. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000044083 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9396816 Full-Text] | [https://academic.oup.com/nar/article/25/24/5057/1749133 Full-Text] <br> | ||
+ | '''Walker SS, et al.''' (1991) Analysis of the interactions of functional domains of a nuclear origin of replication from Saccharomyces cerevisiae. Nucleic Acids Res 19(22):6255-62. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000049529 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/1956786 PubMed] | [https://academic.oup.com/nar/article/19/22/6255/1015625 Full-Text] <br> | ||
+ | |- | ||
+ | | 2000-08-14 | ||
+ | | [https://www.yeastgenome.org/locus/YOR239W YOR239W], [https://www.yeastgenome.org/locus/YOR240W YOR240W] <br> | ||
+ | Annotation change: it has been reported in Asakura et al. 1998 that a +1 translational frameshift merges YOR239W and YOR240W into one ORF. YOR240W is now an alias for YOR239W and YOR239W encompasses both the ORFs.<br><br> | ||
+ | '''Asakura T, et al.''' (1998) Isolation and characterization of a novel actin filament-binding protein from Saccharomyces cerevisiae. Oncogene 16(1):121-30. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000041861 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9467951 PubMed] | [https://www.nature.com/articles/1201487 Full-Text] <br> | ||
+ | |- | ||
+ | | 2000-08-11 | ||
+ | | [https://www.yeastgenome.org/locus/YOL052C-A YOL052C-A] <br> | ||
+ | Old name: YOL053C-A; new name: YOL052C-A; date: 11/1998; old coord: ChrXV 231753 231568; SGDID: S0005413; Name changed due to nomenclature <br><br> | ||
+ | |- | ||
+ | | 2000-07-14 | ||
+ | | [https://www.yeastgenome.org/locus/YOL047C YOL047C] <br> | ||
+ | The annotations of the start site and 3' intron boundary of YOL047C were both changed, so that the relative coding coordinates change from 1-1..189-892 to 1-243..307-1134. Note that the stop site and the 5' boundary of the intron were not changed. ''Chromosomal coordinates for the coding region change from 242503-242503..242315-241612 to 242745-242503..242439-241612.'' <br><br> | ||
+ | |- | ||
+ | | 1999-07-17 | ||
+ | | [https://www.yeastgenome.org/locus/YOL075C YOL075C] <br> | ||
+ | The start site of YOL075C was moved 597 bases upstream. ''Chromosomal coordinates change from 194944-189657 to 193541-189657.'' <br><br> | ||
+ | |- | ||
+ | | 1998-05-21 | ||
+ | | [https://www.yeastgenome.org/locus/YOL013W-A YOL013W-A], [https://www.yeastgenome.org/locus/YOR298C-A YOR298C-A] <br> | ||
+ | The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. <br><br> | ||
+ | The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD. <br><br> | ||
+ | '''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br> | ||
+ | |- | ||
+ | | 1997-07-01 | ||
+ | | [https://www.yeastgenome.org/locus/YOR304C-A YOR304C-A] <br> | ||
+ | The original annotation of the YOR304C-A ORF was incorrect because it included one additional nucleotide past the stop codon. The stop coordinate has now been corrected so that this extra "G" nucleotide is no longer included. <br><br> | ||
+ | |||
+ | |} |
Latest revision as of 16:14, 2 October 2019
This page lists all sequence and annotation changes that have been made to the Chromosome XV systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome XV has been updated 63 times, affecting 53 features.
- The annotation of Chromosome XV has been updated 51 times, affecting 90 features.
- Current and past versions can be obtained from SGD's Download site.
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YOL138C | 64173 | 64173 | Substitution | G | C |
61985 | 61985 | Substitution | A | T | ||
63708 | 63708 | Substitution | C | T | ||
Nucleotide change(s) in the coding region of RTC1/YOL138C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 393 is now Cysteine rather than Serine, and residue 548 is now Aspartic Acid rather than Glycine.
New 61970 CGCATGTCTGGGCGATCCGATTATTGGTGCTGTATGGGAAGAAAGCTTTTTAAAAGTTTC 62029 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 61970 CGCATGTCTGGGCGAACCGATTATTGGTGCTGTATGGGAAGAAAGCTTTTTAAAAGTTTC 62029 New 63660 GTAGGTTGAAGCTCCGGTTCTACCACCTCATATGAGCCTATCTCTTGGTCAACTGAAAGT 63719 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 63660 GTAGGTTGAAGCTCCGGTTCTACCACCTCATATGAGCCTATCTCTTGGCCAACTGAAAGT 63719 New 64140 GCATTGGCATTGTCGCCAACAAACCAGAGGCAGCATTTACCGTCTCTACCACCTGTAGCA 64199 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 64140 GCATTGGCATTGTCGCCAACAAACCAGAGGCAGGATTTACCGTCTCTACCACCTGTAGCA 64199 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL142W | 56036 | 56036 | Substitution | C | G |
Nucleotide change(s) in the coding region of RRP40/YOL142W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 160 is now Leucine rather than Phenylalanine.
New 55991 CTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTGAATTTCGCACGCC 56050 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 55990 CTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTCAATTTCGCACGCC 56049 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL141W | 57699 | 57699 | Substitution | A | T |
Nucleotide change(s) in the coding region of PPM2/YOL141W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 417 is now Leucine rather than Methionine.
New 57661 GGAGGTAGTAACCCATACAGAGTAAACGAAATATTACAGTTGAGTATACACTACGACAAA 57720 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old 57660 GGAGGTAGTAACCCATACAGAGTAAACGAAATATTACAGATGAGTATACACTACGACAAA 57719 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL077C | 186243 | 186243 | Substitution | A | C |
Nucleotide change(s) in the coding region of BRX1/YOL077C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 161 is now Glycine rather than Cysteine.
New 186230 TTTGGTGGTACACCAAAATTATGCACTAGCAACTCCTTAATTAATTGGTAGTGTGGGGAG 186289 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 186230 TTTGGTGGTACACAAAAATTATGCACTAGCAACTCCTTAATTAATTGGTAGTGTGGGGAG 1862890 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL075C | 190052 | 190052 | Substitution | CG | GC |
Nucleotide change(s) in the coding region of YOL075C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1164 is now Alanine rather than Arginine.
New 190020 TTTCGAAAAATGTATTTGTCATTATACCAAGAGCTTCGCCACAACAGGTAACAATAAAGG 190079 |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 190020 TTTCGAAAAATGTATTTGTCATTATACCAAGACGTTCGCCACAACAGGTAACAATAAAGG 190079 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR306C | 889947 | 889947 | Substitution | G | C |
Nucleotide change(s) in the coding region of MCH5/YOR306C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 495 is now Cysteine rather than Serine.
New 889913 ATGTAGCAAACAGCGCTTACAAAAGTTGCCAAACCGCAAAAAATAATATAGTGTTGGTAA 889972 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 889911 ATGTAGCAAACAGCGCTTACAAAAGTTGCCAAACCGGAAAAAATAATATAGTGTTGGTAA 889970 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR149C | 611036 | 611036 | Substitution | A | G |
611023 | 611024 | Substitution | GC | TG | ||
Nucleotide change(s) in the coding region of SMP3/YOR149C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 122-123 are now IK rather than MQ.
New 610993 TACGTAAGAAGTTAAAAGTAGACTTTTTTTGATGAATTGTACGGCCTTTCTCTCATCCCT 611052 ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| Old 610994 TACGTAAGAAGTTAAAAGTAGACTTTTTTGCATGAATTGTACAGCCTTTCTCTCATCCCT 611053 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR140W | 588363 | 588365 | Substitution | GCG | AGC |
588344 | 588344 | Deletion | C | |||
588318 | 588318 | Insertion | T | |||
Nucleotide change(s) in the coding region of SFL1/YOR140W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 446-462 are now FVQYQPQSQQHVTYAKQ rather than LYNTNRSRNQHVTYASE.
New 588314 TTTTTGTACAATACCAACCGCAGTCGCAAC-AACATGTGACTTATGCGAAGCAACCGGCA 588372 |||| ||||||||||||||||||||||||| |||||||||||||||||| |||||||| Old 588315 TTTT-GTACAATACCAACCGCAGTCGCAACCAACATGTGACTTATGCGAGCGAACCGGCA 588373 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL058W | 220195 | 220195 | Deletion | T | |
220207 | 220207 | Insertion | C | |||
Nucleotide change(s) in the coding region of ARG1/YOL058W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 329-332 are now SYFT rather than FLLH.
New 220179 TTGATATATAACGGTT-CCTACTTCACCCCAGAGTGTGAGTACATCAGATCTATGATCCA 220238 |||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| Old 220179 TTGATATATAACGGTTTCCTACTTCACCC-AGAGTGTGAGTACATCAGATCTATGATCCA 220237 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR130C | 570495 | 570495 | Substitution | A | G |
Nucleotide change(s) in the coding region of ORT1/YOR130C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 105 is now Serine rather than Phenylalanine.
New 570474 TCAGGATTTGCCCCAACGGGGAAACGTTTGTATGTTTTTCTAAAAATTTAGAACATTGGT 570533 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 570475 TCAGGATTTGCCCCAACGGGAAAACGTTTGTATGTTTTTCTAAAAATTTAGAACATTGGT 570534 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR297C | 874911 | 874911 | Substitution | C | T |
Nucleotide change(s) in the coding region of TIM18/YOR297C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 137 is now Glutamic Acid rather than Glycine.
New 874863 TCCTCCATAGAGGCAATAAAGGGCGAGCTTATGCCATCTTGGATACTTTTCCTTCGGTAT 874922 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 874862 TCCTCCATAGAGGCAATAAAGGGCGAGCTTATGCCATCTTGGATACTTTCCCTTCGGTAT 874921 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL022C | 280393 | 280393 | Substitution | A | G |
A single nucleotide substitution was made within ORF TSR4/YOL022C. Note that the protein sequence was not changed.
New 280377 GGTACCCCATTCCATGCCGTTATCGACAGACACTACTTCTTCCAGATCAAAAATCATCTT 280436 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 280378 GGTACCCCATTCCATACCGTTATCGACAGACACTACTTCTTCCAGATCAAAAATCATCTT 280437 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR255W, YOR256C | 808197 | 808197 | Insertion | A | |
A single nucleotide insertion was made in the intergenic region between ORFs OSW1/YOR255W and TRE2/YOR256C.
New 808183 TTACATAATTAAAGAAAAAATTTTATTAACATACTTCCTTATACTTACAATATGTATTCT 808242 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 808184 TTACATAATTAAAG-AAAAATTTTATTAACATACTTCCTTATACTTACAATATGTATTCT 808242 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR298C-A, YOR299W | 877795 | 877795 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs MBF1/YOR298C-A and BUD7/YOR299W.
New 877783 CTATTATTGGTTAAGCGACAGGCGCCTTTCCAGCTACCTAATATATACCACCACCGTCAA 877842 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 877782 CTATTATTGGTTAA-CGACAGGCGCCTTTCCAGCTACCTAATATATACCACCACCGTCAA 877840 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | ARS1531 | 35765 | 35765 | Substitution | G | C |
A single nucleotide substitution was made within ARS1531.
New 35751 TTTTCAAAATCCGCGCAAAATTATAGAATTCATCATATATAATGAAGGAACTGTGTTCCT 35810 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 35750 TTTTCAAAATCCGCGGAAAATTATAGAATTCATCATATATAATGAAGGAACTGTGTTCCT 35809 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2004-01-23 | ARS1531, YOL152W | 36149 | 36149 | Substitution | G | A |
36119 | 36119 | Substitution | G | C | ||
36056 | 36056 | Substitution | G | A | ||
36013 | 36013 | Substitution | T | A | ||
Four separate single nucleotide substitutions were made in the intergenic region between ARS1531 and ORF FRE7/YOL152W.
New 36001 AAAACTTGAGAATAACATAACCCTTTAATAGGCCAATGCAACTGATAGAACACCAGAAAA 36060 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| Old 36000 AAAACTTGAGAATTACATAACCCTTTAATAGGCCAATGCAACTGATAGAACACCAGGAAA 36059 New 36061 AGTTGTAATGCCAGTGCGGCTGAACAGAATCTGTGGTAATAGATTTCGGGTATAATGCGC 36120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 36060 AGTTGTAATGCCAGTGCGGCTGAACAGAATCTGTGGTAATAGATTTCGGGTATAATGCGG 36119 New 36121 AAATTAGGAATACTCATATGTTCAGATAGAATAAATAATAAAGAGACCTTCAACATAAAA 36180 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old 36120 AAATTAGGAATACTCATATGTTCAGATAGGATAAATAATAAAGAGACCTTCAACATAAAA 36179 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR256C | 809751 | 809751 | Substitution | C | T |
A single nucleotide substitution was made within ORF TRE2/YOR256C. Note that the protein sequence was not changed.
New 809693 GTCTATATTCTCACCATATGGCTCAGATATGAAGATTACAGCTTTAGCTCCGAATTTCTC 809762 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 809693 GTCTATATTCTCACCATATGGCTCAGATATGAAGATTACAGCTTTAGCCCCGAATTTCTC 809762 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL125W | 84121 | 84121 | Substitution | T | C |
A single nucleotide substitution was made within ORF TRM13/YOL125W.
New 84110 AAAAAATGCAACAAGACCAAACTAAGCCATTTAAACGATGATAAGCCATACTATGAACCG 84169 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 84110 AAAAAATGCAATAAGACCAAACTAAGCCATTTAAACGATGATAAGCCATACTATGAACCG 84169 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL058W, YOL059W | 219000 | 219000 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs GPD2/YOL059W and ARG1/YOL058W.
New 218990 ATGACTGCGTAGCGGCAGATAGTGTAATCTGAGCAGTTGCGAGACCCAGACTGGCACTGT 219049 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 218990 ATGACTGCGTA-CGGCAGATAGTGTAATCTGAGCAGTTGCGAGACCCAGACTGGCACTGT 219048 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL036W, snR50 | 259235 | 259235 | Deletion | A | |
259230 | 259230 | Deletion | T | |||
Two single nucleotide deletions were made in the intergenic region between ORF YOL036W and snoRNA SNR50.
New 259199 ATTAGGATGGTAGCCCTACCTTTTTTTTTTTT-GGCA-CACATGGTCAACTTTTCTTCTC 259256 |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| Old 259198 ATTAGGATGGTAGCCCTACCTTTTTTTTTTTTTGGCAACACATGGTCAACTTTTCTTCTC 259257 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR106W, YOR107W | 521099 | 521099 | Deletion | C | |
521071 | 521071 | Insertion | A | |||
A single nucleotide insertion and a single nucleotide deletion were made in the intergenic region between ORFs VAM3/YOR106W and RGS2/YOR107W.
New 521055 TGGAGATGAAAAAAAAACTTGCTGAATAAAGATAGTTAAGGCGC-TAGTAATCAAATTAA 521113 |||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| Old 521056 TGGAGATGAAAAAAAA-CTTGCTGAATAAAGATAGTTAAGGCGCCTAGTAATCAAATTAA 521114 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR090C, YOR091W | 492979 | 492979 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs PTC5/YOR090C and TMA46/YOR091W.
New 492955 TACCCTCCAATCGATCCTTTTTTTCTTTTTTGTATCTTGTGTAGAAAGAAGTGAATCCTG 493014 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old 492957 TACCCTCCAATCGATCCTTTTTT-CTTTTTTGTATCTTGTGTAGAAAGAAGTGAATCCTG 493015 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL145C | 52199 | 52199 | Substitution | C | T |
50767 | 50767 | Substitution | C | T | ||
50430 | 50431 | Substitution | GG | CC | ||
50081 | 50081 | Substitution | T | C | ||
50069 | 50069 | Substitution | G | T | ||
49941 | 49941 | Substitution | G | T | ||
49922 | 49922 | Substitution | T | A | ||
49919 | 49919 | Substitution | A | T | ||
49912 | 49912 | Substitution | A | T | ||
49829 | 49829 | Substitution | G | T | ||
Several nucleotide changes were made in the coding region of CTR9/YOL145C, resulting in an altered protein sequence. The start, stop, and reading frame remain the same, but with the following changes: Gly197->Lys, Gly674->Glu, Thr786->Arg, Lys903->Glu, Arg907->Ser, residues 956-959 are now LIQE not IFQV, and Glu987->Lys.
New 49811 GTCTTGGCTTTTCTTCGTCATATTCATTGTCTTTATCAGACAGATCTGAA 49870 ||||||||| |||||||||||||||||||||||||||||||||||||||| Old 49820 GTCTTGGCTGTTCTTCGTCATATTCATTGTCTTTATCAGACAGATCTGAA 49869 New 49871 TCATCTTTAACATTATGTTCACTTATGGCCATGGCTTCTCGCTCCTGGAT 49920 |||||||||||||||||||||||||||||||||||||||||| |||||| Old 49870 TCATCTTTAACATTATGTTCACTTATGGCCATGGCTTCTCGCACCTGGAA 49919 New 49921 TAACTTTTGTGCCTCATCTTGTAGTTTCCTATACTCCTCTGCCTGTTTTT 49970 || |||||||||||||||||| |||||||||||||||||||||||||||| Old 49920 TATCTTTTGTGCCTCATCTTGGAGTTTCCTATACTCCTCTGCCTGTTTTT 49969 New 50041 AATTTTACGTGCTTCATCAATTTTGGCGCTTTGTTCCTTCTCAAATTCTT 50090 ||||||||||||||||||||||||||||| ||||||||||| |||||||| Old 50040 AATTTTACGTGCTTCATCAATTTTGGCGCGTTGTTCCTTCTTAAATTCTT 50089 New 50401 TTCCAAGGCTTTTTGATAAAAATTCACAGACCTTTCCTTAATGGCACGTG 50450 |||||||||||||||||||||||||||||| |||||||||||||||||| Old 50400 TTCCAAGGCTTTTTGATAAAAATTCACAGAGGTTTCCTTAATGGCACGTG 50449 New 50761 TGATTTTTCCTGTTCCTTTGGATTCCTGGACTTTTTACCGTCTCTGGCAA 50810 ||||||| |||||||||||||||||||||||||||||||||||||||||| Old 50760 TGATTTTCCCTGTTCCTTTGGATTCCTGGACTTTTTACCGTCTCTGGCAA 50809 New 52161 GCAATTCTTGAAAAATTTTCAGACTGGCCATATAATTTTTCTTCTGATAA 52210 ||||||||||||||||||||||||||||||||||||||| |||||||||| Old 52160 GCAATTCTTGAAAAATTTTCAGACTGGCCATATAATTTTCCTTCTGATAA 52209 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL140W, YOL141W | 58601 | 58601 | Substitution | C | G |
58558 | 58558 | Deletion | T | |||
A single nucleotide deletion and a single nucleotide substitution were made in the intergenic region between ORFs PPM2/YOL141W and ARG8/YOL140W.
New 58550 GGATTCGA-ATGGTTGCCAGCTCGCTATGTGACTCACTTAAAGTACATGATGCGTCATTG 58609 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Old 58550 GGATTCGATATGGTTGCCAGCTCGCTATGTGACTCACTTAAAGTACATGATCCGTCATTG 58609 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL139C, YOL140W | 60173 | 60173 | Substitution | A | G |
A single nucleotide substitution was made in the intergenic region between ORFs ARG8/YOL140W and CDC33/YOL139C.
New 60130 CTTACGTGATATGTACATGTGGTGCGTCTTTCATACCTTGAATGATATAATTAATAAGAG 60189 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 60130 CTTACGTGATATGTACATGTGGTGCGTCTTTCATACCTTGAATAATATAATTAATAAGAG 60189 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL135C, YOL136C | 69084 | 69084 | Substitution | C | T |
A single nucleotide substitution was made in the intergenic region between ORFs PFK27/YOL136C and MED7/YOL135C.
New 69060 AACCGAGTAATCCAATTTACTTTTTCTACTTTTTTTTCATTATCAATCGATTCAGATGCC 69119 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Old 69060 AACCGAGTAATCCAATTTACTTTTCCTACTTTTTTTTCATTATCAATCGATTCAGATGCC 69119 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR008C-A, YOR008W-B | 343142 | 343142 | Insertion | A | |
A single nucleotide insertion was made in the intergenic region between ORFs YOR008C-A and YOR008W-B.
New 343127 GAAGTATGTAAAAAAATTACACACCATTAAGTTCTTATGTAAACCGAAGTCTGGAAGAGA 343186 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 343128 GAAGTATGTAAAAAA-TTACACACCATTAAGTTCTTATGTAAACCGAAGTCTGGAAGAGA 343186 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR261C, YOR262W | 816959 | 816959 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs RPN8/YOR261C and YOR262W.
New 816943 TTTCCTTTCTTTCTTTCTTTTTTTAAATTCGAAAAATGCCCTCAATCAGTAGCAGTTGTA 817002 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 816943 TTTCCTTTCTTTCTTTC-TTTTTTAAATTCGAAAAATGCCCTCAATCAGTAGCAGTTGTA 817001 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL076W, YOL077C | 186978 | 186979 | Substitution | CG | GC |
A single nucleotide substitution was made in the intergenic region between ORFs BRX1/YOL077C and MDM20/YOL076W.
New 186960 ACAGAATTCATTGGCGAAGCAACGATACATAACGAGCTCGGTACAGCAATCATCGCATCG 187019 |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Old 186960 ACAGAATTCATTGGCGAACGAACGATACATAACGAGCTCGGTACAGCAATCATCGCATCG 187019 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL062C, YOL063C | 210486 | 210487 | Substitution | AC | CA |
210453 | 210454 | Substitution | AC | CA | ||
Two separate dinucleotide substitutions were made in the intergenic region between ORFs CRT10/YOL063C and APM4/YOL062C.
New 210440 TTAACAAAATGTGCATTCTAAAGGAAATTACTATAAAAAATACAGGCATGATAAAAATAT 210499 ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| Old 210440 TTAACAAAATGTGACTTCTAAAGGAAATTACTATAAAAAATACAGGACTGATAAAAATAT 210499 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR306C, YOR307C | 892173 | 892173 | Insertion | C | |
A single nucleotide insertion was made in the intergenic region between ORFs MCH5/YOR306C and SLY41/YOR307C.
New 892133 TTTCTCTCAACCTTTCGAGTACTTGGAAAAAGGAGTAGATCCGCTTTCAGCAATCGAAGC 892192 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 892131 TTTCTCTCAACCTTTCGAGTACTTGGAAAAAGGAGTAGATCCG-TTTCAGCAATCGAAGC 892189 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR354C, YOR355W | 1004737 | 1004737 | Deletion | T | |
A single nucleotide deletion was made in the intergenic region between ORFs MSC6/YOR354C and GDS1/YOR355W.
New 1004693 TCAGCATTCCATTATTGAAGGCTTTAAAATAATAGTTTCTTTTTTCC-TATTATTTTATT 1004751 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 1004690 TCAGCATTCCATTATTGAAGGCTTTAAAATAATAGTTTCTTTTTTCCTTATTATTTTATT 1004749 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR045W, YOR046C | 414326 | 414326 | Deletion | T | |
A single nucleotide deletion was made in the intergenic region between ORFs TOM6/YOR045W and DBP5/YOR046C.
New 414297 ATATGCTGTGTTTGTATTTATATAAGCTT-GCCTCACAAGTAAAAGTGGATCAACAAACT 414355 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old 414297 ATATGCTGTGTTTGTATTTATATAAGCTTTGCCTCACAAGTAAAAGTGGATCAACAAACT 414356 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOL163W, YOL164W | 8476 | 8476 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs BDS1/YOL164W and YOL163W.
New 8461 AGAGCTTTTCGTATATTCTGTTTTCCTAATAACATTTACTATTGTGAATTGAAATTTAAA 8520 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 8461 AGAGCTTTTCGTATAT-CTGTTTTCCTAATAACATTTACTATTGTGAATTGAAATTTAAA 8519 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YOR049C, YOR050C | 423752 | 423752 | Deletion | T | |
A single nucleotide deletion was made in the intergenic region between ORFs RSB1/YOR049C and YOR050C.
New 423716 CGAAGGTTCGGTACCATACCACCATAAAGGGAATT-ACTGTTAGCTGCTGCTTCTAACTG 423774 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old 423717 CGAAGGTTCGGTACCATACCACCATAAAGGGAATTTACTGTTAGCTGCTGCTTCTAACTG 423776 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2006-01-05 | YOL152W | 42535 | 42535 | Insertion | G | |
A sequencing error was demonstrated in BY4741 (a derivative of S288C) by Mark Rinnerthaler and Michael Breitenbach, and SGD has updated the sequence accordingly. As a consequence of this change, the stop codon has been moved 27 nts upstream, shortening the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 629 to 620 amino acids. (Personal communication from MIPS, Mark Rinnerthaler and Michael Breitenbach)
New: 42507 AAGGTATACCGTCGGAAATTCCGTGGCAGGTTTACAGGCC 42546 ||||||||||||||||||||||||||||| |||||||||| Old: 42507 AAGGTATACCGTCGGAAATTCCGTGGCAG-TTTACAGGCC 42545 | ||||||
2006-01-05 | YOR252W | 803745 | 803745 | Insertion | G | |
SGD confirmed the sequence error predicted by the work of Kellis, et al, and have updated the systematic sequence accordingly.
New: 803730 ACGGTTCATCCGAAGGGTAGAAAGTATGAAAAGCT 803764 |||||||||||||||| |||||||||||||||||| Old: 803730 ACGGTTCATCCGAAGG-TAGAAAGTATGAAAAGCT 803763 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-02-13 | YOR298C-A | 877622 | 877622 | Insertion | GC | |
Two nucleotides GC were inserted after the G at coordinate 877622 in what had previously been annotated as the intergenic region between YOR298C-A and YOR299W. This region is now part of YOR298C-A, as the start for this ORF was moved 279 bp upstream from 877403 to 877682 (note that YOR298C-A is encoded on the Crick strand). As a result, YOR298C-Ap was increased from 58 aa to 151 aa. See Brachat et al. 2003 and GenBank AY260886. This change was also predicted by Kellis et al. and Cliften et al.
Query: 361 AATTTGGCCTTGAGATCTGGCAACGTTGGCCCTTGGGCCAGAACCACCAGCTCTTGCTCT 420 |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 877587 AATTTGGCCTTGAGATCTGGCAACGTTGGCCCTTGG--CAGAACCACCAGCTCTTGCTCT 877644 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2003-01-09 | YOR087W, YOR088W | 488439 | 488439 | Insertion | T | |
Due to the insertion of a T after the A at 488439 on chromosome 15, YOR087W and YOR088W have been merged to one single ORF - YVC1/YOR087W, with YOR088W as an alias. The old chromosomal coordinates for YOR087W were 487708-488451, and for YOR088W were 488286-489734. The new chromosomal coordinates for the fused ORF are 487708-489735. The old relative coordinates for YOR087W were 1-744, and for YOR088W were 1-1449. The new relative coordinates for the fused ORF are 1-2028. Denis V and Cyert MS (2002) Internal Ca(2+) release in yeast is triggered by hypertonic shock and mediated by a TRP channel homologue. J Cell Biol 156(1):29-34. | ||||||
2001-05-31 | YOR068C, YOR069W | 453804 | 453804 | Insertion | G | |
Inserted one G nucleotide after the G at chromosomal coordinate 453805, in the intergenic region to the left of overlapping ORFs YOR068C and YOR068W:
Old: 453752 ATCCTGCAATAACAAGCCATGGACTACGAGGATAATCTAGAAGCACCTGTTTGG-ACGAA 453810 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| New: 453752 ATCCTGCAATAACAAGCCATGGACTACGAGGATAATCTAGAAGCACCTGTTTGGGACGAA 453811 | ||||||
1997-08-11 | YOL025W | 276609 | 276609 | Substitution | G | A |
A single nucleotide substitution was made in the systematic sequence in the region covering the ORF LAG2/YOL025W. The G at 276609 was changed to an A.
New: 276601 AAAGCAGGAAATTTTACCCAAAAAATTGATGAAGGAGTGACCTTAAGAACAATGATTCTT 276660 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Old: 276601 AAAGCAGGGAATTTTACCCAAAAAATTGATGAAGGAGTGACCTTAAGAACAATGATTCTT 276660 |
Annotation Changes without sequence changes
Date | Affected Features |
---|---|
2014-11-19 | ARS1501, ARS1507, ARS1508, ARS1509, ARS1513, ARS1519, ARS1523, ARS1526 The chromosomal coordinates of the following ARS elements on Chromosome XV were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1507, ARS1508, ARS1509, ARS1513, ARS1501, ARS1519, ARS1523, ARS1526. |
2014-11-19 | ARS1501, ARS1507, ARS1508, ARS1509, ARS1510, ARS1511, ARS1521, ARS1524, ARS1528, ARS1531 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome XV based on Liachko et al. 2013: ARS1531, ARS1507, ARS1508, ARS1509, ARS1510, ARS1511, ARS1501, ARS1521, ARS1524, ARS1528. |
2014-11-19 | YOR031W The feature_type annotation of CRS5/YOR031W was changed from ORF to blocked_reading_frame (SO:0000718) as part of SGD's genome annotation revision R64.2. |
2014-11-19 | YOL153C The feature_type annotation of YOL153C was changed from pseudogene to blocked_reading_frame (SO:0000718) as part of SGD's genome annotation revision R64.2. |
2014-11-18 | ETC2, ETC7 The following previously unmapped features were identified as nuclear matrix attachment sites and assigned chromosomal coordinates based on Hiraga et al. 2012 as part of SGD's genome annotation revision R64.2: ETC1, ETC2, ETC3, ETC4, ETC6, ETC7, ETC8. |
2010-01-05 | YOR080W The annotated start ATG of ORF YOR080W/DIA2 has been moved to Met15, based on Morohashi et al. 2009. Old chromosomal coordinates were 474554..476794; the new chromosomal coordinates are 474596..476794. Thanks to Karim Labib for bringing this annotation correction to the attention of SGD. |
2009-05-05 | ARS1512, ARS1518 The following ARS elements on Chromosome XV were added to the genome annotation based on Raveendranathan et al. 2006: ARS1512 and ARS1518. |
2007-07-10 | YOR312C The start of ORF RPL20B/YOR312C was moved 13 nt upstream, and the 5' end of the intron was moved 19 nt upstream, based on GenBank EF138822, Miura et al. 2006, and Zhang et al. 2007. The ORF had been annotated as 932 nt with a 407-nt intron (174 aa), but is now 945 nt long with a 426-nt intron (172 aa). |
2007-05-10 | snR36 Updated coordinates of snR36 based on Samarsky et al. 1995 and GenBank L33804. Old coordinates were 680997..680643 (355 nt), new coordinates are 680867..680686 (182 nt). |
2007-05-10 | snR35 Updated coordinates of snR35 based on Samarsky et al. 1995 and GenBank L33803. Old coordinates were 759730..759191 (540 nt) and new coordinates are 759530..759327 (204 nt). |
2007-02-07 | YOR396W The start site for YOR396W/YRF1-8, one of several telomeric Y' element-encoded helicases, was moved 1716 bp (572 codons) upstream.
The gene model of YOR396W was shorter and lacked a substantial N-terminal part when compared to the other Y' helicases encoded by the YRF1 genes, although the reading frame could be extended at the N-terminus to match the other genes without problem. The shorter gene model may have originated from Louis & Haber 1992 and the prediction found in EMBL:U23472. The strain (YP1) sequenced in this study has a frameshift at position 1520 (aa-507) disrupting the gene and producing two ORFs, one of which was the original shorter version of YOR396W used by SGD. In contrary, a later sequence submission (EMBL:Z75302) submitted on behalf of the Chromosome XV Sequencing Project does not contain this frameshift, matching the chromosomal sequence for reference strain S288C stored in SGD. Thank you to Ivo Pedruzzi of Swiss-Prot for bringing this annotation error to the attention of SGD. |
2006-10-06 | YOL126C Based on N-terminal sequencing (Kopetzki E. et al., Minard K.I. et al) and mapping of the transcription start site (Roth S. and Schuller H.J.), the start site for MDH2/YOL126C has been moved 141 bp (47 codons) downstream. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Special thanks to Ivo Pedruzzi and the team at Swiss-prot for bringing this to our attention. |
2006-10-05 | YOR173W Based on N-terminal sequencing and mapping of the transcription start site (Malys N. et al.), the start site for DCS2/YOR173W has been moved 132 bp (44 codons) downstream. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Special thanks to Ivo Pedruzzi and the team at SwissProt for bringing this to our attention. |
2006-10-03 | YOR211C Based on genetic analyses done by Shepard K.A. et al. (1999), the start site for MGM1/YOR211C has been moved 63 bp (21 codons) downstream. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Special thanks to Ivo Pedruzzi and the team at Swiss-Prot for bringing this change to our attention. |
2006-10-02 | ARS1531 ARS1531, also known as ARS1506.5, was added to the genome annotation based on Nieduszynski et al. 2006. |
2006-09-08 | ARS1507, ARS1508, ARS1509, ARS1510, ARS1511, ARS1513, ARS1519, ARS1521, ARS1523, ARS1524, ARS1526, ARS1528, ARS1529 The following new ARS elements on Chromosome XV were added to SGD based on Nieduszynski et al. 2006: ARS1507, ARS1508, ARS1509, ARS1510, ARS1511, ARS1513, ARS1519, ARS1521, ARS1523, ARS1524, ARS1526, ARS1528, ARS1529. |
2006-09-08 | ARS1516 The coordinates of ARS1516 were updated based on Nieduszynski et al. 2006. |
2006-05-11 | YOR197W The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for MCA1/YOR197W was moved 57 nt (19 amino acids) downstream. |
2006-04-12 | ARS1516 ARS1516, also known as "ADE2 ARS", was added to the genome annotation for Chromosome XV at coordinates 566191-566877 based on Wyrick et al. 2001 and Sasnauskas et al. 1987. |
2006-01-24 | snR81 New snoRNA added to genome annotation (GenBank accession # AY679769). |
2005-12-01 | YOR091W Based on on 5' SAGE TSS data and multiple orthologous sequence alignments published by Zhang and Dietrich, the start site for YOR091W was moved 168 nt (56 codons) downstream. |
2005-12-01 | YOR221C Based on multiple sequence alignments and on data published by Davis et al., the intron and first exon have been removed from this gene. This change effectively moves the MCT1/YOR221C start site 273 nts downstream, but does not alter the translation frame of this gene, resulting in a shortened, altered N-terminus. |
2005-12-01 | YOR074C Based on multiple sequence alignments and on data published by Taylor et al., Davis et al., and Poon et al., the intron has been removed from CDC21/YOR074C. The start codon, stop codon, and frame of translation all remain the same, but the sequence previously annotated as an intron is included in the translation. |
2005-11-30 | YOR147W Based on on 5' SAGE TSS data and multiple orthologous sequence alignments published by Zhang and Dietrich, the start site for MDM32/YOR147W was moved 93 nt (31 codons) downstream. |
2005-11-30 | YOR330C Based on 5' end mapping published by Francoise Foury, the start site for MIP1/YOR330C was moved 78 nt (26 codons) downstream. |
2004-10-12 | CEN12 The orientation of this centromere was reversed (from Watson to Crick) to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. and Espelin et al. |
2004-04-21 | YOR069W Based on the automated comparison of related fungi, Cliften et al. and Brachat et al. suggest that the start site for VPS5/YOR069W be moved 1089 nt upstream, extending the 5' end of the protein an additional 363 amino acids. This suggestion was reviewed and accepted by SGD curators. Evidence supporting this change includes: (1) this is the predicted start methionine in all Saccharomyces species sequenced by Cliften et al. and/or Kellis et al. and (2) this is the start site described in literature characterizing VPS5/YOR069W (Horazdovsky BF, et al.,(1997) Mol Biol Cell. Aug; 8(8):1529-41),(Nothwehr ST, Hindes AE (1997) J Cell Sci. May;110 (Pt 9):1063-72.). |
2003-09-27 | YOL048C Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 5' exon for YOL048C. Brachat et al. confirmed this intron using 5' RACE. The resulting ORF is in the same frame, but has a 236-residue extension at the N-terminus. This change was reviewed and accepted by SGD curators. |
2003-09-22 | YOR125C Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for CAT5/YOR125C be moved 117 nt (39 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The start site predicted previously for S. cerevisiae is not conserved in S. paradoxus (AGG), S. mikatae (AGG), and S. bayanus (AGG); 4) Insertions in S. mikatae and S. bayanus create frame shifts between the up and downstream ATGs; 5) the MitoProt (http://www.mips.biochem.mpg.de/cgi-bin/proj/medgen/mitofilter) program predicts that the shorter protein is localized to the mitochondria, which is confirmed by the literature (see for example Jonassen et al (1998) J Biol Chem 273:3351-7); the longer protein has a lower probability (.97 vs. .55) of mitochondrial localization according to the program; 6) homology to related proteins and conserved domains are downstream of the region between the two ATGs. |
2003-09-22 | YOL096C Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for COQ3/YOL096C be moved 12 nt (4 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The start site is not conserved in the closely related species S. paradoxus (CTA), S. mikatae (TTA), or S. bayanus (CCA). |
2003-09-22 | YOR037W Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for CYC2/YOR037W be moved 114 nt (38 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The start site predicted previously for S. cerevisiae is not conserved in S. paradoxus (GTA), S. mikatae (ATA), and S. bayanus (ATA); 4) InDels create frame shifts between the upstream start site and the proposed downstream start site; 5) The MitoProt program predicts that the shorter protein is localized to the mitochondria, which is confirmed by the literature (e.g. Dumont et al); the longer protein has a much lower probability of mitochondrial localization according to the program.. |
2003-09-22 | YOR103C Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for OST2/YOR103C be moved 9 nt (3 codons) downstream. This suggestion was reviewed by SGD curators and incorporated on September 22, 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The current start site is not conserved in S. paradoxus (ATA), S. mikatae (ACG), and S. bayanus (ACG). |
2003-09-22 | YOL146W Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PSF3/YOL146W be moved 126 nt (42 codons) downstream. This suggestion was reviewed by SGD curators and incorporated on September 22, 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The upstream ATG is conserved in S. paradoxus and S. mikatae, but insertions create stops between the two ATGs in these species. The upstream ATG (ATA in S. bayanus) and the frame are not conserved in S. bayanus; 4) Protein sequence comparisons against the nr dataset at NCBI show that there is no sequence similarity between S. cerevisiae and other species between the first and the second ATG; sequence similarity begins after the second methionine. Supporting evidence for this change has also been published by Takayama et al. who showed that the originally annotated upstream start site is not conserved in the S. pombe or human genes and that the apparent molecular mass of Psf3p is more consistent with the downstream start site. |
2003-09-22 | YOR238W The automated comparison of closely related Saccharomyces species suggests that the start site for YOR238W be moved 9 nt (3 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-22 | YOL103W Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for ITR2/YOL103W be moved 9 nt (3 codons) downstream. This suggestion was reviewed and accpeted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The upstream start site predicted previously for S. cerevisiae is not conserved in S. paradoxus, S. mikatae, or S. bayanus. |
2003-09-09 | TEL15L, TEL15R The chromosomal locations for TEL15L, TEL15L-TR, TEL15L-XC, TEL15L-XR, TEL15R, TEL15R-TR, TEL15R-XC, TEL15R-XR, and TEL15R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK). |
2003-07-29 | YOL083C-A, YOL097W-A, YOL155W-A, YOR034C-A, YOR072W-B, YOR192C-C, YOR293C-A Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XV ORFs: YOR072W-B, YOL083C-A, YOL097W-A, YOL155W-A, YOR034C-A, YOR192C-C, and YOR293C-A. |
2003-07-29 | YOL013W-A, YOL038C-A
Thanks to MIPS for providing the coordinates of the following Chromosome XV ORFs: YOL013W-B and YOL038C-A. |
2003-07-29 | YOL019W-A, YOL085W-A, YOL166W-A, YOR032W-A, YOR108C-A, YOR161C-C, YOR161W-A, YOR161W-B, YOR186C-A, YOR231C-A, YOR335W-A, YOR394C-A, YOR396C-A Thanks to Kumar et al. for providing the coordinates of the following Chromosome XV ORFs: YOL019W-A, YOR394C-A, YOR396C-A, YOL166W-A, YOR032W-A, YOR108C-A, YOR161C-C, YOR161W-A, YOR161W-B, YOR186C-A, YOR231C-A, YOR335W-A, and YOL085W-A. |
2003-07-29 | YOR020W-A Thanks to Brachat et al. for providing the coordinates of YOR020W-A. |
2003-07-29 | YOL164W-A, YOR011W-A, YOR072W-A, YOR073W-A, YOR316C-A, YOR329W-A, YOR376W-A, YOR381W-A Thanks to Kessler et al. for providing the coordinates for the following Chromosome XV ORFs: YOR072W-A, YOR316C-A, YOR376W-A, YOR381W-A, YOR329W-A, YOR073W-A, YOR011W-A, and YOL164W-A. |
2003-01-09 | YOL002C The start site of YOL002C has been moved 30 nt downstream from 324394 to 324364. Chromosomal coordinates change from old:324394-323441 to new:324364-323411. Relative coordinates go from old:1-984 to new:1-954. Thanks to Gillian Small for reporting this sequence annotation change to SGD. |
2001-03-08 | snR31 Changed the orientation of SNR31 from Watson to Crick (old start coord = 841953; old stop coord = 842177; new start coord = 842177; new stop coord = 841953). |
2001-03-06 | ARS1502 Courtesy of Prof. BiK Tye; based on Ph. D. thesis of Dr. Clarence Chan |
2000-10-17 | ARS1501 ARS1021 (aka ARS121) and ARS1501 were added to the genome annotation after personal communication from Shlomo Eisenberg. See Walker et al. 1991 for ARS1021 and Raychaudhuri et al. 1997 for ARS1501. |
2000-08-14 | YOR239W, YOR240W Annotation change: it has been reported in Asakura et al. 1998 that a +1 translational frameshift merges YOR239W and YOR240W into one ORF. YOR240W is now an alias for YOR239W and YOR239W encompasses both the ORFs. |
2000-08-11 | YOL052C-A Old name: YOL053C-A; new name: YOL052C-A; date: 11/1998; old coord: ChrXV 231753 231568; SGDID: S0005413; Name changed due to nomenclature |
2000-07-14 | YOL047C The annotations of the start site and 3' intron boundary of YOL047C were both changed, so that the relative coding coordinates change from 1-1..189-892 to 1-243..307-1134. Note that the stop site and the 5' boundary of the intron were not changed. Chromosomal coordinates for the coding region change from 242503-242503..242315-241612 to 242745-242503..242439-241612. |
1999-07-17 | YOL075C The start site of YOL075C was moved 597 bases upstream. Chromosomal coordinates change from 194944-189657 to 193541-189657. |
1998-05-21 | YOL013W-A, YOR298C-A The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. |
1997-07-01 | YOR304C-A The original annotation of the YOR304C-A ORF was incorrect because it included one additional nucleotide past the stop codon. The stop coordinate has now been corrected so that this extra "G" nucleotide is no longer included. |