Difference between revisions of "Chromosome XII History"
(→Sequence Changes) |
(→Sequence Changes) |
||
Line 223: | Line 223: | ||
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YLR024C YLR024C] | ||
+ | | 192416 | ||
+ | | 192416 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | T | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide substitution was made within ORF UBR2/YLR024C. Note that the protein sequence was not changed. | ||
+ | <pre>New 192359 TCTTCTAAAGCCTTCGTTATTGAGATTGCATATTCAACCGGTGTATTCAAAATTCTTGTTATTGTAGATG 192428 | ||
+ | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||
+ | Old 192360 TCTTCTAAAGCCTTCGTTATTGAGATTGCATATTCAACCGGTGTATTCAAAATTCTCGTTATTGTAGATG 192429</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YLR034C YLR034C] | ||
+ | | 210771 | ||
+ | | 210771 | ||
+ | | Substitution | ||
+ | | A | ||
+ | | T | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide substitution was made within ORF SMF3/YLR034C. Note that the protein sequence was not changed. | ||
+ | <pre>New 210719 ATGAACAACCATCAACTTTCTATTTGCGGTAAAATAAATTAAAGGAGCGGATACGATTGGTAAAATTAAG 210788 | ||
+ | ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||
+ | Old 210720 ATGAACAACCATCAACTTTCTATTTGCGGTAAAATAAATTAAAGGAGCGGAAACGATTGGTAAAATTAAG 210789</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YLR162W-A YLR162W-A], [https://www.yeastgenome.org/locus/YLR163C YLR163C] | ||
+ | | 491154 | ||
+ | | 491154 | ||
+ | | Deletion | ||
+ | | C | ||
+ | | | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs RRT15/YLR162W-A and MAS1/YLR163C. | ||
+ | <pre>New 491099 TGAAGAGGTAGGTACATATTCATTGGCAGATATTCTACAATGCAATTATTATGA-CCAATCACACAGTAT 491167 | ||
+ | |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||
+ | Old 491100 TGAAGAGGTAGGTACATATTCATTGGCAGATATTCTACAATGCAATTATTATGACCCAATCACACAGTAT 491169</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YLR378C YLR378C], [https://www.yeastgenome.org/locus/YLR380W YLR380W] | ||
+ | | 878171 | ||
+ | | 878171 | ||
+ | | Deletion | ||
+ | | G | ||
+ | | | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs SEC61/YLR378C and CSR1/YLR380W. | ||
+ | <pre>New 878158 AAATCTTGGCACTT-GTCACTTACGCTCCTTTAAACAAAATCAAACATACAAATATACGG 878216 | ||
+ | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | ||
+ | Old 878157 AAATCTTGGCACTTGGTCACTTACGCTCCTTTAAACAAAATCAAACATACAAATATACGG 878216</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YLR277C YLR277C], [https://www.yeastgenome.org/locus/YLR278C YLR278C] | ||
+ | | 699963 | ||
+ | | 699963 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | A | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide substitution was made in the intergenic region between ORFs YSH1/YLR277C and YLR278C. | ||
+ | <pre>New 699948 AAAAAAAAAAAAAAGGAATGAGTTTGTACATACTATTATATTAATGTAGTATCACGTTAAAAAGCCGTAG 700017 | ||
+ | ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||
+ | Old 699950 AAAAAAAAAAAAAGGGAATGAGTTTGTACATACTATTATATTAATGTAGTATCACGTTAAAAAGCCGTAG 700019</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YLR309C YLR309C] | ||
+ | | 750224 | ||
+ | | 750224 | ||
+ | | Substitution | ||
+ | | C | ||
+ | | T | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide substitution was made within ORF IMH1/YLR309C. Note that the protein sequence was not changed. | ||
+ | <pre>New 750178 TCACTAAATTGTTTAACTTGTTCCTCCAAGTAACTCACAGTTTTTTCCTTTTGTTTATAA 750237 | ||
+ | |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||
+ | Old 750180 TCACTAAATTGTTTAACTTGTTCCTCCAAGTAACTCACAGTTTTCTCCTTTTGTTTATAA 750239</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2006-01-09 | ||
+ | | [https://www.yeastgenome.org/locus/YLR401C YLR401C] | ||
+ | | 922648 | ||
+ | | 922648 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
+ | |- | ||
+ | | || colspan="6" | Based on the automated comparison of related fungi, Kellis et al. and Brachat et al. suggest that the stop site for YLR401C be moved 176 nt downstream. SGD confirmed the insertion of a single G nt. and have updated the systematic sequence accordingly. As a consequence of this sequence change, DUS3/YLR401C was extended on the 3' end, altering the C-terminus and increasing the size of the predicted protein from 609 to 668 amino acids. | ||
+ | <pre>New: 922634 ACAAATACCCATGGGGACATACCTATGAAAAA 922665 | ||
+ | ||||||||||||||| |||||||||||||||| | ||
+ | Old: 922634 ACAAATACCCATGGG-ACATACCTATGAAAAA 922664</pre> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br> | ||
+ | '''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | rowspan="2"| 2004-02-05 | ||
+ | | rowspan="2"| [https://www.yeastgenome.org/locus/YLR205C YLR205C] | ||
+ | | 553633 | ||
+ | | 553633 | ||
+ | | Insertion | ||
+ | | | ||
+ | | C | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 553548 | ||
+ | | 553548 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
+ | |- | ||
+ | | || colspan="6" | Brachat et al. 2003 predicted and confirmed the insertion of two nucleotides in Chromosome XII - a G after the G at 553548, and a C after the C at 553633. As a consequence of these sequence changes, HMX1/YLR205C was extended at the 5' end, increasing the size of the protein from 273 amino acids to 317 amino acids. | ||
+ | <pre> New: ACATAATAGTACGCCAGAATACCCTGTCTGTATATAAAGCCATGTCTCATGGCGATGGCC | ||
+ | ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||
+ | Old: 553498 ACATAATAGTACGCCAGAATACCCTGTCTGTATATAAAGCCATGTCTCATG-CGATGGCC 553556 | ||
+ | |||
+ | New: CTGTTTGCTAGCGCCCCCACGTCAGTGGGTGAGGGTATGATTGTATTGCTACTGTCCTCC | ||
+ | ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | ||
+ | Old: 553617 CTGTTTGCTAGCGCCCC-ACGTCAGTGGGTGAGGGTATGATTGTATTGCTACTGTCCTCC 553675</pre> | ||
+ | '''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2004-02-04 | ||
+ | | [https://www.yeastgenome.org/locus/YLR389C YLR389C] | ||
+ | | 899751 | ||
+ | | 899751 | ||
+ | | Insertion | ||
+ | | | ||
+ | | T | ||
+ | |- | ||
+ | | || colspan="6" | Brachat et al. 2003 predicted and confirmed the insertion of a single T nucleotide in YLR389C. As a consequence of this sequence change, YLR389C was extended at the 3' end, increasing the size of the predicted protein from 988 amino acids to 1027 amino acids. | ||
+ | <pre>Query: GCTCTTTGTTTTCCACTTGAGATTTCAAATGTAGAATCAACTTCGATGCGTTCTCGCTCA | ||
+ | ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | ||
+ | Sbjct: 899741 GCTCTTTGTTT-CCACTTGAGATTTCAAATGTAGAATCAACTTCGATGCGTTCTCGCTCA 899799</pre> | ||
+ | '''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2004-02-04 | ||
+ | | [https://www.yeastgenome.org/locus/YLR312C-B YLR312C-B], [https://www.yeastgenome.org/locus/YLR313C YLR313C] | ||
+ | | 760763 | ||
+ | | 760764 | ||
+ | | Deletion | ||
+ | | CC | ||
+ | | | ||
+ | |- | ||
+ | | || colspan="6" | Roemer et al confirmed the deletion of two C nucleotides in SPH1/YLR313C in an S288C strain background. As a consequence of this sequence change, SPH1/YLR313C was extended at the 3' and merged with an adjacent ORF, YLR312C-B, that was in the same frame. This change increased the size of the Sph1p from 530 amino acids to 661 amino acids. Roemer et al also confirmed other laboratory strain backgrounds, such as W303-derived strains, do have the additional two nucleotides and encode the shorter protein. | ||
+ | <pre>New: CTTGAACAATTTTGATTTAGAGGCTTGAACATCATTCAAAATGCCCTG--TGCCATAGGA | ||
+ | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||
+ | Sbjct: 760715 CTTGAACAATTTTGATTTAGAGGCTTGAACATCATTCAAAATGCCCTGCCTGCCATAGGA 760774</pre> | ||
+ | '''Roemer T, et al.''' (1998) The Spa2-related protein, Sph1p, is important for polarized growth in yeast. J Cell Sci 111 ( Pt 4)():479-94. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000045317 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9443897 PubMed] | [https://jcs.biologists.org/content/111/4/479.long Full-Text] <br> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2001-06-12 | ||
+ | | [https://www.yeastgenome.org/locus/YLR312W-A YLR312W-A] | ||
+ | | 759511 | ||
+ | | 759511 | ||
+ | | Insertion | ||
+ | | | ||
+ | | C | ||
+ | |- | ||
+ | | || colspan="6" | Inserted one C nucleotide after the C at chromosomal coordinate 759511. This insertion is in the intron of YLR312W-A and therefore does not affect YLR312W-A translation. | ||
+ | <pre>Old: 759481 TGGAAAATAGCATGATGTTTATATCGCGTTC-TTGCGGAGACCCGTTACTGCTTTGAACT 759539 | ||
+ | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | ||
+ | New: 759481 TGGAAAATAGCATGATGTTTATATCGCGTTCCTTGCGGAGACCCGTTACTGCTTTGAACT 759540</pre> | ||
+ | '''Kitakawa M, et al.''' (1997) Identification and characterization of the genes for mitochondrial ribosomal proteins of Saccharomyces cerevisiae. Eur J Biochem 245(2):449-56. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000058441 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9151978 PubMed] | [https://febs.onlinelibrary.wiley.com/doi/full/10.1111/j.1432-1033.1997.t01-2-00449.x?sid=nlm%3Apubmed Full-Text] <br> | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 1997-07-30 | ||
+ | | [https://www.yeastgenome.org/locus/YLR028C YLR028C] | ||
+ | | 199680 | ||
+ | | 199680 | ||
+ | | Insertion | ||
+ | | | ||
+ | | T | ||
+ | |- | ||
+ | | || colspan="6" | A single T nucleotide was inserted before the T at chromosomal coordinate 199680 within the ORF ADE16/YLR028C. At the same time this sequence change was made, the stop site for YLR028C was moved downstream 110 nucleotides. | ||
+ | <pre>New: 199649 CTTTACACCAGACTGCACAGCTCTATAAACGTTGTCTGGGAAGGGAAAGAACGCATCGGA 199708 | ||
+ | |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | ||
+ | Old: 199649 CTTTACACCAGACTGCACAGCTCTATAAACGT-GTCTGGGAAGGGAAAGAACGCATCGGA 199707 | ||
+ | ''Note that this ORF is on the Crick strand, which is complementary to the sequence shown above.''</pre> | ||
+ | |||
+ | |} | ||
+ | |||
+ | <br><br> | ||
+ | |||
+ | =Annotation Changes ''without sequence changes''= | ||
+ | {| border="1" style="border-collapse:collapse; width:90%" cellpadding="6" | ||
+ | ! Date !! Affected Features |
Revision as of 16:22, 1 October 2019
This page lists all sequence and annotation changes that have been made to the Chromosome XII systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome XII has been updated 28 times, affecting 34 features.
- The annotation of Chromosome XII has been updated 38 times, affecting 94 features.
- Current and past versions can be obtained from SGD's Download site.
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YLR407W | 933639 | 933639 | Insertion | G | |
A single G nucleotide was inserted within the ORF YLR407W near its 3' end, altering its coding sequence. The start and vast majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now one amino acid shorter.
New 933597 AATGCAGGCTGGACGGAAACGAGAAAGTGGGCTAATGCTGCCAAGGGCATGCCATGACTG 933656 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 933596 AATGCAGGCTGGACGGAAACGAGAAAGTGGGCTAATGCTGCCAA-GGCATGCCATGACTG 933654 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR402W | 924691 | 924691 | Insertion | G | |
A single G nucleotide was inserted within the ORF YLR402W near its 5' end, necessitating a change in annotation to a downstream start codon. The sequence change makes the longer version of the protein no longer possible in the reference sequence. The stop and reading frame remain the same, but the annotated protein is now 108 amino acids shorter, less than half its original size.
New: 924657 TTAAGTCTCTTCATCCCGTGTACTATTACCCGACAGGTTTCTGCGGCATGTTCTGTGGAA 924716 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old: 924657 TTAAGTCTCTTCATCCCGTGTACTATTACCCGACA-GTTTCTGCGGCATGTTCTGTGGAA 924715 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLL054C | 32902 | 32902 | Insertion | A | |
A single nucleotide was inserted very near the 3' end of ORF YLL054C, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 74 amino acids longer.
New 32881 AATTGTGGATTGTTTAATTTTGATGTGAACGAAAAGGACTTATCCCTTCCCATACCCCAT 32940 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 32881 AATTGTGGATTGTTTAATTTTG-TGTGAACGAAAAGGACTTATCCCTTCCCATACCCCAT 32939 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR313C | 760764 | 760764 | Insertion | CC | |
A GG dinucleotide was inserted within the ORF SPH1/YLR313C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 131 amino acids shorter.
New 760738 CTTGAACATCATTCAAAATGCCCTGCCTGCCATAGGAAGAACAACCATTGATTTACTCTC 760797 ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 760740 CTTGAACATCATTCAAAATGCCCTG--TGCCATAGGAAGAACAACCATTGATTTACTCTC 760797 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR314C | 762846 | 762846 | Substitution | A | T |
Nucleotide change(s) in the coding region of CDC3/YLR314C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 431 is now Glutamine rather than Leucine.
New 762828 TGTAAAGTTTTTTCTTCTTGTTGTTTAGATATTGGATCGAACTCTTTGAAAACTGAATTATCTTGCTTAA 762897 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Old 762828 TGTAAAGTTTTTTCTTCTAGTTGTTTAGATATTGGATCGAACTCTTTGAAAACTGAATTATCTTGCTTAA 762897 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR318W | 767026 | 767027 | Substitution | TC | CT |
Nucleotide change(s) in the coding region of EST2/YLR318W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 162 is now Alanine rather than Valine.
New 766978 AAATCGTGGGTAACAGATGTAACGAACCTCATCTGCCGCCCAAATGGGCTCAACGATCATCCTCATCATC 767047 |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old 766978 AAATCGTGGGTAACAGATGTAACGAACCTCATCTGCCGCCCAAATGGGTCCAACGATCATCCTCATCATC 767047 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR024C, YLR025W | 193483 | 193483 | Substitution | A | C |
A single nucleotide substitution was made in the intergenic region between ORFs UBR2/YLR024C and SNF7/YLR025W.
New 193439 ATTGAAAGTATGAATGCGTTGATTATTGGGTTTCTCCCCACAGCTGTACATTGACGATGC 193498 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 193440 ATTGAAAGTATGAATGCGTTGATTATTGGGTTTCTCCCCACAGATGTACATTGACGATGC 193499 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR023C, YLR024C | 187423 | 187423 | Deletion | A | |
187394 | 187394 | Deletion | A | |||
Two separate single nucleotide deletions were made in the intergenic region between ORFs IZH3/YLR023C and UBR2/YLR024C.
New 187381 ACCTTATCCATCAA-CACTTTCTCCATTTCCTGCAGGGTAAAA-AGAAAAGTGAAGTCAC 187438 |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| Old 187380 ACCTTATCCATCAAACACTTTCTCCATTTCCTGCAGGGTAAAAAAGAAAAGTGAAGTCAC 187439 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR412C-A, YLR412W | 949230 | 949230 | Insertion | C | |
A single nucleotide insertion was made in the intergenic region bewteen ORFs BER1/YLR412W and YLR412C-A.
New 949197 TCATTCACTACATAGTACTTTATAACTAAACTGTAACCTTTCAGGGCATCGTAACCTGAC 949256 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 949195 TCATTCACTACATAGTACTTTATAACTAAACTGTAA-CTTTCAGGGCATCGTAACCTGAC 949253 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR346C, YLR347C | 822958 | 822958 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs YLR346C and KAP95/YLR347C.
New 822948 TCAGCAGGTGCGGCTGTGCCTTTTCACTTTCAGCTAAGATGTTTGCAAGCAAGAATTAACAGATAAGCCG 823017 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 822948 TCAGCAGGTGC-GCTGTGCCTTTTCACTTTCAGCTAAGATGTTTGCAAGCAAGAATTAACAGATAAGCCG 823016 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR451W, YLR452C | 1038769 | 1038769 | Deletion | C | |
A single nucleotide deletion was made in the intergenic region between ORFs LEU3/YLR451W and SST2/YLR452C.
New 1038716 TTTTAATGAATGAATTTGCGTTCAATCCCAAGGTTTAAAGTCCTTTTCTTTTTTTG-CGTAATGTTTACT 1038784 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 1038713 TTTTAATGAATGAATTTGCGTTCAATCCCAAGGTTTAAAGTCCTTTTCTTTTTTTGCCGTAATGTTTACT 1038782 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR449W, YLR450W | 1032533 | 1032533 | Deletion | G | |
A single nucleotide deletion was made in the intergenic region between ORFs FPR4/YLR449W and HMG2/YLR450W.
New 1032527 GTTATAGTAA-GACACTTCAGTGAGAAATTAATCTGACTTACTTTTACTTAATTGTGTTCTTTCCAAATT 1032595 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 1032523 GTTATAGTAAGGACACTTCAGTGAGAAATTAATCTGACTTACTTTTACTTAATTGTGTTCTTTCCAAATT 1032592 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR447C, YLR448W | 1028607 | 1028607 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs VMA6/YLR447C and RPL6B/YLR448W.
New 1028577 TAACCTGGACTTGCCGTGCTAAGTCGGCCTTCTAGGCTGCGCTTCCGTTCAGCATCGTTT 1028636 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 1028574 TAACCTGGACTTGCCGTGCTAAGTCGGCCTTCTA-GCTGCGCTTCCGTTCAGCATCGTTT 1028632 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR024C | 192416 | 192416 | Substitution | C | T |
A single nucleotide substitution was made within ORF UBR2/YLR024C. Note that the protein sequence was not changed.
New 192359 TCTTCTAAAGCCTTCGTTATTGAGATTGCATATTCAACCGGTGTATTCAAAATTCTTGTTATTGTAGATG 192428 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 192360 TCTTCTAAAGCCTTCGTTATTGAGATTGCATATTCAACCGGTGTATTCAAAATTCTCGTTATTGTAGATG 192429 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR034C | 210771 | 210771 | Substitution | A | T |
A single nucleotide substitution was made within ORF SMF3/YLR034C. Note that the protein sequence was not changed.
New 210719 ATGAACAACCATCAACTTTCTATTTGCGGTAAAATAAATTAAAGGAGCGGATACGATTGGTAAAATTAAG 210788 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 210720 ATGAACAACCATCAACTTTCTATTTGCGGTAAAATAAATTAAAGGAGCGGAAACGATTGGTAAAATTAAG 210789 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR162W-A, YLR163C | 491154 | 491154 | Deletion | C | |
A single nucleotide deletion was made in the intergenic region between ORFs RRT15/YLR162W-A and MAS1/YLR163C.
New 491099 TGAAGAGGTAGGTACATATTCATTGGCAGATATTCTACAATGCAATTATTATGA-CCAATCACACAGTAT 491167 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 491100 TGAAGAGGTAGGTACATATTCATTGGCAGATATTCTACAATGCAATTATTATGACCCAATCACACAGTAT 491169 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR378C, YLR380W | 878171 | 878171 | Deletion | G | |
A single nucleotide deletion was made in the intergenic region between ORFs SEC61/YLR378C and CSR1/YLR380W.
New 878158 AAATCTTGGCACTT-GTCACTTACGCTCCTTTAAACAAAATCAAACATACAAATATACGG 878216 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 878157 AAATCTTGGCACTTGGTCACTTACGCTCCTTTAAACAAAATCAAACATACAAATATACGG 878216 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR277C, YLR278C | 699963 | 699963 | Substitution | G | A |
A single nucleotide substitution was made in the intergenic region between ORFs YSH1/YLR277C and YLR278C.
New 699948 AAAAAAAAAAAAAAGGAATGAGTTTGTACATACTATTATATTAATGTAGTATCACGTTAAAAAGCCGTAG 700017 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 699950 AAAAAAAAAAAAAGGGAATGAGTTTGTACATACTATTATATTAATGTAGTATCACGTTAAAAAGCCGTAG 700019 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YLR309C | 750224 | 750224 | Substitution | C | T |
A single nucleotide substitution was made within ORF IMH1/YLR309C. Note that the protein sequence was not changed.
New 750178 TCACTAAATTGTTTAACTTGTTCCTCCAAGTAACTCACAGTTTTTTCCTTTTGTTTATAA 750237 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 750180 TCACTAAATTGTTTAACTTGTTCCTCCAAGTAACTCACAGTTTTCTCCTTTTGTTTATAA 750239 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2006-01-09 | YLR401C | 922648 | 922648 | Insertion | G | |
Based on the automated comparison of related fungi, Kellis et al. and Brachat et al. suggest that the stop site for YLR401C be moved 176 nt downstream. SGD confirmed the insertion of a single G nt. and have updated the systematic sequence accordingly. As a consequence of this sequence change, DUS3/YLR401C was extended on the 3' end, altering the C-terminus and increasing the size of the predicted protein from 609 to 668 amino acids.
New: 922634 ACAAATACCCATGGGGACATACCTATGAAAAA 922665 ||||||||||||||| |||||||||||||||| Old: 922634 ACAAATACCCATGGG-ACATACCTATGAAAAA 922664 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2004-02-05 | YLR205C | 553633 | 553633 | Insertion | C | |
553548 | 553548 | Insertion | G | |||
Brachat et al. 2003 predicted and confirmed the insertion of two nucleotides in Chromosome XII - a G after the G at 553548, and a C after the C at 553633. As a consequence of these sequence changes, HMX1/YLR205C was extended at the 5' end, increasing the size of the protein from 273 amino acids to 317 amino acids.
New: ACATAATAGTACGCCAGAATACCCTGTCTGTATATAAAGCCATGTCTCATGGCGATGGCC ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Old: 553498 ACATAATAGTACGCCAGAATACCCTGTCTGTATATAAAGCCATGTCTCATG-CGATGGCC 553556 New: CTGTTTGCTAGCGCCCCCACGTCAGTGGGTGAGGGTATGATTGTATTGCTACTGTCCTCC ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old: 553617 CTGTTTGCTAGCGCCCC-ACGTCAGTGGGTGAGGGTATGATTGTATTGCTACTGTCCTCC 553675 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. | ||||||
2004-02-04 | YLR389C | 899751 | 899751 | Insertion | T | |
Brachat et al. 2003 predicted and confirmed the insertion of a single T nucleotide in YLR389C. As a consequence of this sequence change, YLR389C was extended at the 3' end, increasing the size of the predicted protein from 988 amino acids to 1027 amino acids.
Query: GCTCTTTGTTTTCCACTTGAGATTTCAAATGTAGAATCAACTTCGATGCGTTCTCGCTCA ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 899741 GCTCTTTGTTT-CCACTTGAGATTTCAAATGTAGAATCAACTTCGATGCGTTCTCGCTCA 899799 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. | ||||||
2004-02-04 | YLR312C-B, YLR313C | 760763 | 760764 | Deletion | CC | |
Roemer et al confirmed the deletion of two C nucleotides in SPH1/YLR313C in an S288C strain background. As a consequence of this sequence change, SPH1/YLR313C was extended at the 3' and merged with an adjacent ORF, YLR312C-B, that was in the same frame. This change increased the size of the Sph1p from 530 amino acids to 661 amino acids. Roemer et al also confirmed other laboratory strain backgrounds, such as W303-derived strains, do have the additional two nucleotides and encode the shorter protein.
New: CTTGAACAATTTTGATTTAGAGGCTTGAACATCATTCAAAATGCCCTG--TGCCATAGGA |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 760715 CTTGAACAATTTTGATTTAGAGGCTTGAACATCATTCAAAATGCCCTGCCTGCCATAGGA 760774 Roemer T, et al. (1998) The Spa2-related protein, Sph1p, is important for polarized growth in yeast. J Cell Sci 111 ( Pt 4)():479-94. | ||||||
2001-06-12 | YLR312W-A | 759511 | 759511 | Insertion | C | |
Inserted one C nucleotide after the C at chromosomal coordinate 759511. This insertion is in the intron of YLR312W-A and therefore does not affect YLR312W-A translation.
Old: 759481 TGGAAAATAGCATGATGTTTATATCGCGTTC-TTGCGGAGACCCGTTACTGCTTTGAACT 759539 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| New: 759481 TGGAAAATAGCATGATGTTTATATCGCGTTCCTTGCGGAGACCCGTTACTGCTTTGAACT 759540 Kitakawa M, et al. (1997) Identification and characterization of the genes for mitochondrial ribosomal proteins of Saccharomyces cerevisiae. Eur J Biochem 245(2):449-56. | ||||||
1997-07-30 | YLR028C | 199680 | 199680 | Insertion | T | |
A single T nucleotide was inserted before the T at chromosomal coordinate 199680 within the ORF ADE16/YLR028C. At the same time this sequence change was made, the stop site for YLR028C was moved downstream 110 nucleotides.
New: 199649 CTTTACACCAGACTGCACAGCTCTATAAACGTTGTCTGGGAAGGGAAAGAACGCATCGGA 199708 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Old: 199649 CTTTACACCAGACTGCACAGCTCTATAAACGT-GTCTGGGAAGGGAAAGAACGCATCGGA 199707 ''Note that this ORF is on the Crick strand, which is complementary to the sequence shown above.'' |
Annotation Changes without sequence changes
Date | Affected Features |
---|