Difference between revisions of "Chromosome XI History"
(→Sequence Changes) |
(→Sequence Changes) |
||
Line 631: | Line 631: | ||
|- style="height:30px; width:30px; text-align:center;" | |- style="height:30px; width:30px; text-align:center;" | ||
− | | | + | | 2008-06-03 |
| [https://www.yeastgenome.org/locus/YKL052C YKL052C] | | [https://www.yeastgenome.org/locus/YKL052C YKL052C] | ||
| 340150 | | 340150 | ||
Line 645: | Line 645: | ||
'''Prelich G''' (2008) <br> | '''Prelich G''' (2008) <br> | ||
[https://www.yeastgenome.org/reference/S000126589 SGD paper] | [https://www.yeastgenome.org/reference/S000126589 SGD paper] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | rowspan="2"| 2005-12-15 | ||
+ | | rowspan="2"| [https://www.yeastgenome.org/locus/YKL137W YKL137W] | ||
+ | | 185979 | ||
+ | | 185979 | ||
+ | | Deletion | ||
+ | | A | ||
+ | | | ||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 185988 | ||
+ | | 185988 | ||
+ | | Deletion | ||
+ | | A | ||
+ | | | ||
+ | |- | ||
+ | | || colspan="6" | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. (2003) suggest that the start site for YKL137W be moved 26 nt upstream. SGD has confirmed the deletion of the A at 185979 and the deletion of the A at 185988. As a consequence, YKL137W was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 103 amino acids to 111 amino acids. | ||
+ | <pre>New: ATGGAGCAAAACAAAGA-TCCGCAGA-TGATCTCGAAACATAGTTCTAGGCTACCTATAT | ||
+ | ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| | ||
+ | Old: 185962 ATGGAGCAAAACAAAGAATCCGCAGAATGATCTCGAAACATAGTTCTAGGCTACCTATAT 186021</pre> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2005-12-15 | ||
+ | | [https://www.yeastgenome.org/locus/YKL099C YKL099C] | ||
+ | | 255410 | ||
+ | | 255410 | ||
+ | | Insertion | ||
+ | | | ||
+ | | A | ||
+ | |- | ||
+ | | || colspan="6" | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. (2003) suggest that the stop site for YKL099C be moved 19 nt upstream. SGD has confirmed the insertion of an A after the A at 255410. As a consequence, YKL099C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 256 amino acids to 250 amino acids. | ||
+ | <pre>New: CTAACGTTTCCGTTGTTTCTTCCATTTAAATGAAATTTTTCCTGAAGAGTCTACGATTTT | ||
+ | ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | ||
+ | Old: 255366 CTAACGTTTCCGTTGTTTCTTCCATTTAAATGAAATTTTTCCTGA-GAGTCTACGATTTT 255424</pre> | ||
+ | '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] |
Revision as of 12:26, 1 October 2019
This page lists all sequence and annotation changes that have been made to the Chromosome XI systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome XI has been updated 79 times, affecting 53 features.
- The annotation of Chromosome XI has been updated 39 times, affecting 55 features.
- Current and past versions can be obtained from SGD's Download site.
Contents
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | YKL198C | 68315 | 68315 | Deletion | C | |
69325 | 69326 | Substitution | TG | CT | ||
69494 | 69494 | Deletion | G | |||
69501 | 69501 | Insertion | C | |||
Five nucleotide changes were made within the ORF PTK1/YKL198C, altering its coding sequence: one single insertion, two single deletions, and two substitutions. The start and majority of the reading frame remain the same, but a small section of the annotated protein sequence is now different, the C-terminus has changed, and the annotated protein is now 13 amino acids longer.
New 68277 GACCAAGCTGTTGACAATGTTCAGATGGTGATGCAC-TACCCTGTGCGGGGAGTGGCCAC 68335 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 68279 GACCAAGCTGTTGACAATGTTCAGATGGTGATGCACCTACCCTGTGCGGGGAGTGGCCAC 68338 New 69296 TACAAAACTTTTCTGCTAGGGCCACGCTGCGCCAGCCCGATTTTTGTATCATCGCGAACA 69355 |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Old 69299 TACAAAACTTTTCTGCTAGGGCCACGTGGCGCCAGCCCGATTTTTGTATCATCGCGAACA 69358 New 69476 TGATAAACTCCTTTG-AGCAGCGCTTGTAGAATTTCTCGGGCGTTTCATTATAGATCATA 69534 ||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| Old 69479 TGATAAACTCCTTTGGAGCAGCG-TTGTAGAATTTCTCGGGCGTTTCATTATAGATCATA 69537 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL157W | 158179 | 158179 | Deletion | G | |
A single G nucleotide was deleted within ORF APE2/YKL157W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids longer.
New 158153 CTATTACTTCGAAAGCGCAGT-GGGTTAACAGAGACCGTGATGTCGTCAACAAGTATTTG 158211 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 158158 CTATTACTTCGAAAGCGCAGTGGGGTTAACAGAGACCGTGATGTCGTCAACAAGTATTTG 158217 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR028W | 496923 | 496923 | Insertion | G | |
A single G nucleotide was inserted within the ORF SAP190/YKR028W near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 65 amino acids shorter.
New 497254 ATATCAAGCGATGAAGAAGACTCCGAAGATGAAGATGAAGAGAATGATATGGGCAATGAG 497313 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Old 496897 ATATCAAGCGATGAAGAAGACTCCGAA-ATGAAGATGAAGAGAATGATATGGGCAATGAG 496955 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL129C | 197105 | 197106 | Substitution | CG | GC |
199353 | 199353 | Insertion | T | |||
199359 | 199359 | Insertion | T | |||
199377 | 199378 | Substitution | AT | TA | ||
199368 | 199368 | Insertion | T | |||
Three nucleotides were inserted within the ORF MYO3/YKL129C, and a dinucleotide substitution was also made in the same region, altering the MYO3 coding sequence. A silent dinucleotide substitution was also made within the ORF. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
New 197091 TGTGCAGCGGTAGCTGCCAAAGATAACGGATTCACAGGTTTTTGCGAAGGGAGAGGTTGC 197150 ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 197090 TGTGCAGCGGTAGCTCGCAAAGATAACGGATTCACAGGTTTTTGCGAAGGGAGAGGTTGC 197149 New 199311 ACTAAACCAATGGTTCTCATAGCCTCTAACGTGCCTTCGTAATCTTTTACGTCATCAATT 199370 |||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| Old 199310 ACTAAACCAATGGTTCTCATAGCCTCTAACGTGCCTTCGTAATC-TTTACG-CATCAATT 199367 New 199371 GTATCTGCAGTAGTACAGCCAGCCGCAGCAGTGTAAATATATTGCTCAGGCATTTGCACA 199430 | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 199368 G-ATCTGCAGATGTACAGCCAGCCGCAGCAGTGTAAATATATTGCTCAGGCATTTGCACA 199426 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR012C | 463468 | 463468 | Substitution | G | T |
463435 | 463435 | Substitution | G | T | ||
Nucleotide change(s) in the coding region of YKR012C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 98 is now Lysine rather than Glutamine, and residue 109 is now Lysine rather than Glutamine.
New 463774 CTCTATATGTAATGTTTTTGAAACATAGACGTCGTTCAAAGGCAATGCTTTTGATCTTTG 463833 |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| Old 463417 CTCTATATGTAATGTTTTGGAAACATAGACGTCGTTCAAAGGCAATGCTTTGGATCTTTG 463476 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL134C | 190415 | 190415 | Insertion | T | |
190409 | 190409 | Insertion | T | |||
190408 | 190408 | Insertion | T | |||
190405 | 190405 | Insertion | G | |||
190404 | 190404 | Insertion | T | |||
190397 | 190397 | Insertion | A | |||
189367 | 189367 | Insertion | T | |||
189339 | 189339 | Deletion | A | |||
Six single nucleotides were inserted near the middle of ORF OCT1/YKL134C, and one nucleotide was inserted and another deleted near its 3' end, altering the OCT1 coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein is now one amino acid longer and two separate small sections of the protein sequence are now different.
New 189292 CTCGAAAAGGGCGTACCAGATTTTAGAAGCTATCGTCCTATC-AAATAAGTAGCTGTAAT 189350 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 189297 CTCGAAAAGGGCGTACCAGATTTTAGAAGCTATCGTCCTATCAAAATAAGTAGCTGTAAT 189356 New 189351 AAGTTGCCCCGTATCCAAATAAATGGCCGAATCTTCCACACCAATTACTCTGATCGTCCA 189410 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 189357 AAGTTGCCCCG-ATCCAAATAAATGGCCGAATCTTCCACACCAATTACTCTGATCGTCCA 189415 New 190371 TTAACGTCAAAATAAAATCTTGAACATCTTTCGGATTCTTTGCCATTTTACCTTCCAATT 190430 |||||||||||||||||||||| ||||||| | ||| | |||||| |||||||||||||| Old 190376 TTAACGTCAAAATAAAATCTTG-ACATCTT-C-GAT-C-TTGCCA-TTTACCTTCCAATT 190429 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR036C | 509993 | 509994 | Substitution | CG | GC |
Nucleotide change(s) in the coding region of CAF4/YKR036C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 94-95 are now QR rather than HG.
New 510334 GTTGGGTAGCGGGTATCGCTGCTCATCTAAATGAGCAAGTATTCTGAAAGTTGTTGCAGA 510393 ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 509976 GTTGGGTAGCGGGTATCCGTGCTCATCTAAATGAGCAAGTATTCTGAAAGTTGTTGCAGA 510035 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL133C | 192315 | 192316 | Substitution | AT | TA |
Nucleotide change(s) in the coding region of YKL133C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 252 is now Tyrosine rather than Isoleucine.
New 192291 TCTTTTAGAGTTTAAATGCATTTGGTAGTCAGGTTTGGATTTACCAATAAATGGTAGACC 192350 ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 192290 TCTTTTAGAGTTTAAATGCATTTGGATGTCAGGTTTGGATTTACCAATAAATGGTAGACC 192349 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL023W | 393438 | 393439 | Substitution | CG | GC |
Nucleotide change(s) in the coding region of YKL023W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 25-26 are now QQ rather than HE.
New 393754 GATGACAGTATTGATAGCCAAAAAAGATGCGTCACGGATCAGCAGGCCTACTCTAATTGG 393813 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 393397 GATGACAGTATTGATAGCCAAAAAAGATGCGTCACGGATCACGAGGCCTACTCTAATTGG 393456 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL221W | 7131 | 7132 | Substitution | CG | GC |
Nucleotide change(s) in the coding region of MCH2/YKL221W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 342 is now Alanine rather than Arginine.
New 7090 GGCCATGTGGATACCTTGTAAAAATTTGGCCACTGCGATAGCTTTTGGATTATTGGTTGG 7149 |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 7091 GGCCATGTGGATACCTTGTAAAAATTTGGCCACTGCGATACGTTTTGGATTATTGGTTGG 7150 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR090W | 610650 | 610650 | Substitution | C | G |
Nucleotide change(s) in the coding region of PXL1/YKR090W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 688 is now Serine rather than Threonine.
New 610964 CATGGAAGCTCTCTTGAAGGAAGGTATCGACAATGCTACATCAAGCAATGATAAGAACAA 611023 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 610606 CATGGAAGCTCTCTTGAAGGAAGGTATCGACAATGCTACATCAACCAATGATAAGAACAA 610665 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL101W | 253006 | 253007 | Substitution | AT | TA |
Nucleotide change(s) in the coding region of HSL1/YKL101W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1482 is now Threonine rather than Serine.
New 253354 AATGCATCTACGGTAATTACTGTAAAAAAAAGAAGCAAACATTCAAACACAAGTTCCAAT 253413 |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Old 252998 AATGCATCATCGGTAATTACTGTAAAAAAAAGAAGCAAACATTCAAACACAAGTTCCAAT 253057 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR008W | 453012 | 453012 | Substitution | T | A |
Nucleotide change(s) in the coding region of RSC4/YKR008W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 390 is now Lysine rather than Isoleucine.
New 453334 ACTGAACCCAAACAACTTCAAAAAGTTAATAGCCAAACCGGAAACAGTGCAATCCGAAGT 453393 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old 452977 ACTGAACCCAAACAACTTCAAAAAGTTAATAGCCATACCGGAAACAGTGCAATCCGAAGT 453036 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL065C | 316656 | 316656 | Substitution | C | T |
Nucleotide change(s) in the coding region of YET1/YKL065C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 16 is now Methionine rather than Valine.
New 316964 TACGGATCCGGAATGGCAAAGGCAAAACGAAGATGAAGAGCATTACCATCTCAACAGTGA 317023 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 316608 TACGGATCCGGAATGGCAAAGGCAAAACGAAGATGAAGAGCATTACCACCTCAACAGTGA 316667 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR021W | 479596 | 479596 | Substitution | C | T |
A single nucleotide substitution was made within ORF ALY1/YKR021W. Note that the protein sequence was not affected.
New 479914 TAACTCTTTGTCACCTCATACCTTCATATCTGATTTGTTTACAAAAACATTCAGTAATAG 479973 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old 479557 TAACTCTTTGTCACCTCATACCTTCATATCTGATTTGTTCACAAAAACATTCAGTAATAG 479616 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | TEL11L, TEL11L-XC | 395 | 395 | Deletion | A | |
A single nucleotide deletion was made within TEL11L, specifically within X element core sequence TEL11L-XC.
New 361 CACATATACTTACCCTACCACTCTAATCCCACCA-CACATCACATGCCATACTCACCTTC 419 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 361 CACATATACTTACCCTACCACTCTAATCCCACCAACACATCACATGCCATACTCACCTTC 420 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR096W, YKR097W | 630275 | 630275 | Insertion | T | |
630274 | 630274 | Insertion | T | |||
630168 | 630168 | Insertion | G | |||
630159 | 630159 | Insertion | C | |||
Four nucleotides were inserted within the intergenic region between ORFs YKR096W and PCK1/YKR097W.
New 630504 GCACTTGGGCAGAGCCCCCACCCAGGGCCTTGTCGGAAAAAATCGGAATATCCCACACGA 630563 |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| Old 630146 GCACTTGGGCAGAG-CCCCACCCA-GGCCTTGTCGGAAAAAATCGGAATATCCCACACGA 630203 New 630624 TACATCTCTTTTCTTTTTTTGACTCACAATAGGAAAAAACCGAGCTTCCTTTCATCCGGC 630683 ||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| Old 630264 TACATCTCTTT-C-TTTTTTGACTCACAATAGGAAAAAACCGAGCTTCCTTTCATCCGGC 630321 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL041W, YKL042W | 359604 | 359604 | Insertion | G | |
A single nucleotide insertion was made in the intergenic region between ORFs SPC42/YKL042W and VPS24/YKL041W.
New 359914 ATCGCTTTTGACGATATAGTACTAGCAATCTGCGGTTCCAATGGAATGGCGTAAACGCAT 359973 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 359558 ATCGCTTTTGACGATATAGTACTAGCAATCTGCGGTTCCAATGGAAT-GCGTAAACGCAT 359616 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR094C | 618236 | 618237 | Substitution | GA | AG |
A dinucleotide substitution was made within the intron of ORF RPL40B/YKR094C.
New 618574 TAAACTCAGAAGCTTGCCGCAGGTAATAGTTTTTCTCAATTGCTACTTGTTTAATAAATT 618633 |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 618216 TAAACTCAGAAGCTTGCCGCGAGTAATAGTTTTTCTCAATTGCTACTTGTTTAATAAATT 618275 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL055C | 335190 | 335190 | Substitution | C | T |
A single nucleotide substitution was made within ORF OAR1/YKL055C. Note that the protein sequence was not affected.
New 335504 TGGTTCCATTTCTGCAGCTAAAACTTCTGTAAATCTGGACAGTGCGGCTTTAGAGGCGGA 335563 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 335148 TGGTTCCATTTCTGCAGCTAAAACTTCTGTAAATCTGGACAGCGCGGCTTTAGAGGCGGA 335207 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL042W, YKL043W | 357929 | 357929 | Substitution | T | C |
A single nucleotide substitution was made in the intergenic region between ORFs PHD1/YKL043W and SPC42/YKL042W.
New 358244 GCGTCGTGGTTGGTGAACCTGGTACAAAATAAATAAAAAAACACCTGCTAAAAAATATCA 358303 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 357888 GCGTCGTGGTTGGTGAACCTGGTACAAAATAAATAAAAAAATACCTGCTAAAAAATATCA 357947 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKR009C, YKRCdelta8 | 457775 | 457775 | Substitution | C | T |
A single nucleotide substitution was made in the intergenic region between ORF FOX2/YKR009C and Ty1 LTR YKRCdelta8.
New 458084 CTCTTCATACATATAAATGTTGCAATAAAAATCAACTAATATCTATGTTGTCATATTGAG 458143 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 457727 CTCTTCATACATATAAATGTTGCAATAAAAATCAACTAATATCTATGTCGTCATATTGAG 457786 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL128C, YKL129C | 200382 | 200382 | Insertion | GTTTACCTTTAGTTAGAAAAGCGAT GGAGCTAGCATCTTGCTACTATATA ATAGTTGTTCAAGATCGTAGGTCTG CCTGCCGAGTGATTAGGGGAGGCTA CTGAAGTTTGTTTTAATGTACCGGT TACATTTTCTTGTACGAAAGTATAT GAAGGGGGCTTATTACTTCCAAGCC TATATTTTCTGTGGCATCGATTAGT ATAGTATAAAAGAGGGAGTGGACAT AGCGGTGAAAACTATACAAGAATAA AAAAGGAACTAAGAACCCTTTGCAT TCATATAATTTCACATATGCATTTT TTATTTTATACTCAAATGTATGTTC TCACCTAGCTTGAGAAAGCGATGAT CA | |
A 352-nucleotide insertion was made in the intergenic region between ORFs MYO3/YKL129C and PMU1/YKL128C.
New 200331 TTTCCTTTTTCGGTAAAGCTCTTCCCGAGGTTTATTATATAAATGCAAATCGATCA 200386 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 200327 TTTCCTTTTTCGGTAAAGCTCTTCCCGAGGTTTATTATATAAATGCAAATCGATCA 200382 New 200387 GTTTACCTTTAGTTAGAAAAGCGATGGAGCTAGCATCTTGCTACTATATAATAGT 200441 New 200442 TGTTCAAGATCGTAGGTCTGCCTGCCGAGTGATTAGGGGAGGCTACTGAAGTTTGTTTTA 200501 New 200502 ATGTACCGGTTACATTTTCTTGTACGAAAGTATATGAAGGGGGCTTATTACTTCCAAGCC 200561 New 200562 TATATTTTCTGTGGCATCGATTAGTATAGTATAAAAGAGGGAGTGGACATAGCGGTGAAA 200621 New 200622 ACTATACAAGAATAAAAAAGGAACTAAGAACCCTTTGCATTCATATAATTTCACATATGC 200681 New 200682 ATTTTTTATTTTATACTCAAATGTATGTTCTCACCTAGCTTGAGAAAGCGATGATCA 200738 New 200739 AAGTGAAAGGTTCAACCATTTCTCAAAGTGCTTAACACATTATTTGAAAAGAAAG 200793 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 200383 AAGTGAAAGGTTCAACCATTTCTCAAAGTGCTTAACACATTATTTGAAAAGAAAG 200437 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL104C, YKL105C | 242811 | 242811 | Substitution | T | A |
A single nucleotide substitution was made in the intergenic region between ORFs YKL105C and GFA1/YKL104C.
New 243154 AAGGAGAAGTGATAGTAGAAAGACGGATGGGAGGCTGGGGGACGAAGAGAAAGTAAAAGG 243213 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 242798 AAGGAGAAGTGATTGTAGAAAGACGGATGGGAGGCTGGGGGACGAAGAGAAAGTAAAAGG 242857 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL219W, YKL220C | 14462 | 14462 | Insertion | GG | |
12941 | 12941 | Deletion | G | |||
A single nucleotide deletion and a dinucleotide insertion were made in the intergenic region between ORFs FRE2/YKL220C and COS9/YKL219W.
New 12900 TATCCGAACAGTAAACGTTTGTCCGTAGTCATCGTGACTG-TTGACGTATTAACTGCAAG 12958 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old 12901 TATCCGAACAGTAAACGTTTGTCCGTAGTCATCGTGACTGGTTGACGTATTAACTGCAAG 12960 New 14449 CGCCCGCTTGGCGGCTTTTTCTTTCCGACTATATAAATGCAAATAGTCAGAAGTTGTAAC 14508 |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 14451 CGCCCGCTTGGC--CTTTTTCTTTCCGACTATATAAATGCAAATAGTCAGAAGTTGTAAC 14508 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL216W, YKL217W | 24801 | 24801 | Deletion | G | |
A single nucleotide deletion was made within the intergenic region between ORFs JEN1/YKL217W and URA1/YKL216W.
New 24779 TGAGGTCATTCCCTAACCTTGG-ATCCAAGTCAATCTGGTATCTTCCCACCCTAAATAGT 24837 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 24779 TGAGGTCATTCCCTAACCTTGGGATCCAAGTCAATCTGGTATCTTCCCACCCTAAATAGT 24838 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL198C, YKL201C | 67956 | 67956 | Deletion | A | |
A single nucleotide deletion was made within the intergenic region between ORFs MNN4/YKL201C and PTK1/YKL198C.
New 67918 CGTGCACCGCATCAAATTTTCTCGGAGGATTCTTTGC-GCCGGTTTTCATTTTCTTCCAC 67976 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 67919 CGTGCACCGCATCAAATTTTCTCGGAGGATTCTTTGCAGCCGGTTTTCATTTTCTTCCAC 67978 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL197C, YKL198C | 70683 | 70683 | Deletion | A | |
70487 | 70487 | Deletion | A | |||
Two separate single nucleotide deletions were made in the intergenic region between ORFs PTK1/YKL198C and PEX1/YKL197C.
New 70435 AAAAAAGCGTATAGGTGCTAAGAAGAATTAAGTATCAAAAGGTAGCAGG-CATTTATGTT 70493 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 70438 AAAAAAGCGTATAGGTGCTAAGAAGAATTAAGTATCAAAAGGTAGCAGGACATTTATGTT 70497 New 70664 TAATAAGCAACGTGC-GCCGCATTTTTTGCCCTTTAAAGGGAAACGCGCTTTGTTCTTTT 70722 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 70668 TAATAAGCAACGTGCAGCCGCATTTTTTGCCCTTTAAAGGGAAACGCGCTTTGTTCTTTT 70727 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YKL156W | 158690 | 158690 | Insertion | A | |
A single nucleotide insertion was made within the intron of ORF RPS27A/YKL156W.
New 158642 GCAACTGGACCAGTGAATAGAACAATACATATAGATAAGTCGCAAAAAGAAAAGAATACA 158701 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 158648 GCAACTGGACCAGTGAATAGAACAATACATATAGATAAGTCGC-AAAAGAAAAGAATACA 158706 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2008-06-03 | YKL052C | 340150 | 340150 | Substitution | A | T |
Greg Prelich's lab demonstrated a sequence error at coordinate 340150 on Chromosome XI within ASK1/YKL052C: on Watson strand the A should be a T. This is nucleotide 41 of the Crick strand ASK1/YKL052C, and changes Val14 to Asp. The error was verified in S288C-derivative strain FY4.
New: 50 ATTTCTTGATCAAGTTTTTCCAATGTTTCCTCTTTGCTTGCAGAATCCAT 1 ||||||||| |||||||||||||||||||||||||||||||||||||||| Old: 340141 ATTTCTTGAACAAGTTTTTCCAATGTTTCCTCTTTGCTTGCAGAATCCAT 340190 Prelich G (2008) | ||||||
2005-12-15 | YKL137W | 185979 | 185979 | Deletion | A | |
185988 | 185988 | Deletion | A | |||
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. (2003) suggest that the start site for YKL137W be moved 26 nt upstream. SGD has confirmed the deletion of the A at 185979 and the deletion of the A at 185988. As a consequence, YKL137W was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 103 amino acids to 111 amino acids.
New: ATGGAGCAAAACAAAGA-TCCGCAGA-TGATCTCGAAACATAGTTCTAGGCTACCTATAT ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| Old: 185962 ATGGAGCAAAACAAAGAATCCGCAGAATGATCTCGAAACATAGTTCTAGGCTACCTATAT 186021 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. | ||||||
2005-12-15 | YKL099C | 255410 | 255410 | Insertion | A | |
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. (2003) suggest that the stop site for YKL099C be moved 19 nt upstream. SGD has confirmed the insertion of an A after the A at 255410. As a consequence, YKL099C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 256 amino acids to 250 amino acids.
New: CTAACGTTTCCGTTGTTTCTTCCATTTAAATGAAATTTTTCCTGAAGAGTCTACGATTTT ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old: 255366 CTAACGTTTCCGTTGTTTCTTCCATTTAAATGAAATTTTTCCTGA-GAGTCTACGATTTT 255424 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. |