Difference between revisions of "Chromosome I History"
(→Sequence Changes) |
|||
(5 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
+ | This page lists all sequence and annotation changes that have been made to the Chromosome I systematic reference sequence since its intial release on 1996-07-31. | ||
+ | *The sequence of Chromosome I has been updated '''115''' times, affecting '''55''' features. <br> | ||
+ | *The annotation of Chromosome I has been updated '''25''' times, affecting '''39''' features. <br> | ||
+ | Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site]. | ||
+ | |||
+ | __FORCETOC__ | ||
+ | |||
=Sequence Changes= | =Sequence Changes= | ||
− | {| | + | |
+ | {| border="1" style="border-collapse:collapse; width:90%" cellpadding="6" | ||
! Date !! Affected Features !! Start Coordinate of Change !! End Coordinate of Change !! Type of Change !! Old Sequence !! New Sequence | ! Date !! Affected Features !! Start Coordinate of Change !! End Coordinate of Change !! Type of Change !! Old Sequence !! New Sequence | ||
|- | |- | ||
− | |2011-02-03 | + | | 2011-02-03 |
+ | | [https://www.yeastgenome.org/locus/YAL013W YAL013W] | ||
+ | | 130485 | ||
+ | | 130486 | ||
+ | | Deletion | ||
+ | | GT | ||
+ | | | ||
|- | |- | ||
| || colspan="6" |Two nucleotides were deleted near the 3' end of ORF DEP1/[https://www.yeastgenome.org/locus/YAL013W YAL013W], altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 15 amino acids shorter. | | || colspan="6" |Two nucleotides were deleted near the 3' end of ORF DEP1/[https://www.yeastgenome.org/locus/YAL013W YAL013W], altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 15 amino acids shorter. | ||
Line 9: | Line 23: | ||
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | ||
Old 130446 AGACTCCGAAATCAACGACGACTTCCACCAGTGGGCCCAGTGTGACCGCCACACTGGACC 130505</pre> | Old 130446 AGACTCCGAAATCAACGACGACTTCCACCAGTGGGCCCAGTGTGACCGCCACACTGGACC 130505</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YAR019W-A YAR019W-A] | ||
+ | | 175305 | ||
+ | | 175305 | ||
+ | | Insertion | ||
+ | | | ||
+ | | C | ||
|- | |- | ||
| || colspan="6" |A single C nucleotide was inserted very near the 3' end of ORF [https://www.yeastgenome.org/locus/YAR019W-A YAR019W-A], altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 4 amino acids shorter. | | || colspan="6" |A single C nucleotide was inserted very near the 3' end of ORF [https://www.yeastgenome.org/locus/YAR019W-A YAR019W-A], altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 4 amino acids shorter. | ||
Line 17: | Line 38: | ||
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||
Old 175293 GGCACAGCAAAGT-CGCACAGAGCACTACAGTATAGCATAGAGTGCTAATGAGTTGATAG 175351</pre> | Old 175293 GGCACAGCAAAGT-CGCACAGAGCACTACAGTATAGCATAGAGTGCTAATGAGTTGATAG 175351</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YAL064W YAL064W] | ||
+ | | 21531 | ||
+ | | 21531 | ||
+ | | Insertion | ||
+ | | | ||
+ | | A | ||
|- | |- | ||
| || colspan="6" |A single A nucleotide was inserted within ORF [https://www.yeastgenome.org/locus/YAL064W YAL064W], near its 5' end, moving the start codon out of frame with the rest of the protein. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 14 amino acids shorter. | | || colspan="6" |A single A nucleotide was inserted within ORF [https://www.yeastgenome.org/locus/YAL064W YAL064W], near its 5' end, moving the start codon out of frame with the rest of the protein. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 14 amino acids shorter. | ||
Line 25: | Line 53: | ||
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | ||
Old 21490 CTATCGATGTGTATACAAACGTACTTCAAATAAGCAATGCGA-TATACTGCAACTTTTCG 21548</pre> | Old 21490 CTATCGATGTGTATACAAACGTACTTCAAATAAGCAATGCGA-TATACTGCAACTTTTCG 21548</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03||[https://www.yeastgenome.org/locus/YAR014C YAR014C] | + | |- style="height:30px; width:30px; text-align:center;" |
− | |- | + | | rowspan="9"| 2011-02-03 |
− | + | | rowspan="9"| [https://www.yeastgenome.org/locus/YAR014C YAR014C] | |
− | |- | + | | 167048 |
− | + | | 167048 | |
− | |- | + | | Substitution |
− | + | | G | |
− | |- | + | | C |
− | + | |-style="height:30px; width:30px; text-align:center;" | |
− | |- | + | | 167084 |
− | + | | 167084 | |
− | |- | + | | Insertion |
− | + | | | |
− | |- | + | | C |
− | + | |-style="height:30px; width:30px; text-align:center;" | |
− | |- | + | | 167113 |
− | + | | 167113 | |
+ | | Insertion | ||
+ | | | ||
+ | | T | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 167133 | ||
+ | | 167133 | ||
+ | | Insertion | ||
+ | | | ||
+ | | A | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 167138 | ||
+ | | 167138 | ||
+ | | Insertion | ||
+ | | | ||
+ | | T | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 167142 | ||
+ | | 167142 | ||
+ | | Insertion | ||
+ | | | ||
+ | | A | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 167149 | ||
+ | | 167149 | ||
+ | | Insertion | ||
+ | | | ||
+ | | T | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 167551 | ||
+ | | 167551 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | C | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 167802 | ||
+ | | 167802 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | T | ||
|- | |- | ||
| || colspan="6" |Six separate single nucleotides were inserted within ORF BUD14/[https://www.yeastgenome.org/locus/YAR014C YAR014C], and three single nucleotide substitutions were also made, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein is now two amino acids longer and a small section of the protein sequence is now different. | | || colspan="6" |Six separate single nucleotides were inserted within ORF BUD14/[https://www.yeastgenome.org/locus/YAR014C YAR014C], and three single nucleotide substitutions were also made, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein is now two amino acids longer and a small section of the protein sequence is now different. | ||
Line 65: | Line 132: | ||
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||
Old 167758 TATCCATTCAGTGCAGGTGTCGGAATTATACTCTCTGCATCACTCTGATTCTTGTTACCA 167817</pre> | Old 167758 TATCCATTCAGTGCAGGTGTCGGAATTATACTCTCTGCATCACTCTGATTCTTGTTACCA 167817</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03||[https://www.yeastgenome.org/locus/YAL051W YAL051W] | + | |- style="height:30px; width:30px; text-align:center;" |
− | |- | + | | rowspan="3"| 2011-02-03 |
− | + | | rowspan="3"| [https://www.yeastgenome.org/locus/YAL051W YAL051W] | |
− | |- | + | | 48772 |
− | + | | 48772 | |
+ | | Substitution | ||
+ | | T | ||
+ | | A | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 49904 | ||
+ | | 49904 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | A | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 50327 | ||
+ | | 50327 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | A | ||
|- | |- | ||
| || colspan="6" |Nucleotide changes within the coding region of OAF1/[https://www.yeastgenome.org/locus/YAL051W YAL051W] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 70 is now Arginine rather than Tryptophan, residue 447 is now Glutamine rather than Proline, and residue 588 is now Lysine rather than Threonine. | | || colspan="6" |Nucleotide changes within the coding region of OAF1/[https://www.yeastgenome.org/locus/YAL051W YAL051W] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 70 is now Arginine rather than Tryptophan, residue 447 is now Glutamine rather than Proline, and residue 588 is now Lysine rather than Threonine. | ||
Line 85: | Line 167: | ||
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | ||
Old 50287 AACCGAGTTAGGGGCGATCTAAGCGATATCAATAATCACACACTTTTGAGAATTCATAAA 50346</pre> | Old 50287 AACCGAGTTAGGGGCGATCTAAGCGATATCAATAATCACACACTTTTGAGAATTCATAAA 50346</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03||[https://www.yeastgenome.org/locus/YAL053W YAL053W] | + | |- style="height:30px; width:30px; text-align:center;" |
− | |- | + | | rowspan="4"| 2011-02-03 |
− | + | | rowspan="4"| [https://www.yeastgenome.org/locus/YAL053W YAL053W] | |
− | |- | + | | 46231 |
− | + | | 46231 | |
− | |- | + | | Substitution |
− | + | | C | |
+ | | G | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 46833 | ||
+ | | 46833 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | A | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 47821 | ||
+ | | 47821 | ||
+ | | Substitution | ||
+ | | T | ||
+ | | A | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 47826 | ||
+ | | 47826 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | T | ||
|- | |- | ||
| || colspan="6" |Nucleotide changes within the coding region of FLC2/[https://www.yeastgenome.org/locus/YAL053W YAL053W] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 111 is now Cysteine rather than Serine, residue 312 is now Asparagine rather than Aspartic Acid, and residues 641-643 are now NDS rather than IDP. | | || colspan="6" |Nucleotide changes within the coding region of FLC2/[https://www.yeastgenome.org/locus/YAL053W YAL053W] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 111 is now Cysteine rather than Serine, residue 312 is now Asparagine rather than Aspartic Acid, and residues 641-643 are now NDS rather than IDP. | ||
Line 107: | Line 208: | ||
|||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| | ||
Old 47807 TGGCAAAAACAAAATTGATCCTGAACTGTTTGAATTGAGAAAAGCTGTTATGGACACCAA 47866</pre> | Old 47807 TGGCAAAAACAAAATTGATCCTGAACTGTTTGAATTGAGAAAAGCTGTTATGGACACCAA 47866</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03||[https://www.yeastgenome.org/locus/YAR023C YAR023C] | + | |- style="height:30px; width:30px; text-align:center;" |
− | |- | + | | rowspan="2"| 2011-02-03 |
− | + | | rowspan="2"| [https://www.yeastgenome.org/locus/YAR023C YAR023C] | |
+ | | 179683 | ||
+ | | 179683 | ||
+ | | Substitution | ||
+ | | T | ||
+ | | A | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 179761 | ||
+ | | 179761 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | A | ||
|- | |- | ||
| || colspan="6" |The substitution of two nucleotides within the coding region of [https://www.yeastgenome.org/locus/YAR023C YAR023C] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 20 is now Phenylalanine rather than Valine, and residue 46 is now Phenylalanine rather than Isoleucine. | | || colspan="6" |The substitution of two nucleotides within the coding region of [https://www.yeastgenome.org/locus/YAR023C YAR023C] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 20 is now Phenylalanine rather than Valine, and residue 46 is now Phenylalanine rather than Isoleucine. | ||
Line 121: | Line 233: | ||
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | ||
Old 179730 ATCACCATGGCAGGGGAGAGAACACCAGAAACCCAAATGTTTGTTAAAGTCGCCAAAATC 179789</pre> | Old 179730 ATCACCATGGCAGGGGAGAGAACACCAGAAACCCAAATGTTTGTTAAAGTCGCCAAAATC 179789</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03||[https://www.yeastgenome.org/locus/YAL026C YAL026C] | + | |- style="height:30px; width:30px; text-align:center;" |
− | |- | + | | rowspan="7"| 2011-02-03 |
− | + | | rowspan="7"| [https://www.yeastgenome.org/locus/YAL026C YAL026C] | |
− | |- | + | | 96838 |
− | + | | 96838 | |
− | |- | + | | Deletion |
− | + | | C | |
− | |- | + | | |
− | + | |-style="height:30px; width:30px; text-align:center;" | |
− | |- | + | | 98350 |
− | + | | 98351 | |
− | |- | + | | Substitution |
− | + | | CG | |
+ | | GC | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 97678 | ||
+ | | 97679 | ||
+ | | Substitution | ||
+ | | CC | ||
+ | | GG | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 97025 | ||
+ | | 97026 | ||
+ | | Substitution | ||
+ | | AT | ||
+ | | TA | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 99563 | ||
+ | | 99565 | ||
+ | | Substitution | ||
+ | | ATC | ||
+ | | TCG | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 96740 | ||
+ | | 96740 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | C | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 96841 | ||
+ | | 96841 | ||
+ | | Insertion | ||
+ | | | ||
+ | | C | ||
|- | |- | ||
| || colspan="6" |Nucleotide changes within the coding region of DRS2/[https://www.yeastgenome.org/locus/YAL026C YAL026C] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 45-46 are now AN rather than GY, residue 450 is now Alanine rather than Arginine, residue 674 is now Proline rather than Glycine, residues 891-892 are now NT rather than KS, residues 953-954 are now GD rather than AS, and residue 987 is now Valine rather than Leucine. | | || colspan="6" |Nucleotide changes within the coding region of DRS2/[https://www.yeastgenome.org/locus/YAL026C YAL026C] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 45-46 are now AN rather than GY, residue 450 is now Alanine rather than Arginine, residue 674 is now Proline rather than Glycine, residues 891-892 are now NT rather than KS, residues 953-954 are now GD rather than AS, and residue 987 is now Valine rather than Leucine. | ||
Line 161: | Line 304: | ||
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | ||
Old 99536 GAAGTACATGACTTGGTGGTATATAATATCCGTTCGCATGTGAGTTGGTGACCTTTGAAC 99595</pre> | Old 99536 GAAGTACATGACTTGGTGGTATATAATATCCGTTCGCATGTGAGTTGGTGACCTTTGAAC 99595</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03||[https://www.yeastgenome.org/locus/YAR019C YAR019C] | + | |- style="height:30px; width:30px; text-align:center;" |
− | |- | + | | rowspan="4"| 2011-02-03 |
− | + | | rowspan="4"| [https://www.yeastgenome.org/locus/YAR019C YAR019C] | |
− | |- | + | | 172425 |
− | + | | 172425 | |
− | |- | + | | Insertion |
− | + | | | |
+ | | G | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 174173 | ||
+ | | 174173 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | C | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 174187 | ||
+ | | 174188 | ||
+ | | Substitution | ||
+ | | CG | ||
+ | | GC | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 172434 | ||
+ | | 172434 | ||
+ | | Deletion | ||
+ | | G | ||
+ | | | ||
|- | |- | ||
| || colspan="6" |Nucleotide changes within the coding region of CDC15/[https://www.yeastgenome.org/locus/YAR019C YAR019C] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 316 is now Alanine rather than Arginine, residue 321 is now Alanine rather than Proline, and 900-902 are now KDV rather than NGC. | | || colspan="6" |Nucleotide changes within the coding region of CDC15/[https://www.yeastgenome.org/locus/YAR019C YAR019C] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 316 is now Alanine rather than Arginine, residue 321 is now Alanine rather than Proline, and 900-902 are now KDV rather than NGC. | ||
Line 179: | Line 341: | ||
|||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| | |||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| | ||
Old 174163 TCTGCCCAGGGAGCGGGAGCCGCTCGAAGACTGAATTTAGAGGGTGATATATTTAGTTTC 174222</pre> | Old 174163 TCTGCCCAGGGAGCGGGAGCCGCTCGAAGACTGAATTTAGAGGGTGATATATTTAGTTTC 174222</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03||[https://www.yeastgenome.org/locus/YAL047C YAL047C] | + | |- style="height:30px; width:30px; text-align:center;" |
− | |- | + | | rowspan="2"| 2011-02-03 |
− | + | | rowspan="2"| [https://www.yeastgenome.org/locus/YAL047C YAL047C] | |
+ | | 55746 | ||
+ | | 55746 | ||
+ | | Substitution | ||
+ | | A | ||
+ | | G | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 55954 | ||
+ | | 55954 | ||
+ | | Substitution | ||
+ | | A | ||
+ | | T | ||
|- | |- | ||
| || colspan="6" |Nucleotide changes within the coding region of SPC72/[https://www.yeastgenome.org/locus/YAL047C YAL047C] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 302 is now Asparagine rather than Isoleucine. | | || colspan="6" |Nucleotide changes within the coding region of SPC72/[https://www.yeastgenome.org/locus/YAL047C YAL047C] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 302 is now Asparagine rather than Isoleucine. | ||
Line 193: | Line 366: | ||
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||
Old 55917 AATGGAATTTATAAATTGATCATATTCTTTGTGCAAAATTTCTATGACAATCTCTAATTG 55976</pre> | Old 55917 AATGGAATTTATAAATTGATCATATTCTTTGTGCAAAATTTCTATGACAATCTCTAATTG 55976</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YAL060W YAL060W] | ||
+ | | 36120 | ||
+ | | 36120 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | A | ||
|- | |- | ||
| || colspan="6" |A single nucleotide substitution within the coding region of BDH1/[https://www.yeastgenome.org/locus/YAL060W YAL060W] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 322 is now Aspartic Acid rather than Alanine. | | || colspan="6" |A single nucleotide substitution within the coding region of BDH1/[https://www.yeastgenome.org/locus/YAL060W YAL060W] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 322 is now Aspartic Acid rather than Alanine. | ||
Line 201: | Line 381: | ||
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||
Old 36107 TATGTTGTCGAAGCCTTCGAAGAAGTTGTTCGTGCCATCCACAACGGAGACATCGCCATG 36166</pre> | Old 36107 TATGTTGTCGAAGCCTTCGAAGAAGTTGTTCGTGCCATCCACAACGGAGACATCGCCATG 36166</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YAL010C YAL010C] | ||
+ | | 134852 | ||
+ | | 134854 | ||
+ | | Substitution | ||
+ | | TTG | ||
+ | | ATT | ||
|- | |- | ||
| || colspan="6" |A single nucleotide substitution within the coding region of MDM10/[https://www.yeastgenome.org/locus/YAL010C YAL010C] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 272 is now Asparagine rather than Glutamine. | | || colspan="6" |A single nucleotide substitution within the coding region of MDM10/[https://www.yeastgenome.org/locus/YAL010C YAL010C] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 272 is now Asparagine rather than Glutamine. | ||
Line 209: | Line 396: | ||
||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| | ||
Old 134815 TGGCCGAATATGTGGAGGATATATGGCCGAATAATGGTTGCCAAGATAATGTCAAAGTTA 134874</pre> | Old 134815 TGGCCGAATATGTGGAGGATATATGGCCGAATAATGGTTGCCAAGATAATGTCAAAGTTA 134874</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YAL017W YAL017W] | ||
+ | | 120442 | ||
+ | | 120442 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | G | ||
|- | |- | ||
| || colspan="6" |A single nucleotide substitution within the coding region of PSK1/[https://www.yeastgenome.org/locus/YAL017W YAL017W] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 73 is now Glutamic Acid rather than Glutamine. | | || colspan="6" |A single nucleotide substitution within the coding region of PSK1/[https://www.yeastgenome.org/locus/YAL017W YAL017W] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 73 is now Glutamic Acid rather than Glutamine. | ||
Line 217: | Line 411: | ||
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||
Old 120416 CGAATAAAAAGGAAGGTGATGAGTTCCAGCAAAGTTTAAGAGATACATTTGCGAGCTTTC 120475</pre> | Old 120416 CGAATAAAAAGGAAGGTGATGAGTTCCAGCAAAGTTTAAGAGATACATTTGCGAGCTTTC 120475</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YAL020C YAL020C] | ||
+ | | 113702 | ||
+ | | 113703 | ||
+ | | Substitution | ||
+ | | CG | ||
+ | | GC | ||
|- | |- | ||
| || colspan="6" |The substitution of two nucleotides within the coding region of ATS1/[https://www.yeastgenome.org/locus/YAL020C YAL020C] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 305 is now Glycine rather than Alanine. | | || colspan="6" |The substitution of two nucleotides within the coding region of ATS1/[https://www.yeastgenome.org/locus/YAL020C YAL020C] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 305 is now Glycine rather than Alanine. | ||
Line 225: | Line 426: | ||
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | ||
Old 113896 GCAGTCCAGGCTGGGACGCCTTTTGCGGGCCGCAGTTGCCATGCTCTCCCCAGCCCCAGC 113745</pre> | Old 113896 GCAGTCCAGGCTGGGACGCCTTTTGCGGGCCGCAGTTGCCATGCTCTCCCCAGCCCCAGC 113745</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YAL025C YAL025C] | ||
+ | | 100399 | ||
+ | | 100399 | ||
+ | | Substitution | ||
+ | | A | ||
+ | | C | ||
|- | |- | ||
| || colspan="6" |A single nucleotide substitution within the coding region of MAK16/[https://www.yeastgenome.org/locus/YAL025C YAL025C] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 250 is now Glutamic Acid rather than Glutamine. | | || colspan="6" |A single nucleotide substitution within the coding region of MAK16/[https://www.yeastgenome.org/locus/YAL025C YAL025C] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 250 is now Glutamic Acid rather than Glutamine. | ||
Line 233: | Line 441: | ||
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | ||
Old 100376 GCTTTCACTGTCGCTTTCGCTTTGACTGGCGCTGGAAGCTTCTCTGTCAGAGTCAGCTAA 100435</pre> | Old 100376 GCTTTCACTGTCGCTTTCGCTTTGACTGGCGCTGGAAGCTTCTCTGTCAGAGTCAGCTAA 100435</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03||[https://www.yeastgenome.org/locus/YAL056W YAL056W] | + | |- style="height:30px; width:30px; text-align:center;" |
− | |- | + | | rowspan="5"| 2011-02-03 |
− | + | | rowspan="5"| [https://www.yeastgenome.org/locus/YAL056W YAL056W] | |
− | |- | + | | 40231 |
− | + | | 40231 | |
− | |- | + | | Substitution |
− | + | | C | |
− | |- | + | | G |
− | + | |-style="height:30px; width:30px; text-align:center;" | |
+ | | 41240 | ||
+ | | 41240 | ||
+ | | Substitution | ||
+ | | A | ||
+ | | G | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 41664 | ||
+ | | 41664 | ||
+ | | Substitution | ||
+ | | T | ||
+ | | G | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 41700 | ||
+ | | 41700 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | A | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 41703 | ||
+ | | 41703 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | A | ||
|- | |- | ||
| || colspan="6" |Nucleotide changes within the coding region of GPB2/[https://www.yeastgenome.org/locus/YAL056W YAL056W] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 661 is now Valine rather than Isoleucine, residue 802 is now Cysteine rather than Phenylalanine, and residues 814-815 are now ED rather than AA. | | || colspan="6" |Nucleotide changes within the coding region of GPB2/[https://www.yeastgenome.org/locus/YAL056W YAL056W] resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 661 is now Valine rather than Isoleucine, residue 802 is now Cysteine rather than Phenylalanine, and residues 814-815 are now ED rather than AA. | ||
Line 257: | Line 488: | ||
|||||||||||| ||||||||||||||||||||||||||||||||||| || |||||||| | |||||||||||| ||||||||||||||||||||||||||||||||||| || |||||||| | ||
Old 41652 TAAGCACGCAGTTTTGGGAAGAACATAAAATTACTCTGTCCAAGAAGGCAGCCGATGAGG 41711</pre> | Old 41652 TAAGCACGCAGTTTTGGGAAGAACATAAAATTACTCTGTCCAAGAAGGCAGCCGATGAGG 41711</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YAL059C-A YAL059C-A], [https://www.yeastgenome.org/locus/YAL059W YAL059W] | ||
+ | | 36814 | ||
+ | | 36814 | ||
+ | | Substitution | ||
+ | | A | ||
+ | | C | ||
|- | |- | ||
| || colspan="6" |A single nucleotide substitution within the coding regions of overlapping ORFs ECM1/[https://www.yeastgenome.org/locus/YAL059W YAL059W] and [https://www.yeastgenome.org/locus/YAL059C-A YAL059C-A] resulted in altered protein sequences for both ORFs. The start, stop, and reading frames remain the same for both proteins, but ECM1/[https://www.yeastgenome.org/locus/YAL059W YAL059W] protein residue 102 is now Alanine rather than Aspartic Acid, and [https://www.yeastgenome.org/locus/YAL059C-A YAL059C-A] protein residue 36 is now Alanine rather than Serine. | | || colspan="6" |A single nucleotide substitution within the coding regions of overlapping ORFs ECM1/[https://www.yeastgenome.org/locus/YAL059W YAL059W] and [https://www.yeastgenome.org/locus/YAL059C-A YAL059C-A] resulted in altered protein sequences for both ORFs. The start, stop, and reading frames remain the same for both proteins, but ECM1/[https://www.yeastgenome.org/locus/YAL059W YAL059W] protein residue 102 is now Alanine rather than Aspartic Acid, and [https://www.yeastgenome.org/locus/YAL059C-A YAL059C-A] protein residue 36 is now Alanine rather than Serine. | ||
Line 265: | Line 503: | ||
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||
Old 36777 AAGAAGTTAAATAAAAAGGCTCTGGAAGACAAACTGGACAACTCTATTTCATCCATGGAC 36836</pre> | Old 36777 AAGAAGTTAAATAAAAAGGCTCTGGAAGACAAACTGGACAACTCTATTTCATCCATGGAC 36836</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/HRA1 HRA1] | ||
+ | | 99841 | ||
+ | | 99841 | ||
+ | | Substitution | ||
+ | | A | ||
+ | | T | ||
|- | |- | ||
| || colspan="6" |A single nucleotide substitution was made within ncRNA [https://www.yeastgenome.org/locus/HRA1 HRA1]. | | || colspan="6" |A single nucleotide substitution was made within ncRNA [https://www.yeastgenome.org/locus/HRA1 HRA1]. | ||
Line 273: | Line 518: | ||
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | ||
Old 99826 TTCAACTTAGTGGCAATAAACAGATTTGGGTTTTCTGGCAAAAAAAGCCAATCACGTGAT 99885</pre> | Old 99826 TTCAACTTAGTGGCAATAAACAGATTTGGGTTTTCTGGCAAAAAAAGCCAATCACGTGAT 99885</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03||[https://www.yeastgenome.org/locus/ARS110 ARS110], [https://www.yeastgenome.org/locus/YAR019W-A YAR019W-A] | + | |- style="height:30px; width:30px; text-align:center;" |
− | |- | + | | rowspan="2"| 2011-02-03 |
− | + | | rowspan="2"| [https://www.yeastgenome.org/locus/ARS110 ARS110], [https://www.yeastgenome.org/locus/YAR019W-A YAR019W-A] | |
+ | | 175378 | ||
+ | | 175378 | ||
+ | | Substitution | ||
+ | | T | ||
+ | | C | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 175371 | ||
+ | | 175371 | ||
+ | | Deletion | ||
+ | | T | ||
+ | | | ||
|- | |- | ||
| || colspan="6" |A single nucleotide deletion and a single nucleotide substitution were made in the intergenic region between ORF [https://www.yeastgenome.org/locus/YAR019W-A YAR019W-A] and [https://www.yeastgenome.org/locus/ARS110 ARS110]. | | || colspan="6" |A single nucleotide deletion and a single nucleotide substitution were made in the intergenic region between ORF [https://www.yeastgenome.org/locus/YAR019W-A YAR019W-A] and [https://www.yeastgenome.org/locus/ARS110 ARS110]. | ||
Line 283: | Line 539: | ||
||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| | ||
Old 175352 GCCCAATTTTGATTATGCCTTCTTTTTCATACACGACGCCAGAGGACATTATTACATTAC 175411</pre> | Old 175352 GCCCAATTTTGATTATGCCTTCTTTTTCATACACGACGCCAGAGGACATTATTACATTAC 175411</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03||[https://www.yeastgenome.org/locus/ARS106 ARS106], [https://www.yeastgenome.org/locus/YAL038W YAL038W] | + | |- style="height:30px; width:30px; text-align:center;" |
− | |- | + | | rowspan="2"| 2011-02-03 |
− | + | | rowspan="2"| [https://www.yeastgenome.org/locus/ARS106 ARS106], [https://www.yeastgenome.org/locus/YAL038W YAL038W] | |
+ | | 70874 | ||
+ | | 70874 | ||
+ | | Substitution | ||
+ | | A | ||
+ | | G | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 70794 | ||
+ | | 70794 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | G | ||
|- | |- | ||
| || colspan="6" |Two separate single nucleotide substitutions were made in the intergenic region between [https://www.yeastgenome.org/locus/ARS106 ARS106] and ORF CDC19/[https://www.yeastgenome.org/locus/YAL038W YAL038W]. | | || colspan="6" |Two separate single nucleotide substitutions were made in the intergenic region between [https://www.yeastgenome.org/locus/ARS106 ARS106] and ORF CDC19/[https://www.yeastgenome.org/locus/YAL038W YAL038W]. | ||
Line 296: | Line 563: | ||
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | ||
Old 70857 TTATTTTTTTTTTGTTAAAATTGATCCAAATGTAAATAAACAATCACAAGGAAAAAAAAA 70916</pre> | Old 70857 TTATTTTTTTTTTGTTAAAATTGATCCAAATGTAAATAAACAATCACAAGGAAAAAAAAA 70916</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03||[https://www.yeastgenome.org/locus/ARS104 ARS104], [https://www.yeastgenome.org/locus/YAL063C YAL063C] | + | |- style="height:30px; width:30px; text-align:center;" |
− | |- | + | | rowspan="2"| 2011-02-03 |
− | + | | rowspan="2"| [https://www.yeastgenome.org/locus/ARS104 ARS104], [https://www.yeastgenome.org/locus/YAL063C YAL063C] | |
+ | | 28953 | ||
+ | | 28953 | ||
+ | | Insertion | ||
+ | | | ||
+ | | T | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 28069 | ||
+ | | 28069 | ||
+ | | Deletion | ||
+ | | T | ||
+ | | | ||
|- | |- | ||
| || colspan="6" |A single nucleotide deletion and a single nucleotide insertion were made in the intergenic region between ORF FLO9/[https://www.yeastgenome.org/locus/YAL063C YAL063C] and [https://www.yeastgenome.org/locus/ARS104 ARS104]. | | || colspan="6" |A single nucleotide deletion and a single nucleotide insertion were made in the intergenic region between ORF FLO9/[https://www.yeastgenome.org/locus/YAL063C YAL063C] and [https://www.yeastgenome.org/locus/ARS104 ARS104]. | ||
Line 309: | Line 587: | ||
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||
Old 28918 AGTAAACAAGAGATACCTAATTTCACAGCCACTTTT-GTTGCGGACACTGACGGGATGTG 28976</pre> | Old 28918 AGTAAACAAGAGATACCTAATTTCACAGCCACTTTT-GTTGCGGACACTGACGGGATGTG 28976</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YAR023C YAR023C], [https://www.yeastgenome.org/locus/SUP56 tL(CAA)A] | ||
+ | | 180961 | ||
+ | | 180961 | ||
+ | | Insertion | ||
+ | | | ||
+ | | CAAA | ||
|- | |- | ||
| || colspan="6" |A tetranucleotide insertion was made in the intergenic region between ORF [https://www.yeastgenome.org/locus/YAR023C YAR023C] and tRNA-Leu SUP56/[https://www.yeastgenome.org/locus/SUP56 tL(CAA)A]. | | || colspan="6" |A tetranucleotide insertion was made in the intergenic region between ORF [https://www.yeastgenome.org/locus/YAR023C YAR023C] and tRNA-Leu SUP56/[https://www.yeastgenome.org/locus/SUP56 tL(CAA)A]. | ||
Line 317: | Line 602: | ||
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | ||
Old 180940 TTCCCATTACAATGCCGAATAG----ATATGTAGTAGAACACGTACACGCATGATAATTA 180995</pre> | Old 180940 TTCCCATTACAATGCCGAATAG----ATATGTAGTAGAACACGTACACGCATGATAATTA 180995</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YAL041W YAL041W], [https://www.yeastgenome.org/locus/YAL042W YAL042W] | ||
+ | | 62767 | ||
+ | | 62767 | ||
+ | | Substitution | ||
+ | | A | ||
+ | | G | ||
|- | |- | ||
| || colspan="6" |A single nucleotide substitution was made in the intergenic region between ORFs ERV46/[https://www.yeastgenome.org/locus/YAL042W YAL042W] and CDC24/[https://www.yeastgenome.org/locus/YAL041W YAL041W]. | | || colspan="6" |A single nucleotide substitution was made in the intergenic region between ORFs ERV46/[https://www.yeastgenome.org/locus/YAL042W YAL042W] and CDC24/[https://www.yeastgenome.org/locus/YAL041W YAL041W]. | ||
Line 325: | Line 617: | ||
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | ||
Old 62757 TAGGATAGCAAAAGAGTACCATTGCTGTTATCATTTGTTGCCTAGCCCTATCAAGACCTG 62816</pre> | Old 62757 TAGGATAGCAAAAGAGTACCATTGCTGTTATCATTTGTTGCCTAGCCCTATCAAGACCTG 62816</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03||[https://www.yeastgenome.org/locus/YAR047C YAR047C], [https://www.yeastgenome.org/locus/YAR050W YAR050W] | + | |- style="height:30px; width:30px; text-align:center;" |
− | |- | + | | rowspan="2"| 2011-02-03 |
− | + | | rowspan="2"| [https://www.yeastgenome.org/locus/YAR047C YAR047C], [https://www.yeastgenome.org/locus/YAR050W YAR050W] | |
+ | | 203327 | ||
+ | | 203327 | ||
+ | | Insertion | ||
+ | | | ||
+ | | T | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 202933 | ||
+ | | 202933 | ||
+ | | Insertion | ||
+ | | | ||
+ | | A | ||
|- | |- | ||
| || colspan="6" |Two separate single nucleotide insertions were made in the intergenic region between ORFs [https://www.yeastgenome.org/locus/YAR047C YAR047C] and FLO1/[https://www.yeastgenome.org/locus/YAR050W YAR050W]. | | || colspan="6" |Two separate single nucleotide insertions were made in the intergenic region between ORFs [https://www.yeastgenome.org/locus/YAR047C YAR047C] and FLO1/[https://www.yeastgenome.org/locus/YAR050W YAR050W]. | ||
Line 338: | Line 641: | ||
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | ||
Old 203314 TTCACTCTTGCTCG-TTGATGTAAGCTCTCTTCCGGGTTCTTATTTTTAATTCTTGTCAC 203372</pre> | Old 203314 TTCACTCTTGCTCG-TTGATGTAAGCTCTCTTCCGGGTTCTTATTTTTAATTCTTGTCAC 203372</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YAR042W YAR042W], [https://www.yeastgenome.org/locus/YAR047C YAR047C] | ||
+ | | 198900 | ||
+ | | 198900 | ||
+ | | Insertion | ||
+ | | | ||
+ | | A | ||
|- | |- | ||
| || colspan="6" |A single nucleotide insertion was made in the intergenic region between ORFs SWH1/[https://www.yeastgenome.org/locus/YAR042W YAR042W] and [https://www.yeastgenome.org/locus/YAR047C YAR047C]. | | || colspan="6" |A single nucleotide insertion was made in the intergenic region between ORFs SWH1/[https://www.yeastgenome.org/locus/YAR042W YAR042W] and [https://www.yeastgenome.org/locus/YAR047C YAR047C]. | ||
Line 346: | Line 656: | ||
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | ||
Old 198876 TAAGCCCCTTTTATGGATGCATGAG-AAAAAAAAAAGGTTTGCTACAACCATCTCAGGTC 198934</pre> | Old 198876 TAAGCCCCTTTTATGGATGCATGAG-AAAAAAAAAAGGTTTGCTACAACCATCTCAGGTC 198934</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03||[https://www.yeastgenome.org/locus/YAR020C YAR020C], [https://www.yeastgenome.org/locus/YAR023C YAR023C] | + | |- style="height:30px; width:30px; text-align:center;" |
− | |- | + | | rowspan="6"| 2011-02-03 |
− | + | | rowspan="6"| [https://www.yeastgenome.org/locus/YAR020C YAR020C], [https://www.yeastgenome.org/locus/YAR023C YAR023C] | |
− | |- | + | | 178647 |
− | + | | 178647 | |
− | |- | + | | Substitution |
− | + | | T | |
− | |- | + | | C |
− | + | |-style="height:30px; width:30px; text-align:center;" | |
− | |- | + | | 178638 |
− | + | | 178638 | |
+ | | Deletion | ||
+ | | G | ||
+ | | | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 178618 | ||
+ | | 178618 | ||
+ | | Insertion | ||
+ | | | ||
+ | | A | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 178601 | ||
+ | | 178601 | ||
+ | | Deletion | ||
+ | | A | ||
+ | | | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 178256 | ||
+ | | 178256 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | C | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 177135 | ||
+ | | 177135 | ||
+ | | Insertion | ||
+ | | | ||
+ | | T | ||
|- | |- | ||
| || colspan="6" |Several nucleotide sequence changes were made in the intergenic region between ORFs PAU7/[https://www.yeastgenome.org/locus/YAR020C YAR020C] and [https://www.yeastgenome.org/locus/YAR023C YAR023C]. | | || colspan="6" |Several nucleotide sequence changes were made in the intergenic region between ORFs PAU7/[https://www.yeastgenome.org/locus/YAR020C YAR020C] and [https://www.yeastgenome.org/locus/YAR023C YAR023C]. | ||
Line 370: | Line 707: | ||
||||| ||||||||||||||||| ||||||||||||||||||| |||||||| ||||||| | ||||| ||||||||||||||||| ||||||||||||||||||| |||||||| ||||||| | ||
Old 178596 ATTGTAAGATTGTATCGTTCGAG-AACGTCAGGCATGATAGATGGTTGCAATTACAGGAC 178654</pre> | Old 178596 ATTGTAAGATTGTATCGTTCGAG-AACGTCAGGCATGATAGATGGTTGCAATTACAGGAC 178654</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03||[https://www.yeastgenome.org/locus/YAR018C YAR018C], [https://www.yeastgenome.org/locus/YAR019C YAR019C] | + | |- style="height:30px; width:30px; text-align:center;" |
− | |- | + | | rowspan="10"| 2011-02-03 |
− | + | | rowspan="10"| [https://www.yeastgenome.org/locus/YAR018C YAR018C], [https://www.yeastgenome.org/locus/YAR019C YAR019C] | |
− | |- | + | | 172170 |
− | + | | 172170 | |
− | |- | + | | Insertion |
− | + | | | |
− | |- | + | | T |
− | + | |-style="height:30px; width:30px; text-align:center;" | |
− | |- | + | | 172042 |
− | + | | 172042 | |
− | |- | + | | Insertion |
− | + | | | |
− | |- | + | | T |
− | + | |-style="height:30px; width:30px; text-align:center;" | |
− | |- | + | | 172041 |
− | + | | 172041 | |
− | |- | + | | Insertion |
− | + | | | |
+ | | T | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 172020 | ||
+ | | 172020 | ||
+ | | Deletion | ||
+ | | A | ||
+ | | | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 172018 | ||
+ | | 172018 | ||
+ | | Deletion | ||
+ | | A | ||
+ | | | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 171983 | ||
+ | | 171983 | ||
+ | | Deletion | ||
+ | | G | ||
+ | | | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 171975 | ||
+ | | 171977 | ||
+ | | Deletion | ||
+ | | CTA | ||
+ | | | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 171972 | ||
+ | | 171972 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | T | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 171968 | ||
+ | | 171968 | ||
+ | | Deletion | ||
+ | | C | ||
+ | | | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 171882 | ||
+ | | 171882 | ||
+ | | Insertion | ||
+ | | | ||
+ | | C | ||
|- | |- | ||
| || colspan="6" |Several nucleotide sequence changes were made in the intergenic region between ORFs KIN3/[https://www.yeastgenome.org/locus/YAR018C YAR018C] and CDC15/[https://www.yeastgenome.org/locus/YAR019C YAR019C]. | | || colspan="6" |Several nucleotide sequence changes were made in the intergenic region between ORFs KIN3/[https://www.yeastgenome.org/locus/YAR018C YAR018C] and CDC15/[https://www.yeastgenome.org/locus/YAR019C YAR019C]. | ||
Line 405: | Line 785: | ||
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||
Old 172125 GGAAGGTTCACAATTCTATATATAGTGTTAATGTAATGCTGTATTA-TTCTCTATATATG 172183</pre> | Old 172125 GGAAGGTTCACAATTCTATATATAGTGTTAATGTAATGCTGTATTA-TTCTCTATATATG 172183</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YAR007C YAR007C], [https://www.yeastgenome.org/locus/YAR008W YAR008W] | ||
+ | | 158934 | ||
+ | | 158934 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
|- | |- | ||
| || colspan="6" |A single nucleotide insertion was made in the intergenic region between ORFs RFA1/[https://www.yeastgenome.org/locus/YAR007C YAR007C] and SEN34/[https://www.yeastgenome.org/locus/YAR008W YAR008W]. | | || colspan="6" |A single nucleotide insertion was made in the intergenic region between ORFs RFA1/[https://www.yeastgenome.org/locus/YAR007C YAR007C] and SEN34/[https://www.yeastgenome.org/locus/YAR008W YAR008W]. | ||
Line 413: | Line 800: | ||
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | ||
Old 158925 TAACATATAT-CAAAAAGAACGGCAAAAGGCGAGGAGGTTTTTATGCCACCGCTAGTATT 158983</pre> | Old 158925 TAACATATAT-CAAAAAGAACGGCAAAAGGCGAGGAGGTTTTTATGCCACCGCTAGTATT 158983</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/CEN1 CEN1], [https://www.yeastgenome.org/locus/YAR002W YAR002W] | ||
+ | | 152189 | ||
+ | | 152190 | ||
+ | | Substitution | ||
+ | | CA | ||
+ | | AC | ||
|- | |- | ||
| || colspan="6" |A dinucleotide substitution was made in the intergenic region between [https://www.yeastgenome.org/locus/CEN1 CEN1] and ORF NUP60/[https://www.yeastgenome.org/locus/YAR002W YAR002W] | | || colspan="6" |A dinucleotide substitution was made in the intergenic region between [https://www.yeastgenome.org/locus/CEN1 CEN1] and ORF NUP60/[https://www.yeastgenome.org/locus/YAR002W YAR002W] | ||
Line 421: | Line 815: | ||
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||
Old 152155 ATATATTTACAAGTGAAAGCTTATTGTAATGTGTCATTTTAAACATCAAATAACAGACCT 152214</pre> | Old 152155 ATATATTTACAAGTGAAAGCTTATTGTAATGTGTCATTTTAAACATCAAATAACAGACCT 152214</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03||[https://www.yeastgenome.org/locus/YAL067C YAL067C], [https://www.yeastgenome.org/locus/YAL067W-A YAL067W-A] | + | |- style="height:30px; width:30px; text-align:center;" |
− | |- | + | | rowspan="5"| 2011-02-03 |
− | + | | rowspan="5"| [https://www.yeastgenome.org/locus/YAL067C YAL067C], [https://www.yeastgenome.org/locus/YAL067W-A YAL067W-A] | |
− | |- | + | | 6454 |
− | + | | 6454 | |
− | |- | + | | Deletion |
− | + | | C | |
− | |- | + | | |
− | + | |-style="height:30px; width:30px; text-align:center;" | |
+ | | 5927 | ||
+ | | 5927 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 5244 | ||
+ | | 5244 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | A | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 3981 | ||
+ | | 3982 | ||
+ | | Substitution | ||
+ | | AT | ||
+ | | TA | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 3836 | ||
+ | | 3836 | ||
+ | | Deletion | ||
+ | | C | ||
+ | | | ||
|- | |- | ||
| || colspan="6" |Several nucleotide sequence changes were made in the intergenic region between ORFs [https://www.yeastgenome.org/locus/YAL067W-A YAL067W-A] and SEO1/[https://www.yeastgenome.org/locus/YAL067C YAL067C]. | | || colspan="6" |Several nucleotide sequence changes were made in the intergenic region between ORFs [https://www.yeastgenome.org/locus/YAL067W-A YAL067W-A] and SEO1/[https://www.yeastgenome.org/locus/YAL067C YAL067C]. | ||
Line 449: | Line 866: | ||
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||
Old 6420 AAGTTTCTTAAATAACCCGGATTGGTTAGGTTCACGCCATGCCTGGCGCGTACATTGAGG 6479</pre> | Old 6420 AAGTTTCTTAAATAACCCGGATTGGTTAGGTTCACGCCATGCCTGGCGCGTACATTGAGG 6479</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03||[https://www.yeastgenome.org/locus/YAL064C-A YAL064C-A], [https://www.yeastgenome.org/locus/YAL064W YAL064W] | + | |- style="height:30px; width:30px; text-align:center;" |
− | |- | + | | rowspan="3"| 2011-02-03 |
− | + | | rowspan="3"| [https://www.yeastgenome.org/locus/YAL064C-A YAL064C-A], [https://www.yeastgenome.org/locus/YAL064W YAL064W] | |
− | |- | + | | 16500 |
− | + | | 16500 | |
+ | | Deletion | ||
+ | | G | ||
+ | | | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 16470 | ||
+ | | 16470 | ||
+ | | Deletion | ||
+ | | T | ||
+ | | | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 16457 | ||
+ | | 16457 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | A | ||
|- | |- | ||
| || colspan="6" |A single nucleotide substitution and two separate single nucleotide deletions were made in the intergenic region between ORFs [https://www.yeastgenome.org/locus/YAL064C-A YAL064C-A] and [https://www.yeastgenome.org/locus/YAL064W YAL064W]. | | || colspan="6" |A single nucleotide substitution and two separate single nucleotide deletions were made in the intergenic region between ORFs [https://www.yeastgenome.org/locus/YAL064C-A YAL064C-A] and [https://www.yeastgenome.org/locus/YAL064W YAL064W]. | ||
Line 461: | Line 893: | ||
||||||| |||||||||||| ||||||||||||||||||||||||||||| ||||||||| | ||||||| |||||||||||| ||||||||||||||||||||||||||||| ||||||||| | ||
Old 16450 TCTGTGGGAAATAAGAAATTTCAGCACCAGTAAAAGACGAGAAATATAGGGCACATAAAT 16509</pre> | Old 16450 TCTGTGGGAAATAAGAAATTTCAGCACCAGTAAAAGACGAGAAATATAGGGCACATAAAT 16509</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YAL063C YAL063C], [https://www.yeastgenome.org/locus/YAL063C-A YAL063C-A] | ||
+ | | 23253 | ||
+ | | 23253 | ||
+ | | Insertion | ||
+ | | | ||
+ | | T | ||
|- | |- | ||
| || colspan="6" |A single nucleotide insertion was made in the intergenic region between ORFs [https://www.yeastgenome.org/locus/YAL063C-A YAL063C-A] and FLO9/[https://www.yeastgenome.org/locus/YAL063C YAL063C]. | | || colspan="6" |A single nucleotide insertion was made in the intergenic region between ORFs [https://www.yeastgenome.org/locus/YAL063C-A YAL063C-A] and FLO9/[https://www.yeastgenome.org/locus/YAL063C YAL063C]. | ||
Line 469: | Line 908: | ||
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||
Old 23219 TTTGCTCATCATTGGATAATTTCTTTTTTTTTTTT-GATGCATCCAAACTTGGACCCCTT 23277</pre> | Old 23219 TTTGCTCATCATTGGATAATTTCTTTTTTTTTTTT-GATGCATCCAAACTTGGACCCCTT 23277</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YAL021C YAL021C], [https://www.yeastgenome.org/locus/YAL022C YAL022C] | ||
+ | | 110470 | ||
+ | | 110471 | ||
+ | | Substitution | ||
+ | | CG | ||
+ | | GC | ||
|- | |- | ||
| || colspan="6" |A dinucleotide substitution was made in the intergenic region between ORFs FUN26/[https://www.yeastgenome.org/locus/YAL022C YAL022C] and CCR4/[https://www.yeastgenome.org/locus/YAL021C YAL021C]. | | || colspan="6" |A dinucleotide substitution was made in the intergenic region between ORFs FUN26/[https://www.yeastgenome.org/locus/YAL022C YAL022C] and CCR4/[https://www.yeastgenome.org/locus/YAL021C YAL021C]. | ||
Line 477: | Line 923: | ||
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | ||
Old 110456 GCGTTTGATGATAACGTGTCGCCGTAACGTAAATCATTCATCCTTTCCTATGATTTTTTA 110515</pre> | Old 110456 GCGTTTGATGATAACGTGTCGCCGTAACGTAAATCATTCATCCTTTCCTATGATTTTTTA 110515</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YAL010C YAL010C], [https://www.yeastgenome.org/locus/YAL011W YAL011W] | ||
+ | | 134125 | ||
+ | | 134125 | ||
+ | | Insertion | ||
+ | | | ||
+ | | C | ||
|- | |- | ||
| || colspan="6" |A single nucleotide substitution was made in the intergenic region between ORFs SWC3/[https://www.yeastgenome.org/locus/YAL011W YAL011W] and MDM10/[https://www.yeastgenome.org/locus/YAL010C YAL010C]. | | || colspan="6" |A single nucleotide substitution was made in the intergenic region between ORFs SWC3/[https://www.yeastgenome.org/locus/YAL011W YAL011W] and MDM10/[https://www.yeastgenome.org/locus/YAL010C YAL010C]. | ||
Line 485: | Line 938: | ||
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | ||
Old 134096 ATTCTGCTTTAACGCCATTATGATTATACA-ATTGTATTACTTATTTTTTAACCTGTATA 134154</pre> | Old 134096 ATTCTGCTTTAACGCCATTATGATTATACA-ATTGTATTACTTATTTTTTAACCTGTATA 134154</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2011-02-03 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/TEL01R TEL01R] TEL01R-XC | ||
+ | | 229568 | ||
+ | | 229568 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
|- | |- | ||
| || colspan="6" |A single nucleotide insertion was made within the right telomere of Chromosome 1, [https://www.yeastgenome.org/locus/TEL01R TEL01R] specifically within the X element Core sequence TEL01R-XC. | | || colspan="6" |A single nucleotide insertion was made within the right telomere of Chromosome 1, [https://www.yeastgenome.org/locus/TEL01R TEL01R] specifically within the X element Core sequence TEL01R-XC. | ||
Line 493: | Line 953: | ||
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||
Old 229533 ATTACGCATGGAGTTAAGAGTATTTACATGATAATT-GGGTTCCGTGATTCATTATAGAT 229591</pre> | Old 229533 ATTACGCATGGAGTTAAGAGTATTTACATGATAATT-GGGTTCCGTGATTCATTATAGAT 229591</pre> | ||
− | Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | + | '''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br> |
− | |- | + | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
− | |2008-03-05||[https://www.yeastgenome.org/locus/YAL044C YAL044C] | + | |- style="height:30px; width:30px; text-align:center;" |
− | |- | + | | rowspan="3"| 2008-03-05 |
− | + | | rowspan="3"| [https://www.yeastgenome.org/locus/YAL044C YAL044C] | |
− | |- | + | | 58424 |
− | + | | 58424 | |
+ | | Substitution | ||
+ | | C | ||
+ | | T | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 58247 | ||
+ | | 58247 | ||
+ | | Substitution | ||
+ | | A | ||
+ | | C | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 58196 | ||
+ | | 58196 | ||
+ | | Substitution | ||
+ | | A | ||
+ | | C | ||
|- | |- | ||
| || colspan="6" |Three single base substitutions were made within ORF [https://www.yeastgenome.org/locus/YAL044C YAL044C]/GCV3 to correct errors in the systematic reference sequence for Chromosome I: Two separate A -> C transversions at 58196 and 58247, and a C -> T transition at 58424. These errors were verified by sequencing in 3 different strains, all of ResGen BY4741 (S288C) background. SGD thanks Michael E. Rice for bringing these errors to our attention, and for verifying the correct sequence. | | || colspan="6" |Three single base substitutions were made within ORF [https://www.yeastgenome.org/locus/YAL044C YAL044C]/GCV3 to correct errors in the systematic reference sequence for Chromosome I: Two separate A -> C transversions at 58196 and 58247, and a C -> T transition at 58424. These errors were verified by sequencing in 3 different strains, all of ResGen BY4741 (S288C) background. SGD thanks Michael E. Rice for bringing these errors to our attention, and for verifying the correct sequence. | ||
Line 517: | Line 992: | ||
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||
Old: 58371 ATTCTTGTTTAGGGCATTGCCGGAGCTGTTTCTCAAAAACAATTTGCTCACAGCGGGCAT 58430</pre> | Old: 58371 ATTCTTGTTTAGGGCATTGCCGGAGCTGTTTCTCAAAAACAATTTGCTCACAGCGGGCAT 58430</pre> | ||
− | |- | + | |- style="height:30px; width:30px; text-align:center;" |
− | |2007-04-05||[https://www.yeastgenome.org/locus/YAL004W YAL004W], [https://www.yeastgenome.org/locus/YAL005C YAL005C] | + | | rowspan="3"| 2007-04-05 |
− | |- | + | | rowspan="3"| [https://www.yeastgenome.org/locus/YAL004W YAL004W], [https://www.yeastgenome.org/locus/YAL005C YAL005C] |
− | + | | 140169 | |
− | |- | + | | 140169 |
− | + | | Substitution | |
+ | | A | ||
+ | | G | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 140182 | ||
+ | | 140182 | ||
+ | | Substitution | ||
+ | | A | ||
+ | | G | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 140811 | ||
+ | | 140811 | ||
+ | | Substitution | ||
+ | | A | ||
+ | | G | ||
|- | |- | ||
| || colspan="6" |Three single nucleotide substitutions were made within the coding sequence of SSA1 (at nucleotide positions 623, 1252, and 1265 relative to the SSA1 coding sequence), based on the sequence reported by Slater and Craig (1989) and corresponding to GenBank entry X12926. These changes result in phenylalanine to serine changes at amino acid residues 208 and 422 and a change from serine to proline at amino acid residue 418. Thanks to Andreas Bracher for bringing these corrections to our attention. | | || colspan="6" |Three single nucleotide substitutions were made within the coding sequence of SSA1 (at nucleotide positions 623, 1252, and 1265 relative to the SSA1 coding sequence), based on the sequence reported by Slater and Craig (1989) and corresponding to GenBank entry X12926. These changes result in phenylalanine to serine changes at amino acid residues 208 and 422 and a change from serine to proline at amino acid residue 418. Thanks to Andreas Bracher for bringing these corrections to our attention. | ||
Line 529: | Line 1,018: | ||
<pre>638 ATACCGTCTTCAATGGACAACAAAGAGAC 610 new sequence, coordinates relative to SSA1 coding region | <pre>638 ATACCGTCTTCAATGGACAACAAAGAGAC 610 new sequence, coordinates relative to SSA1 coding region | ||
||||||||||||||| ||||||||||||| | ||||||||||||||| ||||||||||||| | ||
− | + | 140796 ATACCGTCTTCAATGAACAACAAAGAGAC 140824 old sequence, chromosomal coordinates | |
− | |||
− | + | 1279 TGGAAAAGATCTCGGACTTCTTTGTTGGAATGGTAGAGTTT 1239 new sequence, coordinates relative to SSA1 coding region | |
− | |||
− | |||
|||||||||||||| |||||||||||| ||||||||||||| | |||||||||||||| |||||||||||| ||||||||||||| | ||
− | + | 140155 TGGAAAAGATCTCGAACTTCTTTGTTGAAATGGTAGAGTTT 140195 old sequence, chromosomal coordinates</pre> | |
− | |||
Slater MR and Craig EA (1989) The SSA1 and SSA2 genes of the yeast Saccharomyces cerevisiae. Nucleic Acids Res 17(2):805-6 | Slater MR and Craig EA (1989) The SSA1 and SSA2 genes of the yeast Saccharomyces cerevisiae. Nucleic Acids Res 17(2):805-6 | ||
− | |- | + | |- style="height:30px; width:30px; text-align:center;" |
− | |2006-01-19 | + | | 2006-01-19 |
+ | | [https://www.yeastgenome.org/locus/YAR042W YAR042W] | ||
+ | | 193355 | ||
+ | | 193355 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | A | ||
|- | |- | ||
| || colspan="6" |When confirming the G nucleotide insertion that resulted in the merger of SWH1/[https://www.yeastgenome.org/locus/YAR042W YAR042W] and OSH1/[https://www.yeastgenome.org/locus/YAR044W YAR044W] (see 2003-09-27), SGD detected an additional sequencing error. The substitution of an A nt for a G nt changes amino acid 248 from a serine to an asparagine. | | || colspan="6" |When confirming the G nucleotide insertion that resulted in the merger of SWH1/[https://www.yeastgenome.org/locus/YAR042W YAR042W] and OSH1/[https://www.yeastgenome.org/locus/YAR044W YAR044W] (see 2003-09-27), SGD detected an additional sequencing error. The substitution of an A nt for a G nt changes amino acid 248 from a serine to an asparagine. | ||
Line 547: | Line 1,038: | ||
|||||||||||||| |||||||||||||||| | |||||||||||||| |||||||||||||||| | ||
Old: 193341 CGACACCGCCACCAGCACCAAGATCGCCATC 193371</pre> | Old: 193341 CGACACCGCCACCAGCACCAAGATCGCCATC 193371</pre> | ||
− | |- | + | |- style="height:30px; width:30px; text-align:center;" |
− | |2004-07-20||[https://www.yeastgenome.org/locus/YAL051W YAL051W] | + | | rowspan="2"| 2004-07-20 |
− | |- | + | | rowspan="2"| [https://www.yeastgenome.org/locus/YAL051W YAL051W] |
− | + | | 51694 | |
+ | | 51694 | ||
+ | | Deletion | ||
+ | | G | ||
+ | | | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 51688 | ||
+ | | 51688 | ||
+ | | Deletion | ||
+ | | G | ||
+ | | | ||
|- | |- | ||
| || colspan="6" |The work of Kellis et al. 2003 predicted the deletion of 2 separate G nucleotides in [https://www.yeastgenome.org/locus/YAL051W YAL051W] at chromosomal coordinates 51688 and 51694, and these sequence errors were confirmed in S288C by SGD. As a consequence of these changes, [https://www.yeastgenome.org/locus/YAL051W YAL051W] was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 1062 to 1047 amino acids. | | || colspan="6" |The work of Kellis et al. 2003 predicted the deletion of 2 separate G nucleotides in [https://www.yeastgenome.org/locus/YAL051W YAL051W] at chromosomal coordinates 51688 and 51694, and these sequence errors were confirmed in S288C by SGD. As a consequence of these changes, [https://www.yeastgenome.org/locus/YAL051W YAL051W] was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 1062 to 1047 amino acids. | ||
Line 556: | Line 1,057: | ||
|||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| | |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| | ||
Old: 51666 TTTATTTGATTATGACTTTTTGGTTTGGGCAATGACTTTGCTTAAAAATTTTCTTTCCAA 51725</pre> | Old: 51666 TTTATTTGATTATGACTTTTTGGTTTGGGCAATGACTTTGCTTAAAAATTTTCTTTCCAA 51725</pre> | ||
− | Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | + | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> |
− | |- | + | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Errata] <br> |
− | |2004-01-30 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2004-01-30 | ||
+ | | [https://www.yeastgenome.org/locus/YAR014C YAR014C] | ||
+ | | 166772 | ||
+ | | 166772 | ||
+ | | Deletion | ||
+ | | G | ||
+ | | | ||
|- | |- | ||
| || colspan="6" |Kellis et al. 2003 predicted and confirmed the deletion of a single G nucleotide at chromosomal coordinate 166772. As a consequence of this sequence change, [https://www.yeastgenome.org/locus/YAR014C YAR014C] was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 702 to 707 amino acids. | | || colspan="6" |Kellis et al. 2003 predicted and confirmed the deletion of a single G nucleotide at chromosomal coordinate 166772. As a consequence of this sequence change, [https://www.yeastgenome.org/locus/YAR014C YAR014C] was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 702 to 707 amino acids. | ||
Line 564: | Line 1,072: | ||
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||
Old: 166731 TTGTAAGGACAATATCATTTACGAATAATTTCATCCAATTGGTTTCATCAACACA 166785</pre> | Old: 166731 TTGTAAGGACAATATCATTTACGAATAATTTCATCCAATTGGTTTCATCAACACA 166785</pre> | ||
− | Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | + | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> |
− | |- | + | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Errata] <br> |
− | |2004-01-24 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2004-01-24 | ||
+ | | [https://www.yeastgenome.org/locus/YAL056W YAL056W] | ||
+ | | 41778 | ||
+ | | 41778 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
|- | |- | ||
| || colspan="6" |Kellis et al. 2003 predicted and confirmed the insertion of a single G nucleotide after the T at chromosomal coordinate 41778. As a consequence of this sequence change, [https://www.yeastgenome.org/locus/YAL056W YAL056W] was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein increasing from 847 to 880 amino acids. | | || colspan="6" |Kellis et al. 2003 predicted and confirmed the insertion of a single G nucleotide after the T at chromosomal coordinate 41778. As a consequence of this sequence change, [https://www.yeastgenome.org/locus/YAL056W YAL056W] was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein increasing from 847 to 880 amino acids. | ||
Line 572: | Line 1,087: | ||
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | ||
Old: 41724 GCGAAAATGAAGATACAAATTCAAATATAGTAGTTGGTGTCGGTGGCACTTCTTT-CAAT 41782</pre> | Old: 41724 GCGAAAATGAAGATACAAATTCAAATATAGTAGTTGGTGTCGGTGGCACTTCTTT-CAAT 41782</pre> | ||
− | Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | + | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> |
− | |- | + | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Errata] <br> |
− | |2004-01-22 | + | |- style="height:30px; width:30px; text-align:center;" |
+ | | 2004-01-22 | ||
+ | | [https://www.yeastgenome.org/locus/YAL002W YAL002W] | ||
+ | | 143848 | ||
+ | | 143848 | ||
+ | | Insertion | ||
+ | | | ||
+ | | C | ||
|- | |- | ||
| || colspan="6" |Kellis et al. 2003 and Cliften et al. 2003 predicted and confirmed the insertion of a single C nucleotide after the C at chromosomal coordinate 143848. As a consequence of this sequence change, [https://www.yeastgenome.org/locus/YAL002W YAL002W] was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 1176 to 1274 amino acids. | | || colspan="6" |Kellis et al. 2003 and Cliften et al. 2003 predicted and confirmed the insertion of a single C nucleotide after the C at chromosomal coordinate 143848. As a consequence of this sequence change, [https://www.yeastgenome.org/locus/YAL002W YAL002W] was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 1176 to 1274 amino acids. | ||
Line 580: | Line 1,102: | ||
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | ||
Old: 143826 ATCTAGTTCTTCATATACGGCAC-TCCCCTGAACGAAGATGGTCCTAAAGGGGTAGCTTC 143884</pre> | Old: 143826 ATCTAGTTCTTCATATACGGCAC-TCCCCTGAACGAAGATGGTCCTAAAGGGGTAGCTTC 143884</pre> | ||
− | Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | + | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> |
− | Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | + | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Errata] <br> |
− | |- | + | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> |
− | |2003-12-17||[https://www.yeastgenome.org/locus/YAL013W YAL013W] | + | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> |
− | |- | + | |- style="height:30px; width:30px; text-align:center;" |
− | + | | rowspan="2"| 2003-12-17 | |
+ | | rowspan="2"| [https://www.yeastgenome.org/locus/YAL013W YAL013W] | ||
+ | | 130239 | ||
+ | | 130239 | ||
+ | | Insertion | ||
+ | | | ||
+ | | C | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 130246 | ||
+ | | 130247 | ||
+ | | Substitution | ||
+ | | CG | ||
+ | | GC | ||
|- | |- | ||
| || colspan="6" |Kellis et al. 2003 and Brachat et al. 2003 predicted and confirmed the insertion of a single C nucleotide after the C at position 130239 on Chromosome I. As a consequence of this sequence change, [https://www.yeastgenome.org/locus/YAL013W YAL013W] was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 362 to 420 amino acids. They also found an additional seqeuncing error: the CG at 130246-130247 should be GC. | | || colspan="6" |Kellis et al. 2003 and Brachat et al. 2003 predicted and confirmed the insertion of a single C nucleotide after the C at position 130239 on Chromosome I. As a consequence of this sequence change, [https://www.yeastgenome.org/locus/YAL013W YAL013W] was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 362 to 420 amino acids. They also found an additional seqeuncing error: the CG at 130246-130247 should be GC. | ||
Line 591: | Line 1,125: | ||
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| | ||
New: 130201 ACTTGATAACAAGACGCTGAGCTGTATCACGGGCTACGCCAGCGCAGCACAGCTGTGCTA 130260</pre> | New: 130201 ACTTGATAACAAGACGCTGAGCTGTATCACGGGCTACGCCAGCGCAGCACAGCTGTGCTA 130260</pre> | ||
− | Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | + | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> |
− | Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 | + | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Errata] <br> |
− | |- | + | '''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br> |
− | |2003-09-27 | + | [https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br> |
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2003-09-27 | ||
+ | | [https://www.yeastgenome.org/locus/YAR042W YAR042W], [https://www.yeastgenome.org/locus/YAR044W YAR044W] | ||
+ | | 193300 | ||
+ | | 193300 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
|- | |- | ||
| || colspan="6" |Insertion of a single G after the G at 193300 merged SWH1/[https://www.yeastgenome.org/locus/YAR042W YAR042W] and OSH1/[https://www.yeastgenome.org/locus/YAR044W YAR044W]. After merging [https://www.yeastgenome.org/locus/YAR042W YAR042W] (coordinates 192613-193383 (1-771)) and [https://www.yeastgenome.org/locus/YAR044W YAR044W] (coordinates 193599-196178 (1-2580)), the coordinates of the merged ORF, SWH1/[https://www.yeastgenome.org/locus/YAR042W YAR042W], are 192613-196179 (1-3567). OSH1 and [https://www.yeastgenome.org/locus/YAR044W YAR044W] are now aliases of SWH1/[https://www.yeastgenome.org/locus/YAR042W YAR042W]. This sequence change was predicted by several studies, then verified in S288c by SGD. | | || colspan="6" |Insertion of a single G after the G at 193300 merged SWH1/[https://www.yeastgenome.org/locus/YAR042W YAR042W] and OSH1/[https://www.yeastgenome.org/locus/YAR044W YAR044W]. After merging [https://www.yeastgenome.org/locus/YAR042W YAR042W] (coordinates 192613-193383 (1-771)) and [https://www.yeastgenome.org/locus/YAR044W YAR044W] (coordinates 193599-196178 (1-2580)), the coordinates of the merged ORF, SWH1/[https://www.yeastgenome.org/locus/YAR042W YAR042W], are 192613-196179 (1-3567). OSH1 and [https://www.yeastgenome.org/locus/YAR044W YAR044W] are now aliases of SWH1/[https://www.yeastgenome.org/locus/YAR042W YAR042W]. This sequence change was predicted by several studies, then verified in S288c by SGD. | ||
Line 601: | Line 1,143: | ||
New: 193261 CTTGAACACGGTGCTGACCCCTTCAAGAGAGACCGCAAGGGCAAACTGCCCATCGAGCTC 193320</pre> | New: 193261 CTTGAACACGGTGCTGACCCCTTCAAGAGAGACCGCAAGGGCAAACTGCCCATCGAGCTC 193320</pre> | ||
Schmalix WA and Bandlow W (1994) SWH1 from yeast encodes a candidate nuclear factor containing ankyrin repeats and showing homology to mammalian oxysterol-binding protein. Biochim Biophys Acta 1219(1):205-10 | Schmalix WA and Bandlow W (1994) SWH1 from yeast encodes a candidate nuclear factor containing ankyrin repeats and showing homology to mammalian oxysterol-binding protein. Biochim Biophys Acta 1219(1):205-10 | ||
− | Beh CT, et al. (2001) Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics 157(3):1117-40 | + | Beh CT, et al. (2001) Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics 157(3):1117-40 <br> |
− | Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | + | [https://www.yeastgenome.org/reference/S000059993 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11238399 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1461579 Full-Text] <br> |
− | Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 | + | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> |
− | Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | + | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Errata] <br> |
− | |- | + | '''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br> |
− | |2002-12-17||[https://www.yeastgenome.org/locus/YAL023C YAL023C] | + | [https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br> |
− | |- | + | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> |
− | + | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | |
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | rowspan="2"| 2002-12-17 | ||
+ | | rowspan="2"| [https://www.yeastgenome.org/locus/YAL023C YAL023C] | ||
+ | | 108137 | ||
+ | | 108137 | ||
+ | | Insertion | ||
+ | | | ||
+ | | CC | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 108143 | ||
+ | | 108143 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
|- | |- | ||
| || colspan="6" |Due to the insertion of CC after the C at 108137, and the insertion of a G after the G at 108143 in the systematic sequence of Chromosome I, the coordinates of PMT2/[https://www.yeastgenome.org/locus/YAL023C YAL023C] have been changed. Thanks to Verena Girrbach (verena.girrbach@biologie.uni-regensburg.de) for reporting this sequence error in the systematic sequence of PMT2/FUN25/[https://www.yeastgenome.org/locus/YAL023C YAL023C] to SGD. | | || colspan="6" |Due to the insertion of CC after the C at 108137, and the insertion of a G after the G at 108143 in the systematic sequence of Chromosome I, the coordinates of PMT2/[https://www.yeastgenome.org/locus/YAL023C YAL023C] have been changed. Thanks to Verena Girrbach (verena.girrbach@biologie.uni-regensburg.de) for reporting this sequence error in the systematic sequence of PMT2/FUN25/[https://www.yeastgenome.org/locus/YAL023C YAL023C] to SGD. | ||
Line 614: | Line 1,170: | ||
||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| | ||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| | ||
New: 108121 AGTCTGGGTAAATTTCCCCAGAAGGGAAGTCCCAAGAACCGTTGTAGCCTGCCAAATAAC 108180</pre> | New: 108121 AGTCTGGGTAAATTTCCCCAGAAGGGAAGTCCCAAGAACCGTTGTAGCCTGCCAAATAAC 108180</pre> | ||
− | |- | + | |- style="height:30px; width:30px; text-align:center;" |
− | |2002-12-17 | + | | 2002-12-17 |
+ | | [https://www.yeastgenome.org/locus/YAL014C YAL014C] | ||
+ | | 128441 | ||
+ | | 128441 | ||
+ | | Insertion | ||
+ | | | ||
+ | | T | ||
|- | |- | ||
| || colspan="6" |Due to the insertion of a single T nucleotide after the T at coordinate 128441 in the systematic sequence of Chromosome I, the ORF SUN8/[https://www.yeastgenome.org/locus/YAL014C YAL014C] was extended 450 nucleotides in the 3' direction, making the protein product 150 amino acids longer at the C-terminus. Thanks to Lena Burri, Trevor Lithgow, and Hugh Pelham for reporting this sequence error in the systematic sequence of SYN8/UIP2/[https://www.yeastgenome.org/locus/YAL014C YAL014C] to SGD. | | || colspan="6" |Due to the insertion of a single T nucleotide after the T at coordinate 128441 in the systematic sequence of Chromosome I, the ORF SUN8/[https://www.yeastgenome.org/locus/YAL014C YAL014C] was extended 450 nucleotides in the 3' direction, making the protein product 150 amino acids longer at the C-terminus. Thanks to Lena Burri, Trevor Lithgow, and Hugh Pelham for reporting this sequence error in the systematic sequence of SYN8/UIP2/[https://www.yeastgenome.org/locus/YAL014C YAL014C] to SGD. | ||
Line 622: | Line 1,184: | ||
New: 128401 TTCTAAATCAACCAGCAGCGAGTCGTTCTGAGAAACGATCTCATTATTAAGGTCCAGCGA 128460</pre> | New: 128401 TTCTAAATCAACCAGCAGCGAGTCGTTCTGAGAAACGATCTCATTATTAAGGTCCAGCGA 128460</pre> | ||
Lewis MJ and Pelham HR (2002) A new yeast endosomal SNARE related to mammalian syntaxin 8. Traffic 3(12):922-9 | Lewis MJ and Pelham HR (2002) A new yeast endosomal SNARE related to mammalian syntaxin 8. Traffic 3(12):922-9 | ||
− | |- | + | |- style="height:30px; width:30px; text-align:center;" |
− | |1998-09-02||[https://www.yeastgenome.org/locus/YAL062W YAL062W], [https://www.yeastgenome.org/locus/YAL063C YAL063C] | + | | rowspan="6"| 1998-09-02 |
− | |- | + | | rowspan="6"| [https://www.yeastgenome.org/locus/YAL062W YAL062W], [https://www.yeastgenome.org/locus/YAL063C YAL063C] |
− | + | | 29254 | |
− | |- | + | | 29254 |
− | + | | Deletion | |
− | |- | + | | A |
− | + | | | |
− | |- | + | |-style="height:30px; width:30px; text-align:center;" |
− | + | | 29289 | |
− | |- | + | | 29289 |
− | + | | Deletion | |
+ | | A | ||
+ | | | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 29290 | ||
+ | | 29290 | ||
+ | | Deletion | ||
+ | | A | ||
+ | | | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 29291 | ||
+ | | 29291 | ||
+ | | Deletion | ||
+ | | T | ||
+ | | | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 29307 | ||
+ | | 29307 | ||
+ | | Deletion | ||
+ | | A | ||
+ | | | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 29301 | ||
+ | | 29301 | ||
+ | | Substitution | ||
+ | | T | ||
+ | | A | ||
|- | |- | ||
| || colspan="6" |The following changes were made to the systematic sequence of Chromosome I in the region encompassing features FLO9/[https://www.yeastgenome.org/locus/YAL063C YAL063C] and GDH3/[https://www.yeastgenome.org/locus/YAL062W YAL062W]: deletion of the A at 29254, deletion of AAT at 29289-29291, transversion of T to A at 29301, and deletion of the A at 29307. | | || colspan="6" |The following changes were made to the systematic sequence of Chromosome I in the region encompassing features FLO9/[https://www.yeastgenome.org/locus/YAL063C YAL063C] and GDH3/[https://www.yeastgenome.org/locus/YAL062W YAL062W]: deletion of the A at 29254, deletion of AAT at 29289-29291, transversion of T to A at 29301, and deletion of the A at 29307. | ||
Line 642: | Line 1,230: | ||
|||||||| ||||||||| ||||| ||||||||||||||||||||||||||||||||| | |||||||| ||||||||| ||||| ||||||||||||||||||||||||||||||||| | ||
New: 29280 GATCCTTT---TTTTTTTGAAGAAAA-GGCAGCCAAGTTACGTCATAGAGAAAACTCCCT 29335</pre> | New: 29280 GATCCTTT---TTTTTTTGAAGAAAA-GGCAGCCAAGTTACGTCATAGAGAAAACTCCCT 29335</pre> | ||
− | |- | + | |- style="height:30px; width:30px; text-align:center;" |
− | |1998-09-02||[https://www.yeastgenome.org/locus/YAR060C YAR060C], [https://www.yeastgenome.org/locus/YARCdelta8 YARCdelta8] | + | | rowspan="3"| 1998-09-02 |
− | |- | + | | rowspan="3"| [https://www.yeastgenome.org/locus/YAR060C YAR060C], [https://www.yeastgenome.org/locus/YARCdelta8 YARCdelta8] |
− | + | | 210810 | |
− | |- | + | | 210810 |
− | + | | Substitution | |
+ | | T | ||
+ | | A | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 211011 | ||
+ | | 211011 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | T | ||
+ | |-style="height:30px; width:30px; text-align:center;" | ||
+ | | 210804 | ||
+ | | 210804 | ||
+ | | Deletion | ||
+ | | T | ||
+ | | | ||
|- | |- | ||
| || colspan="6" |The following changes were made to the systematic sequence of Chromosome I in the region encompassing features [https://www.yeastgenome.org/locus/YARCdelta8 YARCdelta8] and [https://www.yeastgenome.org/locus/YAR060C YAR060C]: deletion of the T at 210804, transversion of T to A at 210810, and transition of C to T at 211011. | | || colspan="6" |The following changes were made to the systematic sequence of Chromosome I in the region encompassing features [https://www.yeastgenome.org/locus/YARCdelta8 YARCdelta8] and [https://www.yeastgenome.org/locus/YAR060C YAR060C]: deletion of the T at 210804, transversion of T to A at 210810, and transition of C to T at 211011. | ||
Line 656: | Line 1,258: | ||
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | ||
New: 210955 GCCCTTCTACGGCTTCTTCTAACCAATTGTTCCCCGTGAGTTGCTTTCTCTGAAAACCTT 211014</pre> | New: 210955 GCCCTTCTACGGCTTCTTCTAACCAATTGTTCCCCGTGAGTTGCTTTCTCTGAAAACCTT 211014</pre> | ||
− | |- | + | |- style="height:30px; width:30px; text-align:center;" |
− | |1998-09-02 | + | | 1998-09-02 |
+ | | [https://www.yeastgenome.org/locus/YAR050W YAR050W] | ||
+ | | 203939 | ||
+ | | 203939 | ||
+ | | Substitution | ||
+ | | T | ||
+ | | G | ||
|- | |- | ||
| || colspan="6" |The following sequence change was made to the systematic sequence of Chromosome I within the ORF [https://www.yeastgenome.org/locus/YAR050W YAR050W]/FLO1: transversion of T to G at 203939. | | || colspan="6" |The following sequence change was made to the systematic sequence of Chromosome I within the ORF [https://www.yeastgenome.org/locus/YAR050W YAR050W]/FLO1: transversion of T to G at 203939. | ||
Line 663: | Line 1,271: | ||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||
New: 203876 CAATTCTATCAGTAGGTGGTGCAACCGCGTTCAACTGTTGTGCTCAACAGCAACCGCCGA 203935</pre> | New: 203876 CAATTCTATCAGTAGGTGGTGCAACCGCGTTCAACTGTTGTGCTCAACAGCAACCGCCGA 203935</pre> | ||
+ | |} | ||
+ | |||
+ | =Annotation Changes= | ||
+ | {| border="1" style="border-collapse:collapse; width:90%" cellpadding="6" | ||
+ | ! Date !! Affected Features | ||
+ | |- | ||
+ | |2014-11-18 | ||
+ | |[https://www.yeastgenome.org/locus/ARS104 ARS104], [https://www.yeastgenome.org/locus/ARS106 ARS106], [https://www.yeastgenome.org/locus/ARS107 ARS107], [https://www.yeastgenome.org/locus/ARS110 ARS110], [https://www.yeastgenome.org/locus/ARS111 ARS111]<br> | ||
+ | As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome I based on Liachko et al. 2013: ARS104, ARS106, ARS107, ARS110, ARS111.<br><br> | ||
+ | '''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text] <br> | ||
+ | |- | ||
+ | |2014-11-18 | ||
+ | |[https://www.yeastgenome.org/locus/ARS102 ARS102], [https://www.yeastgenome.org/locus/ARS105 ARS105], [https://www.yeastgenome.org/locus/ARS106 ARS106], [https://www.yeastgenome.org/locus/ARS108 ARS108]<br> | ||
+ | The chromosomal coordinates of the following ARS elements on Chromosome I were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS102, ARS105, ARS106, ARS108.<br><br> | ||
+ | '''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text] <br> | ||
+ | |- | ||
+ | |2014-11-18 | ||
+ | |[https://www.yeastgenome.org/locus/YAR061W YAR061W], [https://www.yeastgenome.org/locus/YAR062W YAR062W]<br> | ||
+ | As part of SGD's genome annotation revision R64.2, the two pseudogenes YAR061W + YAR062W have been combined into a single pseudogene, keeping the name YAR061W. This region is homologous to parts of FLO1/YAR050W and FLO9/YAL063C, but contains stop codons at several positions.<br><br> | ||
+ | Teunissen AW and Steensma HY (1995) Review: the dominant flocculation genes of Saccharomyces cerevisiae constitute a new subtelomeric gene family. Yeast 11(11):1001-13 | ||
+ | |- | ||
+ | |2007-05-08 | ||
+ | |[https://www.yeastgenome.org/locus/snR18 snR18]<br> | ||
+ | Updated coordinates of snR18 based on GenBank U12981.<br><br> | ||
+ | '''Hiraga SI, et al.''' (2012) TFIIIC localizes budding yeast ETC sites to the nuclear periphery. Mol Biol Cell 23(14):2741-54 <br> | ||
+ | [https://www.yeastgenome.org/reference/S000149071 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/22496415 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3395662 Full-Text] | ||
+ | |- | ||
+ | |2007-05-08 | ||
+ | |[https://www.yeastgenome.org/locus/HRA1 HRA1]<br> | ||
+ | Updated coordinates of HRA1 based on Yang & Altman 2007.<br><br> | ||
+ | '''Yang L and Altman S''' (2007) A noncoding RNA in Saccharomyces cerevisiae is an RNase P substrate. RNA 13(5):682-90 <br> | ||
+ | [https://www.yeastgenome.org/reference/S000121958 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17379814 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1852816 Full-Text] | ||
+ | |- | ||
+ | |2007-03-07 | ||
+ | |[https://www.yeastgenome.org/locus/ARS102 ARS102], [https://www.yeastgenome.org/locus/ARS103 ARS103], [https://www.yeastgenome.org/locus/ARS105 ARS105], [https://www.yeastgenome.org/locus/ARS108 ARS108], [https://www.yeastgenome.org/locus/ARS111 ARS111], [https://www.yeastgenome.org/locus/ARS112 ARS112]<br> | ||
+ | The following ARS elements were added to the genome annotation on Chromosome I based on Xu et al. 2006: ARS102, ARS103, ARS105, ARS108, ARS111, ARS112.<br><br> | ||
+ | '''Xu W, et al.''' (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276 <br> | ||
+ | [https://www.yeastgenome.org/reference/S000119399 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17067396 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1657020 Full-Text]<br> | ||
+ | |- | ||
+ | |2007-03-07 | ||
+ | |[https://www.yeastgenome.org/locus/ARS109 ARS109]<br> | ||
+ | The ACS within ARS101/ARS109 at coordinates 159946-159936 was added based on Xu et al. 2006 and Theis & Newlon 2001.<br><br> | ||
+ | '''Theis JF and Newlon CS''' (2001) Two compound replication origins in Saccharomyces cerevisiae contain redundant origin recognition complex binding sites. Mol Cell Biol 21(8):2790-801 <br> | ||
+ | [https://www.yeastgenome.org/reference/S000060218 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11283258 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC86909 Full-Text] <br> | ||
+ | '''Xu W, et al.''' (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276 <br> | ||
+ | [https://www.yeastgenome.org/reference/S000119399 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17067396 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1657020 Full-Text]<br> | ||
+ | |- | ||
+ | |2007-02-06 | ||
+ | |[https://www.yeastgenome.org/locus/HRA1 HRA1]<br> | ||
+ | This RNA gene, HRA1, was described by Samanta et al. (2006). Approximate start and stop coordinates, which are accurate to within 25 nucleotides, have been specified for this non-coding RNA. Many thanks to Manoj Samanta for alerting us to this noncoding RNA.<br><br> | ||
+ | '''Samanta MP, et al.''' (2006) Global identification of noncoding RNAs in Saccharomyces cerevisiae by modulating an essential RNA processing pathway. Proc Natl Acad Sci U S A 103(11):4192-7 <br> | ||
+ | [https://www.yeastgenome.org/reference/S000114638 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16537507 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1389707 Full-Text] | ||
+ | |- | ||
+ | |2006-10-02 | ||
+ | |[https://www.yeastgenome.org/locus/ARS109 ARS109]<br> | ||
+ | An ARS Consensus Sequence (ACS) was added to ARS109 based on Nieduszynski et al. 2006.<br><br> | ||
+ | '''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9<br> | ||
+ | [https://www.yeastgenome.org/reference/S000117321 SGD papers] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed Entry] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1522085 Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement] | ||
+ | |- | ||
+ | |2006-09-06 | ||
+ | |[https://www.yeastgenome.org/locus/ARS104 ARS104], [https://www.yeastgenome.org/locus/ARS106 ARS106], [https://www.yeastgenome.org/locus/ARS107 ARS107]<br> | ||
+ | The following ARS elements on Chromosome I were added to SGD based on Nieduszynski et al. 2006: ARS104, ARS106, ARS107.<br><br> | ||
+ | '''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9<br> | ||
+ | [https://www.yeastgenome.org/reference/S000117321 SGD papers] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed Entry] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1522085 Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement] | ||
+ | |- | ||
+ | |2006-09-06 | ||
+ | |[https://www.yeastgenome.org/locus/ARS109 ARS109], [https://www.yeastgenome.org/locus/ARS110 ARS110]<br> | ||
+ | Updated coordinates of the following ARS elements on Chromosome I based on Nieduszynski et al. 2006: ARS101/109, ARS110.<br><br> | ||
+ | '''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9<br> | ||
+ | [https://www.yeastgenome.org/reference/S000117321 SGD papers] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed Entry] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1522085 Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement] | ||
+ | |- | ||
+ | |2006-05-08 | ||
+ | |[https://www.yeastgenome.org/locus/CEN1 CEN1]<br> | ||
+ | The previously annotated boundaries of CEN1 were adjusted to coincide with the 5' end of CDEI and the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae.<br><br> | ||
+ | '''Wieland G, et al.''' (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 <br> | ||
+ | [https://www.yeastgenome.org/reference/S000059647 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11222754 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC29730 Full-Text] <br> | ||
+ | '''Espelin CW, et al.''' (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68 <br> | ||
+ | [https://www.yeastgenome.org/reference/S000074756 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/13679521 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC266772 Full-Text] | ||
+ | |- | ||
+ | |2006-02-28 | ||
+ | |[https://www.yeastgenome.org/locus/ARS110 ARS110]<br> | ||
+ | This ARS element ARS110 was added to the genome annotation based on Wyrick et al. 2001 and Dimock et al. 1984.<br><br> | ||
+ | '''Dimock K, et al.''' (1984) Molecular cloning of the ADE1 gene of Saccharomyces cerevisiae and stability of the transformants. Gene 27(2):233-7 <br> | ||
+ | [https://www.yeastgenome.org/reference/S000040578 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/6373504 PubMed] | [https://www.sciencedirect.com/science/article/pii/0378111984901446?via%3Dihub Full-Text] <br> | ||
+ | '''Wyrick JJ, et al.''' (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60 <br> | ||
+ | [https://www.yeastgenome.org/reference/S000069019 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11743203 PubMed] | [https://science.sciencemag.org/content/294/5550/2357 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11743203&db=pmid YFGdb] | [https://www.ncbi.nlm.nih.gov/pubmed/11743187 Comments & Errata] | ||
+ | |- | ||
+ | |2004-10-18 | ||
+ | |[https://www.yeastgenome.org/locus/ARS109 ARS109]<br> | ||
+ | ARS101 was added to SGD based on Theis and Newlon 2001 and Wyrick et al. 2001.<br><br> | ||
+ | Theis JF and Newlon CS (2001) Two compound replication origins in Saccharomyces cerevisiae contain redundant origin recognition complex binding sites. Mol Cell Biol 21(8):2790-801 | ||
+ | '''Wyrick JJ, et al.''' (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60 <br> | ||
+ | [https://www.yeastgenome.org/reference/S000069019 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11743203 PubMed] | [https://science.sciencemag.org/content/294/5550/2357 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11743203&db=pmid YFGdb] | [https://www.ncbi.nlm.nih.gov/pubmed/11743187 Comments & Errata] | ||
+ | |- | ||
+ | |2004-10-12 | ||
+ | |[https://www.yeastgenome.org/locus/CEN1 CEN1]<br> | ||
+ | Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.<br><br> | ||
+ | '''Wieland G, et al.''' (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 <br> | ||
+ | [https://www.yeastgenome.org/reference/S000059647 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11222754 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC29730 Full-Text] <br> | ||
+ | '''Espelin CW, et al.''' (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68 <br> | ||
+ | [https://www.yeastgenome.org/reference/S000074756 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/13679521 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC266772 Full-Text] | ||
+ | |- | ||
+ | |2003-09-22 | ||
+ | |[https://www.yeastgenome.org/locus/YAL044C YAL044C]<br> | ||
+ | The start site of GCV3/YAL044C was moved 21 nt (7 codons) downstream, based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been updated. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br><br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | |- | ||
+ | |2003-09-22 | ||
+ | |[https://www.yeastgenome.org/locus/YAL034C YAL034C]<br> | ||
+ | The start site of FUN19/YAL034C was moved 150 nt (50 codons) downstream, based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been updated. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br><br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | |- | ||
+ | |2003-09-22 | ||
+ | |[https://www.yeastgenome.org/locus/YAL011W YAL011W]<br> | ||
+ | The start site of YAL011W was moved 39 nt (13 codons) downstream, based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been updated. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.<br><br> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Errata] <br> | ||
+ | '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br> | ||
+ | |- | ||
+ | |2003-09-09 | ||
+ | |[https://www.yeastgenome.org/locus/TEL01L TEL01L], [https://www.yeastgenome.org/locus/TEL01R TEL01R]<br> | ||
+ | The chromosomal locations for the following telomeric features on Chromosome I were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL01L, TEL01L-TR, TEL01L-XC, TEL01L-XR, TEL01R, TEL01R-TR, and TEL01R-XC.<br><br> | ||
+ | |- | ||
+ | |2003-07-29 | ||
+ | |[https://www.yeastgenome.org/locus/YAL016C-B YAL016C-B]<br> | ||
+ | Thanks to Kessler et al. 2003 for providing the coordinates of ORF YAL016C-B on Chromosome I.<br><br> | ||
+ | '''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073671 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] | [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br> | ||
+ | |- | ||
+ | |2003-07-29 | ||
+ | |[https://www.yeastgenome.org/locus/YAL037C-B YAL037C-B], [https://www.yeastgenome.org/locus/YAL067W-A YAL067W-A], [https://www.yeastgenome.org/locus/YAL068W-A YAL068W-A], [https://www.yeastgenome.org/locus/YAR035C-A YAR035C-A]<br> | ||
+ | Thanks to Kumar et al. 2002 for providing the coordinates of the following ORFs on Chromosome I: YAL037C-B, YAL067W-A, YAL068W-A, YAR035C-A.<br><br> | ||
+ | '''Kumar A, et al.''' (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073673 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11753363 PubMed] | [https://www.nature.com/articles/nbt0102-58 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11753363&db=pmid YFGdb] | [https://www.yeastgenome.org/reference/S000141796 Comments & Errata] <br> | ||
+ | |- | ||
+ | |2003-07-29 | ||
+ | |[https://www.yeastgenome.org/locus/YAL016C-A YAL016C-A], [https://www.yeastgenome.org/locus/YAL019W-A YAL019W-A], [https://www.yeastgenome.org/locus/YAL026C-A YAL026C-A], [https://www.yeastgenome.org/locus/YAL031W-A YAL031W-A], [https://www.yeastgenome.org/locus/YAL037C-A YAL037C-A], [https://www.yeastgenome.org/locus/YAL047W-A YAL047W-A], [https://www.yeastgenome.org/locus/YAL059C-A YAL059C-A], [https://www.yeastgenome.org/locus/YAR019W-A YAR019W-A]<br> | ||
+ | Thanks to MIPS for providing the coordinates of the following ORFs on Chromosome I: YAL016C-A, YAL019W-A, YAL026C-A, YAL031W-A, YAL037C-A, YAL047W-A, YAL059C-A, and YAR019W-A.<br><br> | ||
+ | |- | ||
+ | |2003-07-29 | ||
+ | |[https://www.yeastgenome.org/locus/YAL063C-A YAL063C-A]<br> | ||
+ | Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of ORF YAL063C-A on Chromosome I.<br><br> | ||
+ | '''Basrai MA, et al.''' (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9 <br> | ||
+ | [https://www.yeastgenome.org/reference/S000042214 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10490641 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC84699 Full-Text] <br> | ||
+ | '''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br> | ||
+ | '''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073672 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] | [https://genome.cshlp.org/content/12/8/1210.long Full-Text] | [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br> | ||
+ | |- | ||
+ | |2001-01-30 | ||
+ | |[https://www.yeastgenome.org/locus/YAL044W-A YAL044W-A]<br> | ||
+ | ORF added based on similarity to an S. pombe gene (information submitted by Valerie Wood).<br><br> | ||
+ | |- | ||
+ | |1999-07-17 | ||
+ | |[https://www.yeastgenome.org/locus/YAR043C YAR043C], [https://www.yeastgenome.org/locus/YAR052C YAR052C], [https://www.yeastgenome.org/locus/YAR074C YAR074C]<br> | ||
+ | Deleted ORF, does not encode a protein; this putative ORF was included in the original annotation of Chromosome I but was later withdrawn<br><br> | ||
|} | |} |
Latest revision as of 15:42, 2 October 2019
This page lists all sequence and annotation changes that have been made to the Chromosome I systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome I has been updated 115 times, affecting 55 features.
- The annotation of Chromosome I has been updated 25 times, affecting 39 features.
Current and past versions can be obtained from SGD's Download site.
Contents
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YAL013W | 130485 | 130486 | Deletion | GT | |
Two nucleotides were deleted near the 3' end of ORF DEP1/YAL013W, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 15 amino acids shorter.
New 130445 AGACTCCGAAATCAACGACGACTTCCACCAGTGGGCCCA--GTGACCGCCACACTGGACC 130502 ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old 130446 AGACTCCGAAATCAACGACGACTTCCACCAGTGGGCCCAGTGTGACCGCCACACTGGACC 130505 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAR019W-A | 175305 | 175305 | Insertion | C | |
A single C nucleotide was inserted very near the 3' end of ORF YAR019W-A, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 4 amino acids shorter.
New 175295 GGCACAGCAAAGTCCGCACAGAGCACTACAGTATAGCATAGAGTGCTAATGAGTTGATAG 175354 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 175293 GGCACAGCAAAGT-CGCACAGAGCACTACAGTATAGCATAGAGTGCTAATGAGTTGATAG 175351 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAL064W | 21531 | 21531 | Insertion | A | |
A single A nucleotide was inserted within ORF YAL064W, near its 5' end, moving the start codon out of frame with the rest of the protein. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 14 amino acids shorter.
New 21487 CTATCGATGTGTATACAAACGTACTTCAAATAAGCAATGCGAATATACTGCAACTTTTCG 21546 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 21490 CTATCGATGTGTATACAAACGTACTTCAAATAAGCAATGCGA-TATACTGCAACTTTTCG 21548 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAR014C | 167048 | 167048 | Substitution | G | C |
167084 | 167084 | Insertion | C | |||
167113 | 167113 | Insertion | T | |||
167133 | 167133 | Insertion | A | |||
167138 | 167138 | Insertion | T | |||
167142 | 167142 | Insertion | A | |||
167149 | 167149 | Insertion | T | |||
167551 | 167551 | Substitution | G | C | ||
167802 | 167802 | Substitution | C | T | ||
Six separate single nucleotides were inserted within ORF BUD14/YAR014C, and three single nucleotide substitutions were also made, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein is now two amino acids longer and a small section of the protein sequence is now different.
New 167033 GTCAGTTTGATTTGCCATTCCTCCACTAGACCCCAAGCTGGCTTGAATTTGCCCCTCTGT 167092 |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| Old 167034 GTCAGTTTGATTTGGCATTCCTCCACTAGACCCCAAGCTGGCTTGAATTTG-CCCTCTGT 167092 New 167093 GTTTTCCACGTTTGTTGTCTCTTCAATTTTCGATTTTGCATGAATATATTGTGAAATGTC 167152 ||||||||||||||||||||| |||||||||||||||||||| ||||| |||| |||||| Old 167093 GTTTTCCACGTTTGTTGTCTC-TCAATTTTCGATTTTGCATG-ATATA-TGTG-AATGTC 167148 New 167153 CTTTATTGCTCTAGATGATGGAATACTGCTGCTTTCTTCAACTATTGGAGTGGATGGTGA 167212 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 167149 C-TTATTGCTCTAGATGATGGAATACTGCTGCTTTCTTCAACTATTGGAGTGGATGGTGA 167207 New 167513 GACGTCGCTCACTACATCGCTCGTATCATCATCCTGGAATTTGCCAAAATTTAACTTCGC 167572 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 167508 GACGTCGCTCACTACATCGCTCGTATCATCATCCTGGAATTTGGCAAAATTTAACTTCGC 167567 New 167763 TATCCATTCAGTGCAGGTGTCGGAATTATACTCTCTGCATCACTTTGATTCTTGTTACCA 167822 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 167758 TATCCATTCAGTGCAGGTGTCGGAATTATACTCTCTGCATCACTCTGATTCTTGTTACCA 167817 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAL051W | 48772 | 48772 | Substitution | T | A |
49904 | 49904 | Substitution | C | A | ||
50327 | 50327 | Substitution | C | A | ||
Nucleotide changes within the coding region of OAF1/YAL051W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 70 is now Arginine rather than Tryptophan, residue 447 is now Glutamine rather than Proline, and residue 588 is now Lysine rather than Threonine.
New 48726 CATAATAGGAAAAGAAATAGAATATTGTTTGTCTGCCAGGCTTGTAGGAAGTCAAAAACA 48785 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 48727 CATAATAGGAAAAGAAATAGAATATTGTTTGTCTGCCAGGCTTGTTGGAAGTCAAAAACA 48786 New 49856 AATAATTGATAAATACCCAATACCGAACGATTTTATTTTATTGAGTCAAAGATGTCTAGC 49915 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 49857 AATAATTGATAAATACCCAATACCGAACGATTTTATTTTATTGAGTCCAAGATGTCTAGC 49916 New 50286 AACCGAGTTAGGGGCGATCTAAGCGATATCAATAATCACAAACTTTTGAGAATTCATAAA 50345 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old 50287 AACCGAGTTAGGGGCGATCTAAGCGATATCAATAATCACACACTTTTGAGAATTCATAAA 50346 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAL053W | 46231 | 46231 | Substitution | C | G |
46833 | 46833 | Substitution | G | A | ||
47821 | 47821 | Substitution | T | A | ||
47826 | 47826 | Substitution | C | T | ||
Nucleotide changes within the coding region of FLC2/YAL053W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 111 is now Cysteine rather than Serine, residue 312 is now Asparagine rather than Aspartic Acid, and residues 641-643 are now NDS rather than IDP.
New 46196 TTTGATTTATGTTCCTTGGGCCAAGTATCGCTTTGCCCCCTAAGTGCTGGGCGTATTGAT 46255 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 46197 TTTGATTTATGTTCCTTGGGCCAAGTATCGCTTTCCCCCCTAAGTGCTGGGCGTATTGAT 46256 New 46796 AGTGATTACAATTTTGACACCATTTTAGACGATTCGAATCTGTACACCACTTCTGAGAAG 46855 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 46797 AGTGATTACAATTTTGACACCATTTTAGACGATTCGGATCTGTACACCACTTCTGAGAAG 46856 New 47806 TGGCAAAAACAAAAATGATTCTGAACTGTTTGAATTGAGAAAAGCTGTTATGGACACCAA 47865 |||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| Old 47807 TGGCAAAAACAAAATTGATCCTGAACTGTTTGAATTGAGAAAAGCTGTTATGGACACCAA 47866 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAR023C | 179683 | 179683 | Substitution | T | A |
179761 | 179761 | Substitution | C | A | ||
The substitution of two nucleotides within the coding region of YAR023C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 20 is now Phenylalanine rather than Valine, and residue 46 is now Phenylalanine rather than Isoleucine.
New 179672 ATTGGTCTACTGAATGACCATATCTGAAGGACTACCATAGAGCCACCTAAACATATCCGG 179731 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 179670 ATTGGTCTACTGATTGACCATATCTGAAGGACTACCATAGAGCCACCTAAACATATCCGG 179729 New 179732 ATCACCATGGCAGGGGAGAGAACACCAGAAAACCAAATGTTTGTTAAAGTCGCCAAAATC 179791 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old 179730 ATCACCATGGCAGGGGAGAGAACACCAGAAACCCAAATGTTTGTTAAAGTCGCCAAAATC 179789 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAL026C | 96838 | 96838 | Deletion | C | |
98350 | 98351 | Substitution | CG | GC | ||
97678 | 97679 | Substitution | CC | GG | ||
97025 | 97026 | Substitution | AT | TA | ||
99563 | 99565 | Substitution | ATC | TCG | ||
96740 | 96740 | Substitution | G | C | ||
96841 | 96841 | Insertion | C | |||
Nucleotide changes within the coding region of DRS2/YAL026C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 45-46 are now AN rather than GY, residue 450 is now Alanine rather than Arginine, residue 674 is now Proline rather than Glycine, residues 891-892 are now NT rather than KS, residues 953-954 are now GD rather than AS, and residue 987 is now Valine rather than Leucine.
New 96716 TTTTAAAAATTTAAATTGGCCAACAGCTATATCAGCTGAACGAGCCGCTTGCATACCTTC 96775 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old 96717 TTTTAAAAATTTAAATTGGCCAAGAGCTATATCAGCTGAACGAGCCGCTTGCATACCTTC 96776 New 96826 CGTTGGCACCA-TCGCCAATGGCTAGCAGTAGTGAAGACGACTTTCTTTTTACCATTTTA 96884 ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| Old 96827 CGTTGGCACCACTCG-CAATGGCTAGCAGTAGTGAAGACGACTTTCTTTTTACCATTTTA 96885 New 97005 TCAATGACGAGCGCTAAGGTATTCATATCATGTGTTGACAATTGATGCTCGTTTAGAGCG 97064 ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 97006 TCAATGACGAGCGCTAAGGATTTCATATCATGTGTTGACAATTGATGCTCGTTTAGAGCG 97065 New 97665 GTTACAGAGTTTGGTTTACGGATGATAAACTTATACCCTAAATCTGCACCACCTTGAACG 97724 |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 97666 GTTACAGAGTTTCCTTTACGGATGATAAACTTATACCCTAAATCTGCACCACCTTGAACG 97725 New 98335 AAACTGTGAACAATGCAATAATCTGTCTGTTGATAATTTTCTCAACCGCGGTTCTTTTAA 98394 |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 98336 AAACTGTGAACAATCGAATAATCTGTCTGTTGATAATTTTCTCAACCGCGGTTCTTTTAA 98395 New 99535 GAAGTACATGACTTGGTGGTATATAATTCGCGTTCGCATGTGAGTTGGTGACCTTTGAAC 99594 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old 99536 GAAGTACATGACTTGGTGGTATATAATATCCGTTCGCATGTGAGTTGGTGACCTTTGAAC 99595 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAR019C | 172425 | 172425 | Insertion | G | |
174173 | 174173 | Substitution | G | C | ||
174187 | 174188 | Substitution | CG | GC | ||
172434 | 172434 | Deletion | G | |||
Nucleotide changes within the coding region of CDC15/YAR019C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 316 is now Alanine rather than Arginine, residue 321 is now Alanine rather than Proline, and 900-902 are now KDV rather than NGC.
New 172416 GAATTCCTTTTTGGGACATCC-TTGTTCCAGTTGTTGTTTAAAAACTCCGTTATTTGTAC 172474 |||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| Old 172414 GAATTCCTTTTT-GGACATCCGTTGTTCCAGTTGTTGTTTAAAAACTCCGTTATTTGTAC 172472 New 174165 TCTGCCCAGGCAGCGGGAGCCGCTGCAAGACTGAATTTAGAGGGTGATATATTTAGTTTC 174224 |||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| Old 174163 TCTGCCCAGGGAGCGGGAGCCGCTCGAAGACTGAATTTAGAGGGTGATATATTTAGTTTC 174222 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAL047C | 55746 | 55746 | Substitution | A | G |
55954 | 55954 | Substitution | A | T | ||
Nucleotide changes within the coding region of SPC72/YAL047C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 302 is now Asparagine rather than Isoleucine.
New 55726 TTTCCAAATTGTTTATCAAGACAGATTGCGATTCGATCTTTTCCTTCAGTTGGGAAATCA 55785 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Old 55727 TTTCCAAATTGTTTATCAAAACAGATTGCGATTCGATCTTTTCCTTCAGTTGGGAAATCA 55786 New 55916 AATGGAATTTATAAATTGATCATATTCTTTGTGCAAATTTTCTATGACAATCTCTAATTG 55975 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 55917 AATGGAATTTATAAATTGATCATATTCTTTGTGCAAAATTTCTATGACAATCTCTAATTG 55976 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAL060W | 36120 | 36120 | Substitution | C | A |
A single nucleotide substitution within the coding region of BDH1/YAL060W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 322 is now Aspartic Acid rather than Alanine.
New 36106 TATGTTGTCGAAGACTTCGAAGAAGTTGTTCGTGCCATCCACAACGGAGACATCGCCATG 36165 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 36107 TATGTTGTCGAAGCCTTCGAAGAAGTTGTTCGTGCCATCCACAACGGAGACATCGCCATG 36166 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAL010C | 134852 | 134854 | Substitution | TTG | ATT |
A single nucleotide substitution within the coding region of MDM10/YAL010C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 272 is now Asparagine rather than Glutamine.
New 134813 TGGCCGAATATGTGGAGGATATATGGCCGAATAATGGATTCCAAGATAATGTCAAAGTTA 134872 ||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| Old 134815 TGGCCGAATATGTGGAGGATATATGGCCGAATAATGGTTGCCAAGATAATGTCAAAGTTA 134874 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAL017W | 120442 | 120442 | Substitution | C | G |
A single nucleotide substitution within the coding region of PSK1/YAL017W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 73 is now Glutamic Acid rather than Glutamine.
New 120415 CGAATAAAAAGGAAGGTGATGAGTTCGAGCAAAGTTTAAGAGATACATTTGCGAGCTTTC 120474 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 120416 CGAATAAAAAGGAAGGTGATGAGTTCCAGCAAAGTTTAAGAGATACATTTGCGAGCTTTC 120475 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAL020C | 113702 | 113703 | Substitution | CG | GC |
The substitution of two nucleotides within the coding region of ATS1/YAL020C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 305 is now Glycine rather than Alanine.
New 113685 GCAGTCCAGGCTGGGAGCCCTTTTGCGGGCCGCAGTTGCCATGCTCTCCCCAGCCCCAGC 113744 |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 113896 GCAGTCCAGGCTGGGACGCCTTTTGCGGGCCGCAGTTGCCATGCTCTCCCCAGCCCCAGC 113745 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAL025C | 100399 | 100399 | Substitution | A | C |
A single nucleotide substitution within the coding region of MAK16/YAL025C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 250 is now Glutamic Acid rather than Glutamine.
New 100375 GCTTTCACTGTCGCTTTCGCTTTCACTGGCGCTGGAAGCTTCTCTGTCAGAGTCAGCTAA 100434 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old 100376 GCTTTCACTGTCGCTTTCGCTTTGACTGGCGCTGGAAGCTTCTCTGTCAGAGTCAGCTAA 100435 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAL056W | 40231 | 40231 | Substitution | C | G |
41240 | 41240 | Substitution | A | G | ||
41664 | 41664 | Substitution | T | G | ||
41700 | 41700 | Substitution | C | A | ||
41703 | 41703 | Substitution | C | A | ||
Nucleotide changes within the coding region of GPB2/YAL056W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 661 is now Valine rather than Isoleucine, residue 802 is now Cysteine rather than Phenylalanine, and residues 814-815 are now ED rather than AA.
New 40196 ATTTTTTTGTAGACGGAATAAAGAACTTACCTCCGCCTTTACTACCTCAAGTGATTAATA 40255 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 40197 ATTTTTTTGTAGACGGAATAAAGAACTTACCTCCCCCTTTACTACCTCAAGTGATTAATA 40256 New 41216 ACGATAATTTGGAAAATTATATAGTCAATCCAGGGAGAAAATCGTCATCTATTCCAATGA 41275 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old 41217 ACGATAATTTGGAAAATTATATAATCAATCCAGGGAGAAAATCGTCATCTATTCCAATGA 41276 New 41651 TAAGCACGCAGTGTTGGGAAGAACATAAAATTACTCTGTCCAAGAAGGAAGACGATGAGG 41710 |||||||||||| ||||||||||||||||||||||||||||||||||| || |||||||| Old 41652 TAAGCACGCAGTTTTGGGAAGAACATAAAATTACTCTGTCCAAGAAGGCAGCCGATGAGG 41711 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAL059C-A, YAL059W | 36814 | 36814 | Substitution | A | C |
A single nucleotide substitution within the coding regions of overlapping ORFs ECM1/YAL059W and YAL059C-A resulted in altered protein sequences for both ORFs. The start, stop, and reading frames remain the same for both proteins, but ECM1/YAL059W protein residue 102 is now Alanine rather than Aspartic Acid, and YAL059C-A protein residue 36 is now Alanine rather than Serine.
New 36776 AAGAAGTTAAATAAAAAGGCTCTGGAAGACAAACTGGCCAACTCTATTTCATCCATGGAC 36835 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 36777 AAGAAGTTAAATAAAAAGGCTCTGGAAGACAAACTGGACAACTCTATTTCATCCATGGAC 36836 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | HRA1 | 99841 | 99841 | Substitution | A | T |
A single nucleotide substitution was made within ncRNA HRA1.
New 99825 TTCAACTTAGTGGCATTAAACAGATTTGGGTTTTCTGGCAAAAAAAGCCAATCACGTGAT 99884 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 99826 TTCAACTTAGTGGCAATAAACAGATTTGGGTTTTCTGGCAAAAAAAGCCAATCACGTGAT 99885 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | ARS110, YAR019W-A | 175378 | 175378 | Substitution | T | C |
175371 | 175371 | Deletion | T | |||
A single nucleotide deletion and a single nucleotide substitution were made in the intergenic region between ORF YAR019W-A and ARS110.
New 175355 GCCCAATTTTGATTATGCC-TCTTTTCCATACACGACGCCAGAGGACATTATTACATTAC 175413 ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| Old 175352 GCCCAATTTTGATTATGCCTTCTTTTTCATACACGACGCCAGAGGACATTATTACATTAC 175411 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | ARS106, YAL038W | 70874 | 70874 | Substitution | A | G |
70794 | 70794 | Substitution | C | G | ||
Two separate single nucleotide substitutions were made in the intergenic region between ARS106 and ORF CDC19/YAL038W.
New 70746 GGTTTTCCGACTTTATTTGAGATGACTTGAGATGTGTGTCAATGCTAGTATTTTGGAGAT 70805 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 70747 GGTTTTCCGACTTTATTTGAGATGACTTGAGATGTGTGTCAATGCTACTATTTTGGAGAT 70806 New 70856 TTATTTTTTTTTTGTTAGAATTGATCCAAATGTAAATAAACAATCACAAGGAAAAAAAAA 70915 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 70857 TTATTTTTTTTTTGTTAAAATTGATCCAAATGTAAATAAACAATCACAAGGAAAAAAAAA 70916 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | ARS104, YAL063C | 28953 | 28953 | Insertion | T | |
28069 | 28069 | Deletion | T | |||
A single nucleotide deletion and a single nucleotide insertion were made in the intergenic region between ORF FLO9/YAL063C and ARS104.
New 28027 GTAAATAAGAAGGAAGAACGTTATGTTATTAATGGACTTTT-AGTGTCATCGAATTTTAT 28085 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 28028 GTAAATAAGAAGGAAGAACGTTATGTTATTAATGGACTTTTTAGTGTCATCGAATTTTAT 28087 New 28916 AGTAAACAAGAGATACCTAATTTCACAGCCACTTTTTGTTGCGGACACTGACGGGATGTG 28975 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 28918 AGTAAACAAGAGATACCTAATTTCACAGCCACTTTT-GTTGCGGACACTGACGGGATGTG 28976 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAR023C, tL(CAA)A | 180961 | 180961 | Insertion | CAAA | |
A tetranucleotide insertion was made in the intergenic region between ORF YAR023C and tRNA-Leu SUP56/tL(CAA)A.
New 180942 TTCCCATTACAATGCCGAATAGCAAAATATGTAGTAGAACACGTACACGCATGATAATTA 181001 |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 180940 TTCCCATTACAATGCCGAATAG----ATATGTAGTAGAACACGTACACGCATGATAATTA 180995 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAL041W, YAL042W | 62767 | 62767 | Substitution | A | G |
A single nucleotide substitution was made in the intergenic region between ORFs ERV46/YAL042W and CDC24/YAL041W.
New 62756 TAGGATAGCAGAAGAGTACCATTGCTGTTATCATTTGTTGCCTAGCCCTATCAAGACCTG 62815 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 62757 TAGGATAGCAAAAGAGTACCATTGCTGTTATCATTTGTTGCCTAGCCCTATCAAGACCTG 62816 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAR047C, YAR050W | 203327 | 203327 | Insertion | T | |
202933 | 202933 | Insertion | A | |||
Two separate single nucleotide insertions were made in the intergenic region between ORFs YAR047C and FLO1/YAR050W.
New 202902 GCTCATTAATTGCCCTCACAAGAATTTGGAAGTGCGTAGAACAGGTAAAAGATTGTACTA 202961 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old 202895 GCTCATTAATTGCCCTCACAAGAATTTGGAAGTGCGTAG-ACAGGTAAAAGATTGTACTA 202953 New 203322 TTCACTCTTGCTCGTTTGATGTAAGCTCTCTTCCGGGTTCTTATTTTTAATTCTTGTCAC 203381 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 203314 TTCACTCTTGCTCG-TTGATGTAAGCTCTCTTCCGGGTTCTTATTTTTAATTCTTGTCAC 203372 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAR042W, YAR047C | 198900 | 198900 | Insertion | A | |
A single nucleotide insertion was made in the intergenic region between ORFs SWH1/YAR042W and YAR047C.
New 198882 TAAGCCCCTTTTATGGATGCATGAGAAAAAAAAAAAGGTTTGCTACAACCATCTCAGGTC 198941 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 198876 TAAGCCCCTTTTATGGATGCATGAG-AAAAAAAAAAGGTTTGCTACAACCATCTCAGGTC 198934 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAR020C, YAR023C | 178647 | 178647 | Substitution | T | C |
178638 | 178638 | Deletion | G | |||
178618 | 178618 | Insertion | A | |||
178601 | 178601 | Deletion | A | |||
178256 | 178256 | Substitution | G | C | ||
177135 | 177135 | Insertion | T | |||
Several nucleotide sequence changes were made in the intergenic region between ORFs PAU7/YAR020C and YAR023C.
New 177104 CAAAGCTGATCAAGCCGCTGTATTTATATGAAACTTTGAACAACTACATCTGCACACATG 177163 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 177102 CAAAGCTGATCAAGCCGCTGTATTTATATGAAAC-TTGAACAACTACATCTGCACACATG 177160 New 178244 ACAATTTAACCATGGCAGGTTAAAATATTACTGCGATCAGTAAAAATGGGGATATCACCT 178303 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 178241 ACAATTTAACCATGGGAGGTTAAAATATTACTGCGATCAGTAAAAATGGGGATATCACCT 178300 New 178599 ATTGT-AGATTGTATCGTTCGAGAAACGTCAGGCATGATAGAT-GTTGCAATCACAGGAC 178656 ||||| ||||||||||||||||| ||||||||||||||||||| |||||||| ||||||| Old 178596 ATTGTAAGATTGTATCGTTCGAG-AACGTCAGGCATGATAGATGGTTGCAATTACAGGAC 178654 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAR018C, YAR019C | 172170 | 172170 | Insertion | T | |
172042 | 172042 | Insertion | T | |||
172041 | 172041 | Insertion | T | |||
172020 | 172020 | Deletion | A | |||
172018 | 172018 | Deletion | A | |||
171983 | 171983 | Deletion | G | |||
171975 | 171977 | Deletion | CTA | |||
171972 | 171972 | Substitution | C | T | ||
171968 | 171968 | Deletion | C | |||
171882 | 171882 | Insertion | C | |||
Several nucleotide sequence changes were made in the intergenic region between ORFs KIN3/YAR018C and CDC15/YAR019C.
New 171843 GTAATGAAAAAATTCAGAAACCTTAAAAAAAAAACTTGGCTGTAACCTATCGGAAGACTG 171902 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 171838 GTAATGAAAAAATTCAGAAACCTTAAAAAAAAAACTTGGCTGTAA-CTATCGGAAGACTG 171896 New 171953 CTAGAAACATTTAACAAAATG-CACTTT---GAGTC-GTTCATACATTTAATCCCCAATT 172007 ||||||||||||||||||||| ||| || ||||| ||||||||||||||||||||||| Old 171947 CTAGAAACATTTAACAAAATGCCACCTTCTAGAGTCGGTTCATACATTTAATCCCCAATT 172006 New 172008 GAAAAAAAAAA-G-AAAAGAAAAAAAGCATATATATGTATATGCTTTTTTATCATTACTG 172065 ||||||||||| | ||||||||||||||||||||| | |||||||||||||||||||||| Old 172007 GAAAAAAAAAAAGAAAAAGAAAAAAAGCATATATA-G-ATATGCTTTTTTATCATTACTG 172064 New 172126 GGAAGGTTCACAATTCTATATATAGTGTTAATGTAATGCTGTATTATTTCTCTATATATG 172185 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 172125 GGAAGGTTCACAATTCTATATATAGTGTTAATGTAATGCTGTATTA-TTCTCTATATATG 172183 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAR007C, YAR008W | 158934 | 158934 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs RFA1/YAR007C and SEN34/YAR008W.
New 158923 TAACATATATGCAAAAAGAACGGCAAAAGGCGAGGAGGTTTTTATGCCACCGCTAGTATT 158982 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 158925 TAACATATAT-CAAAAAGAACGGCAAAAGGCGAGGAGGTTTTTATGCCACCGCTAGTATT 158983 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | CEN1, YAR002W | 152189 | 152190 | Substitution | CA | AC |
A dinucleotide substitution was made in the intergenic region between CEN1 and ORF NUP60/YAR002W
New 152153 ATATATTTACAAGTGAAAGCTTATTGTAATGTGTACTTTTAAACATCAAATAACAGACCT 152212 |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old 152155 ATATATTTACAAGTGAAAGCTTATTGTAATGTGTCATTTTAAACATCAAATAACAGACCT 152214 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAL067C, YAL067W-A | 6454 | 6454 | Deletion | C | |
5927 | 5927 | Insertion | G | |||
5244 | 5244 | Substitution | G | A | ||
3981 | 3982 | Substitution | AT | TA | ||
3836 | 3836 | Deletion | C | |||
Several nucleotide sequence changes were made in the intergenic region between ORFs YAL067W-A and SEO1/YAL067C.
New 3791 CTTGGTAGTAACCATAATATTACCCAGGTACGAAACGCTAAGAAC-TTGAAAGACTCATA 3849 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 3791 CTTGGTAGTAACCATAATATTACCCAGGTACGAAACGCTAAGAACCTTGAAAGACTCATA 3850 New 3960 TTTCCATTTTGATAATGAGCTAGTGATCCGGAAAGCTACTTTATGATGTTTCAAGGCCTG 4019 |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 3961 TTTCCATTTTGATAATGAGCATGTGATCCGGAAAGCTACTTTATGATGTTTCAAGGCCTG 4020 New 5220 TAAATAGTTTTCAACTGCTGGTGATAAATCAATAATTTATGTTCTTAACCTAACATTTGA 5279 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old 5221 TAAATAGTTTTCAACTGCTGGTGGTAAATCAATAATTTATGTTCTTAACCTAACATTTGA 5280 New 5880 AACTGCATTCGGACTATGAAAGAAAAAATGGTAGTAGCAAAGGATAGGCATCGCCGTATT 5939 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 5881 AACTGCATTCGGACTATGAAAGAAAAAATGGTAGTAGCAAAGGATAG-CATCGCCGTATT 5939 New 6420 AAGTTTCTTAAATAACCCGGATTGGTTAGGTTCA-GCCATGCCTGGCGCGTACATTGAGG 6478 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 6420 AAGTTTCTTAAATAACCCGGATTGGTTAGGTTCACGCCATGCCTGGCGCGTACATTGAGG 6479 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAL064C-A, YAL064W | 16500 | 16500 | Deletion | G | |
16470 | 16470 | Deletion | T | |||
16457 | 16457 | Substitution | G | A | ||
A single nucleotide substitution and two separate single nucleotide deletions were made in the intergenic region between ORFs YAL064C-A and YAL064W.
New 16449 TCTGTGGAAAATAAGAAATT-CAGCACCAGTAAAAGACGAGAAATATAGG-CACATAAAT 16506 ||||||| |||||||||||| ||||||||||||||||||||||||||||| ||||||||| Old 16450 TCTGTGGGAAATAAGAAATTTCAGCACCAGTAAAAGACGAGAAATATAGGGCACATAAAT 16509 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAL063C, YAL063C-A | 23253 | 23253 | Insertion | T | |
A single nucleotide insertion was made in the intergenic region between ORFs YAL063C-A and FLO9/YAL063C.
New 23217 TTTGCTCATCATTGGATAATTTCTTTTTTTTTTTTTGATGCATCCAAACTTGGACCCCTT 23276 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old 23219 TTTGCTCATCATTGGATAATTTCTTTTTTTTTTTT-GATGCATCCAAACTTGGACCCCTT 23277 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAL021C, YAL022C | 110470 | 110471 | Substitution | CG | GC |
A dinucleotide substitution was made in the intergenic region between ORFs FUN26/YAL022C and CCR4/YAL021C.
New 110455 GCGTTTGATGATAAGCTGTCGCCGTAACGTAAATCATTCATCCTTTCCTATGATTTTTTA 110514 |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 110456 GCGTTTGATGATAACGTGTCGCCGTAACGTAAATCATTCATCCTTTCCTATGATTTTTTA 110515 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | YAL010C, YAL011W | 134125 | 134125 | Insertion | C | |
A single nucleotide substitution was made in the intergenic region between ORFs SWC3/YAL011W and MDM10/YAL010C.
New 134093 ATTCTGCTTTAACGCCATTATGATTATACACATTGTATTACTTATTTTTTAACCTGTATA 134152 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Old 134096 ATTCTGCTTTAACGCCATTATGATTATACA-ATTGTATTACTTATTTTTTAACCTGTATA 134154 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2011-02-03 | TEL01R TEL01R-XC | 229568 | 229568 | Insertion | G | |
A single nucleotide insertion was made within the right telomere of Chromosome 1, TEL01R specifically within the X element Core sequence TEL01R-XC.
New 229542 ATTACGCATGGAGTTAAGAGTATTTACATGATAATTGGGGTTCCGTGATTCATTATAGAT 229601 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 229533 ATTACGCATGGAGTTAAGAGTATTTACATGATAATT-GGGTTCCGTGATTCATTATAGAT 229591 Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98 | ||||||
2008-03-05 | YAL044C | 58424 | 58424 | Substitution | C | T |
58247 | 58247 | Substitution | A | C | ||
58196 | 58196 | Substitution | A | C | ||
Three single base substitutions were made within ORF YAL044C/GCV3 to correct errors in the systematic reference sequence for Chromosome I: Two separate A -> C transversions at 58196 and 58247, and a C -> T transition at 58424. These errors were verified by sequencing in 3 different strains, all of ResGen BY4741 (S288C) background. SGD thanks Michael E. Rice for bringing these errors to our attention, and for verifying the correct sequence.
New: 58191 TTGGGCAATCTCAGTGCCCACTTCTGGCAACTCAACATAGGTAGCGTCCCCTAAGGCATC 58250 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| Old: 58191 TTGGGAAATCTCAGTGCCCACTTCTGGCAACTCAACATAGGTAGCGTCCCCTAAGGAATC 58250 New: 58251 AGTGGCGTATTTTGTAATTCCGACAAAGGCAGTCTTGTCCTGATGCACAGCTATCCACTC 58310 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old: 58251 AGTGGCGTATTTTGTAATTCCGACAAAGGCAGTCTTGTCCTGATGCACAGCTATCCACTC 58310 New: 58311 ATGTTGGGAAGTGTACCTCACGGCTTGAGGTCCTTGGGATGAGTACAAAAATGGTAGTTT 58370 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old: 58311 ATGTTGGGAAGTGTACCTCACGGCTTGAGGTCCTTGGGATGAGTACAAAAATGGTAGTTT 58370 New: 58371 ATTCTTGTTTAGGGCATTGCCGGAGCTGTTTCTCAAAAACAATTTGCTCACAGTGGGCAT 58430 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Old: 58371 ATTCTTGTTTAGGGCATTGCCGGAGCTGTTTCTCAAAAACAATTTGCTCACAGCGGGCAT 58430 | ||||||
2007-04-05 | YAL004W, YAL005C | 140169 | 140169 | Substitution | A | G |
140182 | 140182 | Substitution | A | G | ||
140811 | 140811 | Substitution | A | G | ||
Three single nucleotide substitutions were made within the coding sequence of SSA1 (at nucleotide positions 623, 1252, and 1265 relative to the SSA1 coding sequence), based on the sequence reported by Slater and Craig (1989) and corresponding to GenBank entry X12926. These changes result in phenylalanine to serine changes at amino acid residues 208 and 422 and a change from serine to proline at amino acid residue 418. Thanks to Andreas Bracher for bringing these corrections to our attention.
Note that the change at position 623 of SSA1 also affects the coding sequence of the Dubious ORF YAL004W. 638 ATACCGTCTTCAATGGACAACAAAGAGAC 610 new sequence, coordinates relative to SSA1 coding region ||||||||||||||| ||||||||||||| 140796 ATACCGTCTTCAATGAACAACAAAGAGAC 140824 old sequence, chromosomal coordinates 1279 TGGAAAAGATCTCGGACTTCTTTGTTGGAATGGTAGAGTTT 1239 new sequence, coordinates relative to SSA1 coding region |||||||||||||| |||||||||||| ||||||||||||| 140155 TGGAAAAGATCTCGAACTTCTTTGTTGAAATGGTAGAGTTT 140195 old sequence, chromosomal coordinates Slater MR and Craig EA (1989) The SSA1 and SSA2 genes of the yeast Saccharomyces cerevisiae. Nucleic Acids Res 17(2):805-6 | ||||||
2006-01-19 | YAR042W | 193355 | 193355 | Substitution | G | A |
When confirming the G nucleotide insertion that resulted in the merger of SWH1/YAR042W and OSH1/YAR044W (see 2003-09-27), SGD detected an additional sequencing error. The substitution of an A nt for a G nt changes amino acid 248 from a serine to an asparagine.
Substitute an A nt for the G nt at 193355 New: 193341 CGACACCGCCACCAACACCAAGATCGCCATC 193371 |||||||||||||| |||||||||||||||| Old: 193341 CGACACCGCCACCAGCACCAAGATCGCCATC 193371 | ||||||
2004-07-20 | YAL051W | 51694 | 51694 | Deletion | G | |
51688 | 51688 | Deletion | G | |||
The work of Kellis et al. 2003 predicted the deletion of 2 separate G nucleotides in YAL051W at chromosomal coordinates 51688 and 51694, and these sequence errors were confirmed in S288C by SGD. As a consequence of these changes, YAL051W was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 1062 to 1047 amino acids.
New: 51666 TTTATTTGATTATGACTTTTTG-TTTGG-CAATGACTTTGCTTAAAAATTTTCTTTCCAA 51723 |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| Old: 51666 TTTATTTGATTATGACTTTTTGGTTTGGGCAATGACTTTGCTTAAAAATTTTCTTTCCAA 51725 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-01-30 | YAR014C | 166772 | 166772 | Deletion | G | |
Kellis et al. 2003 predicted and confirmed the deletion of a single G nucleotide at chromosomal coordinate 166772. As a consequence of this sequence change, YAR014C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 702 to 707 amino acids.
New: 166731 TTGTAAGGACAATATCATTTACGAATAATTTCATCCAATTG-TTTCATCAACACA 166784 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old: 166731 TTGTAAGGACAATATCATTTACGAATAATTTCATCCAATTGGTTTCATCAACACA 166785 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-01-24 | YAL056W | 41778 | 41778 | Insertion | G | |
Kellis et al. 2003 predicted and confirmed the insertion of a single G nucleotide after the T at chromosomal coordinate 41778. As a consequence of this sequence change, YAL056W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein increasing from 847 to 880 amino acids.
New: 41724 GCGAAAATGAAGATACAAATTCAAATATAGTAGTTGGTGTCGGTGGCACTTCTTTGCAAT 41783 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Old: 41724 GCGAAAATGAAGATACAAATTCAAATATAGTAGTTGGTGTCGGTGGCACTTCTTT-CAAT 41782 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-01-22 | YAL002W | 143848 | 143848 | Insertion | C | |
Kellis et al. 2003 and Cliften et al. 2003 predicted and confirmed the insertion of a single C nucleotide after the C at chromosomal coordinate 143848. As a consequence of this sequence change, YAL002W was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 1176 to 1274 amino acids.
New: 143826 ATCTAGTTCTTCATATACGGCACCTCCCCTGAACGAAGATGGTCCTAAAGGGGTAGCTTC 143885 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old: 143826 ATCTAGTTCTTCATATACGGCAC-TCCCCTGAACGAAGATGGTCCTAAAGGGGTAGCTTC 143884 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2003-12-17 | YAL013W | 130239 | 130239 | Insertion | C | |
130246 | 130247 | Substitution | CG | GC | ||
Kellis et al. 2003 and Brachat et al. 2003 predicted and confirmed the insertion of a single C nucleotide after the C at position 130239 on Chromosome I. As a consequence of this sequence change, YAL013W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 362 to 420 amino acids. They also found an additional seqeuncing error: the CG at 130246-130247 should be GC.
Old: 130201 ACTTGATAACAAGACGCTGAGCTGTATCACGGGCTACGC-AGCGCACGACAGCTGTGCTA 130259 ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| New: 130201 ACTTGATAACAAGACGCTGAGCTGTATCACGGGCTACGCCAGCGCAGCACAGCTGTGCTA 130260 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2003-09-27 | YAR042W, YAR044W | 193300 | 193300 | Insertion | G | |
Insertion of a single G after the G at 193300 merged SWH1/YAR042W and OSH1/YAR044W. After merging YAR042W (coordinates 192613-193383 (1-771)) and YAR044W (coordinates 193599-196178 (1-2580)), the coordinates of the merged ORF, SWH1/YAR042W, are 192613-196179 (1-3567). OSH1 and YAR044W are now aliases of SWH1/YAR042W. This sequence change was predicted by several studies, then verified in S288c by SGD.
Old: 193261 CTTGAACACGGTGCTGACCCCTTCAAGAGAGACCGCAAGG-CAAACTGCCCATCGAGCTC 193319 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| New: 193261 CTTGAACACGGTGCTGACCCCTTCAAGAGAGACCGCAAGGGCAAACTGCCCATCGAGCTC 193320 Schmalix WA and Bandlow W (1994) SWH1 from yeast encodes a candidate nuclear factor containing ankyrin repeats and showing homology to mammalian oxysterol-binding protein. Biochim Biophys Acta 1219(1):205-10
Beh CT, et al. (2001) Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics 157(3):1117-40 | ||||||
2002-12-17 | YAL023C | 108137 | 108137 | Insertion | CC | |
108143 | 108143 | Insertion | G | |||
Due to the insertion of CC after the C at 108137, and the insertion of a G after the G at 108143 in the systematic sequence of Chromosome I, the coordinates of PMT2/YAL023C have been changed. Thanks to Verena Girrbach (verena.girrbach@biologie.uni-regensburg.de) for reporting this sequence error in the systematic sequence of PMT2/FUN25/YAL023C to SGD.
Old: 108121 AGTCTGGGTAAATTTCC--AGAAGG-AAGTCCCAAGAACCGTTGTAGCCTGCCAAATAAC 108177 ||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| New: 108121 AGTCTGGGTAAATTTCCCCAGAAGGGAAGTCCCAAGAACCGTTGTAGCCTGCCAAATAAC 108180 | ||||||
2002-12-17 | YAL014C | 128441 | 128441 | Insertion | T | |
Due to the insertion of a single T nucleotide after the T at coordinate 128441 in the systematic sequence of Chromosome I, the ORF SUN8/YAL014C was extended 450 nucleotides in the 3' direction, making the protein product 150 amino acids longer at the C-terminus. Thanks to Lena Burri, Trevor Lithgow, and Hugh Pelham for reporting this sequence error in the systematic sequence of SYN8/UIP2/YAL014C to SGD.
Old: 128398 TTCTAAATCAACCAGCAGCGAGTCGTTCTGAGAAACGATCTCAT-ATTAAGGTCCAGCGA 128456 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| New: 128401 TTCTAAATCAACCAGCAGCGAGTCGTTCTGAGAAACGATCTCATTATTAAGGTCCAGCGA 128460 Lewis MJ and Pelham HR (2002) A new yeast endosomal SNARE related to mammalian syntaxin 8. Traffic 3(12):922-9 | ||||||
1998-09-02 | YAL062W, YAL063C | 29254 | 29254 | Deletion | A | |
29289 | 29289 | Deletion | A | |||
29290 | 29290 | Deletion | A | |||
29291 | 29291 | Deletion | T | |||
29307 | 29307 | Deletion | A | |||
29301 | 29301 | Substitution | T | A | ||
The following changes were made to the systematic sequence of Chromosome I in the region encompassing features FLO9/YAL063C and GDH3/YAL062W: deletion of the A at 29254, deletion of AAT at 29289-29291, transversion of T to A at 29301, and deletion of the A at 29307.
Old: 29221 TGAAATCATACCTGCCAAGCTTGCTGCACTTGGAAAGGCAACTCCGTTTTTCAGAGATTA 29280 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| New: 29221 TGAAATCATACCTGCCAAGCTTGCTGCACTTGGAA-GGCAACTCCGTTTTTCAGAGATTA 29279 Old: 29281 GATCCTTTAATTTTTTTTGATGAAAAAGGCAGCCAAGTTACGTCATAGAGAAAACTCCCT 29340 |||||||| ||||||||| ||||| ||||||||||||||||||||||||||||||||| New: 29280 GATCCTTT---TTTTTTTGAAGAAAA-GGCAGCCAAGTTACGTCATAGAGAAAACTCCCT 29335 | ||||||
1998-09-02 | YAR060C, YARCdelta8 | 210810 | 210810 | Substitution | T | A |
211011 | 211011 | Substitution | C | T | ||
210804 | 210804 | Deletion | T | |||
The following changes were made to the systematic sequence of Chromosome I in the region encompassing features YARCdelta8 and YAR060C: deletion of the T at 210804, transversion of T to A at 210810, and transition of C to T at 211011.
Old: 210781 TTTCTCTTTGCTTGCATCTTTTTTCTTCCTTGCCAAAAAATAAAAGATACTCATTTTAAA 210840 ||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| New: 210776 TTTCTCTTTGCTTGCATCTTTTT-CTTCCATGCCAAAAAATAAAAGATACTCATTTTAAA 210834 Old: 210961 GCCCTTCTACGGCTTCTTCTAACCAATTGTTCCCCGTGAGTTGCTTTCTCCGAAAACCTT 211020 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| New: 210955 GCCCTTCTACGGCTTCTTCTAACCAATTGTTCCCCGTGAGTTGCTTTCTCTGAAAACCTT 211014 | ||||||
1998-09-02 | YAR050W | 203939 | 203939 | Substitution | T | G |
The following sequence change was made to the systematic sequence of Chromosome I within the ORF YAR050W/FLO1: transversion of T to G at 203939.
Old: 203881 CAATTCTATCAGTAGGTGGTGCAACCGCGTTCAACTGTTGTGCTCAACAGCAACCGCCTA 203940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | New: 203876 CAATTCTATCAGTAGGTGGTGCAACCGCGTTCAACTGTTGTGCTCAACAGCAACCGCCGA 203935 |
Annotation Changes
Date | Affected Features |
---|---|
2014-11-18 | ARS104, ARS106, ARS107, ARS110, ARS111 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome I based on Liachko et al. 2013: ARS104, ARS106, ARS107, ARS110, ARS111. |
2014-11-18 | ARS102, ARS105, ARS106, ARS108 The chromosomal coordinates of the following ARS elements on Chromosome I were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS102, ARS105, ARS106, ARS108. |
2014-11-18 | YAR061W, YAR062W As part of SGD's genome annotation revision R64.2, the two pseudogenes YAR061W + YAR062W have been combined into a single pseudogene, keeping the name YAR061W. This region is homologous to parts of FLO1/YAR050W and FLO9/YAL063C, but contains stop codons at several positions. |
2007-05-08 | snR18 Updated coordinates of snR18 based on GenBank U12981. |
2007-05-08 | HRA1 Updated coordinates of HRA1 based on Yang & Altman 2007. |
2007-03-07 | ARS102, ARS103, ARS105, ARS108, ARS111, ARS112 The following ARS elements were added to the genome annotation on Chromosome I based on Xu et al. 2006: ARS102, ARS103, ARS105, ARS108, ARS111, ARS112. |
2007-03-07 | ARS109 The ACS within ARS101/ARS109 at coordinates 159946-159936 was added based on Xu et al. 2006 and Theis & Newlon 2001. |
2007-02-06 | HRA1 This RNA gene, HRA1, was described by Samanta et al. (2006). Approximate start and stop coordinates, which are accurate to within 25 nucleotides, have been specified for this non-coding RNA. Many thanks to Manoj Samanta for alerting us to this noncoding RNA. |
2006-10-02 | ARS109 An ARS Consensus Sequence (ACS) was added to ARS109 based on Nieduszynski et al. 2006. |
2006-09-06 | ARS104, ARS106, ARS107 The following ARS elements on Chromosome I were added to SGD based on Nieduszynski et al. 2006: ARS104, ARS106, ARS107. |
2006-09-06 | ARS109, ARS110 Updated coordinates of the following ARS elements on Chromosome I based on Nieduszynski et al. 2006: ARS101/109, ARS110. |
2006-05-08 | CEN1 The previously annotated boundaries of CEN1 were adjusted to coincide with the 5' end of CDEI and the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae. |
2006-02-28 | ARS110 This ARS element ARS110 was added to the genome annotation based on Wyrick et al. 2001 and Dimock et al. 1984. |
2004-10-18 | ARS109 ARS101 was added to SGD based on Theis and Newlon 2001 and Wyrick et al. 2001. |
2004-10-12 | CEN1 Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003. |
2003-09-22 | YAL044C The start site of GCV3/YAL044C was moved 21 nt (7 codons) downstream, based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been updated. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-22 | YAL034C The start site of FUN19/YAL034C was moved 150 nt (50 codons) downstream, based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been updated. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-22 | YAL011W The start site of YAL011W was moved 39 nt (13 codons) downstream, based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been updated. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. |
2003-09-09 | TEL01L, TEL01R The chromosomal locations for the following telomeric features on Chromosome I were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL01L, TEL01L-TR, TEL01L-XC, TEL01L-XR, TEL01R, TEL01R-TR, and TEL01R-XC. |
2003-07-29 | YAL016C-B Thanks to Kessler et al. 2003 for providing the coordinates of ORF YAL016C-B on Chromosome I. |
2003-07-29 | YAL037C-B, YAL067W-A, YAL068W-A, YAR035C-A Thanks to Kumar et al. 2002 for providing the coordinates of the following ORFs on Chromosome I: YAL037C-B, YAL067W-A, YAL068W-A, YAR035C-A. |
2003-07-29 | YAL016C-A, YAL019W-A, YAL026C-A, YAL031W-A, YAL037C-A, YAL047W-A, YAL059C-A, YAR019W-A Thanks to MIPS for providing the coordinates of the following ORFs on Chromosome I: YAL016C-A, YAL019W-A, YAL026C-A, YAL031W-A, YAL037C-A, YAL047W-A, YAL059C-A, and YAR019W-A. |
2003-07-29 | YAL063C-A Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of ORF YAL063C-A on Chromosome I. |
2001-01-30 | YAL044W-A ORF added based on similarity to an S. pombe gene (information submitted by Valerie Wood). |
1999-07-17 | YAR043C, YAR052C, YAR074C Deleted ORF, does not encode a protein; this putative ORF was included in the original annotation of Chromosome I but was later withdrawn |