Chromosome X History

This page lists all sequence and annotation changes that have been made to the Chromosome X systematic reference sequence since its intial release on 1996-07-31.

• The sequence of Chromosome X has been updated 106 times, affecting 81 features.
  
• The annotation of Chromosome X has been updated 31 times, affecting 65 features.
  
• Current and past versions can be obtained from SGD's Download site.

Sequence Changes

Date	Affected Features	Start Coordinate of Change	End Coordinate of Change	Type of Change	Old Sequence	New Sequence
2011-02-03	YJR103W	622414	622414	Insertion		C
	A single C nucleotide was inserted very near the 3' end of ORF URA8/YJR103W, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 14 amino acids longer. New 622379 GAAGGTGCTGGAACCATCAAGACCGTTTTGGGGGCTTGTGGCCGCAGCCTCCGGCACACT 622438 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 622368 GAAGGTGCTGGAACCATCAAGACCGTTTTGGGGGCTTGTGGCCGCAG-CTCCGGCACACT 622426 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL171C	99777	99778	Substitution	CG	GC
		99767	99767	Substitution	G	C
		99792	99793	Substitution	AA	TT
	Nucleotide changes within the coding region of YJL171C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 366 is now Lysine rather than Leucine, residue 371 is now Alanine rather than Arginine, and residue 374 is now Lysine rather than Asparagine. New 99757 ATACACCGTTTTGCATCTTCGTTAAAGCAACACCATTCGACTTCGAGGTGGTCGAAGGCG 99816 |||||||||||||||| ||||||||| ||||||||||||| ||||||||||||||||| Old 99751 ATACACCGTTTTGCATGTTCGTTAAACGAACACCATTCGACAACGAGGTGGTCGAAGGCG 99810 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR107W	627524	627525	Substitution	CC	GG
		627367	627369	Substitution	CCT	TCC
	Nucleotide change(s) in the coding region of YJR107W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 14 is now Proline rather than Leucine, and residue 66 is now Glycine rather than Proline. New 627368 TGCCCATCACTCCATATATCTATGAGCGTCTAGTATATTTCTTCAACGACGGAGGTTGTC 627427 |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| Old 627357 TGCCCATCACCCTATATATCTATGAGCGTCTAGTATATTTCTTCAACGACGGAGGTTGTC 627416 New 627488 CACCACATATTAACTTCTGCAATGATGAGATAATTAACCCAACAGCGGGTCAAACAGTGG 627547 ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 627477 CACCACATATTAACTTCTGCAATGATGAGATAATTAACCCAACAGCGCCTCAAACAGTGG 627536 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR098C	613918	613918	Insertion		T
		613905	613905	Insertion		T
		613904	613904	Insertion		T
	Three nucleotides were inserted near the middle of ORF YJR098C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed. New 613899 TAAAAAAGTTGGTTTCTTTAGTGAAAATAGTTTTATTCCACATCACATCATCTCCAAACC 613958 |||||||||||||| | ||||||||||||| ||||||||||||||||||||||||||||| Old 613891 TAAAAAAGTTGGTT-C-TTAGTGAAAATAG-TTTATTCCACATCACATCATCTCCAAACC 613947 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL015C	407437	407437	Insertion		A
	A single nucleotide was inserted within the ORF YJL015C very near its 5' end, necessitating a change in annotation to a downstream start codon. The sequence change makes the longer version of the protein no longer possible in the reference sequence. The stop and reading frame remain the same, but the annotated protein is now 30 amino acids shorter. New 407400 TAAACTTTTTCGTTTAACGTGACGCATGGTGCGAAGAAAAAAAAATAGCAAATCGCCACT 407459 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 407394 TAAACTTTTTCGTTTAACGTGACGCATGGTGCGAAGAAAAAAAA-TAGCAAATCGCCACT 407452 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL130C	171996	171997	Substitution	CG	GC
	Nucleotide changes within the coding region of URA2/YJL130C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 123 is now Alanine rather than Arginine. New 171954 AGCTGGGATCCCTTCATTTTGTAACCATTTACCTAAGGAAGATTTAGCAAGATAATGAGA 172013 |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 171950 AGCTGGGATCCCTTCATTTTGTAACCATTTACCTAAGGAAGATTTACGAAGATAATGAGA 172009 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL128C	179435	179435	Substitution	G	C
		179433	179433	Substitution	C	G
	Nucleotide changes within the coding region of PBS2/YJL128C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 222-223 are now GL rather than AV. New 179394 TTAGTGGGCATTTTTAATGACATTCCTCCTGGTGGTAATTTGAGCCCTCGACGGGCACTT 179453 ||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| Old 179390 TTAGTGGGCATTTTTAATGACATTCCTCCTGGTGGTAATTTGACCGCTCGACGGGCACTT 179449 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR150C	709354	709354	Substitution	C	T
	A single nucleotide substitution within the coding region of DAN1/YJR150C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 115 is now Glutamic Acid rather than Glycine. New 709317 TGGAAGAAGCCTCTGTGGTAGAAGCTGGTACTGCAGTAGCAATACCTTCATTCGCAAGTG 709376 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 709307 TGGAAGAAGCCTCTGTGGTAGAAGCTGGTACTGCAGTAGCAATACCTCCATTCGCAAGTG 709366 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR149W	708354	708354	Substitution	T	A
	A single nucleotide substitution within the coding region of YJR149W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 402 is now Aspartic Acid rather than Valine. New 708347 CGCAAGATTGAAAATTGACGGAAAATAATATAAATACATATAAAAGACCTGATACTTATT 708406 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 708337 CGCAAGATTGAAAATTGTCGGAAAATAATATAAATACATATAAAAGACCTGATACTTATT 708396 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR132W	670283	670283	Substitution	T	G
	A single nucleotide substitution within the coding region of NMD5/YJR132W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 258 is now Alanine rather than Serine. New 670247 TTTTTTTGTCAGCATCATTCAGCAGCCATTGCCTCAGGAAGTTTTGGCTATATCAGATAT 670306 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 670237 TTTTTTTGTCAGCATCATTCAGCAGCCATTGCCTCAGGAAGTTTTGTCTATATCAGATAT 670296 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL179W	89005	89005	Substitution	C	A
	A single nucleotide substitution within the coding region of PFD1/YJL179W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 74 is now Aspartic Acid rather than Alanine. New 88981 CAAATACGTTAATGATTTATCACATGACGAAACTGTTCTTCTGGATCAAAGAAAAACATT 89040 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 88979 CAAATACGTTAATGATTTATCACATGCCGAAACTGTTCTTCTGGATCAAAGAAAAACATT 89038 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL164C	110920	110920	Insertion		T
		110898	110898	Deletion	T
	Nucleotide changes within the coding region of TPK1/YJL164C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 79-86 are now SGKYSLQD rather than VGSIVYKN. New 110877 TACCCAGTGTCCTTAATATCTGAAAGT-CTTGTAAACTATACTTCCCACTTGTAACTCTC 110935 ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| Old 110871 TACCCAGTGTCCTTAATATCTGAAAGTTCTTGTAAACTATACTTCCCACT-GTAACTCTC 110929 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR129C	664657	664657	Substitution	G	T
	A single nucleotide substitution within the coding region of YJR129C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 118 is now Lysine rather than Threonine. New 664657 TTCCTCAATTTTGATCTTTACGTCCTCGTCAAACCTGTACCTCACGACGTCTTTCATCAT 664716 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 664647 TTCCTCAATTGTGATCTTTACGTCCTCGTCAAACCTGTACCTCACGACGTCTTTCATCAT 664706 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR106W	625480	625480	Substitution	G	A
	A single nucleotide substitution within the coding region of ECM27/YJR106W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 219 is now Asparagine rather than Aspartic Acid. New 625479 GAGCCTCAGAGAAAACTCCGTTTCTCCTTTTTTGGATGACTCTCTGATGGCTTCTGGTTT 625538 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 625467 GAGCCTCAGAGAAGACTCCGTTTCTCCTTTTTTGGATGACTCTCTGATGGCTTCTGGTTT 625526 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL011C	414287	414288	Substitution	CG	GC
	Nucleotide substitutions within the coding region of RPC17/YJL011C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 159 is now Glycine rather than Alanine. New 414280 TACACTCATGCGTAGCCAGAGATGATCTCTAGCATTTCCTCAATTGTTTTTTCGTCAAAT 414339 |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 414273 TACACTCATGCGTACGCAGAGATGATCTCTAGCATTTCCTCAATTGTTTTTTCGTCAAAT 414332 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL188C, YJL189W	76241	76241	Substitution	T	C
	A single nucleotide substitution within the coding region of BUD19/YJL188C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 90 is now Cysteine rather than Tyrosine. This nucleotide change is also present in the intron of the overlapping ORF, RPL39/YJL189W, but does not change the protein coding sequence of RPL39/YJL189W. New 76201 TTTATGTCAGGTGGTATTGCCTTGGATCCGTGAATGCATCACATTGATGAGTTTGAACAT 76260 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 76200 TTTATGTCAGGTGGTATTGCCTTGGATCCGTGAATGCATCATATTGATGAGTTTGAACAT 76259 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL186W	81335	81335	Substitution	T	G
	A single nucleotide substitution within the coding region of MNN5/YJL186W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 395 is now Valine rather than Phenylalanine. New 81301 CAAGGCACTGCCGGTGAAGGTGACAAAGACACTTTCGTCGCTGCTGCCCATGCCTTGAAT 81360 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 81299 CAAGGCACTGCCGGTGAAGGTGACAAAGACACTTTCTTCGCTGCTGCCCATGCCTTGAAT 81358 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL183W	84958	84958	Substitution	G	A
	A single nucleotide substitution within the coding region of MNN11/YJL183W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 298 is now Aspartic Acid rather than Glycine. New 84911 AATCATTTTGAATATAGTTCGGCAAAGATTATCATTCCACATGATGCGGATGGTAATATT 84970 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 84909 AATCATTTTGAATATAGTTCGGCAAAGATTATCATTCCACATGATGCGGGTGGTAATATT 84968 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL172W, YJL173C	97650	97650	Insertion		G
		97583	97583	Insertion		C
		97489	97489	Substitution	C	G
		97474	97474	Substitution	A	G
		97253	97253	Insertion		G
		97250	97250	Insertion		T
	Several nucleotide changes were made in the intergenic region between ORFs RFA3/YJL173C and CPS1/YJL172W. New 97211 CAAGGGATTATAGTACCTTCGCGAGTATTGCATATAAGCTTTTAGCGATACACAAACAAA 97270 |||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| Old 97209 CAAGGGATTATAGTACCTTCGCGAGTATTGCATATAAGCTTT-AGC-ATACACAAACAAA 97266 New 97441 AGAAACACCCACTTCTAGTAGCTTTACGTGACGAATTGAACCGCGTGATCTTGTGCACTG 97500 ||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| Old 97437 AGAAACACCCACTTCTAGTAGCTTTACGTGACGAATTAAACCGCGTGATCTTCTGCACTG 97496 New 97561 CTTATCATAGCGGCCTTTTATTTTCCCCTTTGGGCAAAATACGATACAGCCTTCCAAGGT 97620 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Old 97557 CTTATCATAGCGGCCTTTTATTTTCCC-TTTGGGCAAAATACGATACAGCCTTCCAAGGT 97615 New 97621 CGGGCAAGAAAGTTTATGACATATAAAAGAAACGGGTACCCCAAATACGTCTCTTCCCAT 97680 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old 97616 CGGGCAAGAAAGTTTATGACATATAAAAGAAACGG-TACCCCAAATACGTCTCTTCCCAT 97674 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL168C, YJL169W	102642	102643	Substitution	AA	GC
		102610	102610	Substitution	A	C
		102276	102276	Substitution	C	G
	Nucleotide changes within the coding regions of overlapping ORFs YJL169W and/or SET2/YJL168C resulted in altered protein sequences for both ORFs. The start, stop, and reading frame of YJL169W remain the same, but protein residue 62 is now Alanine rather than Proline. The start, stop, and reading frame of SET2/YJL168C also remain the same, but protein residue 594 is now Alanine rather than Phenylalanine, residue 605 is now Alanine rather than Serine, and residue 716 is now Alanine rather than Glycine. New 102237 GTTGAAGGTGGAGGAGAAGACATCCTTGTTGATGCTGATGATAATGCCAACGCCTTTTTT 102296 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 102231 GTTGAAGGTGGAGGAGAAGACATCCTTGTTGATGCTGATGATAATCCCAACGCCTTTTTT 102290 New 102597 GCTTCCACTAGTTTTTTGGCCTCTTCCTTTTGTAACTCCTTCTGTTTGTTGGCCTCCGCT 102656 ||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| Old 102591 GCTTCCACTAGTTTTTTGGACTCTTCCTTTTGTAACTCCTTCTGTTTGTTGAACTCCGCT 102650 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL163C, YJL164C	111646	111646	Deletion	C
		111288	111288	Deletion	G
	Two separate single nucleotide deletions were made in the intergenic region between ORFs TPK1/YJL164C and YJL163C. New 111246 AAGCCGATTGAAAATGCAAGCAAGCCAAACAAAAAAAAAAGTATAGGG-TCAGATTCCTT 111304 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 111240 AAGCCGATTGAAAATGCAAGCAAGCCAAACAAAAAAAAAAGTATAGGGGTCAGATTCCTT 111299 New 111605 TAGCAGCACAGCTTCGAACAAGTAACTAAAAATATGTGGTGTATAC-GGTATGTAAATGT 111663 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 111600 TAGCAGCACAGCTTCGAACAAGTAACTAAAAATATGTGGTGTATACCGGTATGTAAATGT 111659 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	ARS1007, YJL162C	113842	113842	Substitution	G	A
	A single nucleotide substitution was made in the intergenic region between ARS1007 and ORF JJJ2/YJL162C. New 113814 ATTCAAATTATTTCCATCCTGGCGTAAGGACGACGGGTATATGCTCATTAAGAAGAGCGT 113873 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Old 113810 ATTCAAATTATTTCCATCCTGGCGTAAGGACGGCGGGTATATGCTCATTAAGAAGAGCGT 113869 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL095W, YJL096W	247045	247045	Insertion		G
	A single nucleotide insertion was made in the intergenic region between ORFs MRPL49/YJL096W and BCK1/YJL095W. New 247010 AAATCATGTAAATAACAATAAAATTTGACACACTTTCTTCGGCCCCAATGGCCATTCAAT 247069 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 247005 AAATCATGTAAATAACAATAAAATTTGACACACTTTCTTCG-CCCCAATGGCCATTCAAT 247063 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR001W, YJR002W	438633	438633	Insertion		A
	A single nucleotide insertion was made in the intergenic region between ORFs AVT1/YJR001W and MPP10/YJR002W. New 438599 ATTATTTCATAATCGACGAGGGGCATACTTACTCTACTTAAAATTCATTTACATTAGCTC 438658 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 438592 ATTATTTCATAATCGACGAGGGGCATACTTACTCTACTTAAA-TTCATTTACATTAGCTC 438650 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJLWtau4	422266	422266	Deletion	C
	A single nucleotide deletion was made within Ty4 LTR YJLWtau4. New 422260 TCATTAATAAAGC-TTTTTGACCTCTACCTATGAGCAATAAACCATATCCATCAATAGTG 422318 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 422253 TCATTAATAAAGCCTTTTTGACCTCTACCTATGAGCAATAAACCATATCCATCAATAGTG 422312 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJLWdelta10, YJLWtau4	422450	422450	Insertion		C
		422448	422448	Substitution	G	C
	A single nucleotide substitution and a single nucleotide insertion were made in the intergenic region between Ty4 LTR YJLWtau4 and Ty1 LTR YJLWdelta10. New 422439 CAGTAAAATACTACGCGCCTAGTATAATGACTTCTATATCCAAAATTTTTAAGTTAACCT 422498 ||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| Old 422433 CAGTAAAATACTACGGGC-TAGTATAATGACTTCTATATCCAAAATTTTTAAGTTAACCT 422491 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR108W, YJR109C	422266	422266	Substitution	T	A
	A single nucleotide substitution was made within the intergenic region between ORFs ABM1/YJR108W and CPA2/YJR109C. New 629447 GATCTACTTTTGTTCAAGATAATAATACTGGGGTAGAATATACACTAAGAAGTCTCTTTG 629506 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 629437 GATCTACTTTTGTTCAAGATAATAATACTGGGGTAGAATATACTCTAAGAAGTCTCTTTG 629496 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR107W, YJR108W	422266	422266	Deletion	T
	A single nucleotide deletion was made within the intergenic region between ORFs YJR107W and YJR108W. New 628608 TTATTCCAGTTCTCCTGGCCACTAATCCCGGCTACGC-TTTTGTTGAAATAGTATTCTTC 628666 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 628597 TTATTCCAGTTCTCCTGGCCACTAATCCCGGCTACGCTTTTTGTTGAAATAGTATTCTTC 628656 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR106W, YJR107W	627314	627314	Deletion	T
	A single nucleotide deletion was made within the intergenic region between ORFs ECM27/YJR106W and YJR107W. New 627289 ATAACAATGATGCCTGCCAGACTTTTCATACTATATC-TTTTTGTAGTACTCATGCCTGT 627347 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 627277 ATAACAATGATGCCTGCCAGACTTTTCATACTATATCTTTTTTGTAGTACTCATGCCTGT 627336 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJLWdelta1, tT(AGU)J	59471	59471	Insertion		C
	A single nucleotide insertion was made in the intergenic region between tRNA-Thr tT(AGU)J and Ty1 LTR YJLWdelta1. New 59461 GAGGCTTCGCCCATTCATTAAAGAGTATAGCTACCGCATACTGTTTAGTAGTATACTATC 59520 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 59461 GAGGCTTCGCC-ATTCATTAAAGAGTATAGCTACCGCATACTGTTTAGTAGTATACTATC 59519 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL157C, YJL158C	123314	123314	Substitution	T	C
		123309	123309	Substitution	T	C
	Two separate single nucleotide substitutions were made in the intergenic region between ORFs CIS3/YJL158C and FAR1/YJL157C. New 123294 GTATGGAATGCATAGGCGGCCCGGCCAGGCACCACGGAAAAAAGCTGATTGTCCTCTTTT 123353 ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| Old 123290 GTATGGAATGCATAGGCGGTCCGGTCAGGCACCACGGAAAAAAGCTGATTGTCCTCTTTT 123349 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL155C, YJL156C	129110	129110	Substitution	T	C
	A single nucleotide substitution was made in the intergenic region between ORFs SSY5/YJL156C and FBP26/YJL155C. New 129104 TCCGCCGCGGCGTTCTACAATTTCACTTAAAATTAGTTTGGGTAATAATTACATACAATG 129163 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 129100 TCCGCCGCGGTGTTCTACAATTTCACTTAAAATTAGTTTGGGTAATAATTACATACAATG 129159 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL008C	421510	421510	Substitution	G	A
	A single nucleotide substitution was made within ORF CCT8/YJL008C. Note that the protein sequence was not affected. New 421490 ATGGTTAACAATGATCTTGTTTCTACCACAGGGTCCCATAGAAGTCAAACACATTTGATG 421549 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Old 421483 ATGGTTAACAATGATCTTGTTTCTACCGCAGGGTCCCATAGAAGTCAAACACATTTGATG 421542 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL186W, YJL187C	79350	79350	Insertion		T
	A single nucleotide insertion was made in the intergenic region between ORFs SWE1/YJL187C and MNN5/YJL186W. New 79321 AGTAAGACCTGTTCAGTAGTAATCCTTTTTTTATTGGACTAACTGCGCAAGATGATGTGC 79380 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old 79320 AGTAAGACCTGTTCAGTAGTAATCCTTTTTT-ATTGGACTAACTGCGCAAGATGATGTGC 79378 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL185C, YJL186W	81927	81927	Substitution	A	T
	A single nucleotide substitution was made in the intergenic region between ORFs MNN5/YJL186W and YJL185C. New 81901 GGGGAGAAAAACTAATGAAGTGATTAACTATAATAATTTAATAATAACTCGCCATCCGAC 81960 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Old 81899 GGGGAGAAAAACTAATGAAGTGATTAACAATAATAATTTAATAATAACTCGCCATCCGAC 81958 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL113W, YJL114W, YJLWTy4-1	198632	198632	Deletion	G
		198588	198588	Deletion	A
	Two separate single nucleotide deletions were made within retrotransposon YJLWTy4-1, affecting Gag and Pol ORFs YJL114W and YJL113W. New 198581 AAAAACAAA-TATAGAAGTTTGCATGGTAGAGATGTCAGAATTAGAGCCTGGG-AAAAGG 198639 ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| Old 198579 AAAAACAAAATATAGAAGTTTGCATGGTAGAGATGTCAGAATTAGAGCCTGGGGAAAAGG 198638 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR154W, YJR155W	727112	727112	Substitution	C	G
	A single nucleotide substitution was made within the intergenic region between ORFs YJR154W and AAD10/YJR155W. New 727077 GTTGGGGACTGGTTAATTAATTGAATAGCTTCATAACCCACCGCCGCAAAATGTGCTCTT 727136 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 727067 GTTGGGGACTGGTTAATTAATTGAATAGCTTCATAACCCACCGCCCCAAAATGTGCTCTT 727126 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR153W, YJR154W	724992	724992	Substitution	G	T
		724284	724284	Substitution	T	G
	Two separate single nucleotide substitutions were made in the intergenic region between ORFs PGU1/YJR153W and YJR154W. New 724247 AAATGCGACTAAGTACTACAATTGAAACGAATGAGCGCACTTCATCTGCCTACAAAACGC 724306 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 724237 AAATGCGACTAAGTACTACAATTGAAACGAATGAGCGCACTTCATCTTCCTACAAAACGC 724296 New 724967 TTGTAATATGCGTTACTAGTAATTCCTTTGAATTTTTGAATGCTTTAACTGTGAGTTGGC 725026 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old 724957 TTGTAATATGCGTTACTAGTAATTCCTTTGAATTTGTGAATGCTTTAACTGTGAGTTGGC 725016 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR152W, YJR153W	722285	722285	Substitution	G	T
	A single nucleotide substitution was made within the intergenic region between ORFs DAL5/YJR152W and PGU1/YJR153W. New 722267 CCGGATATGAGTAAGAGTGATCTTGCCGTAGAGATAATAGCTGCACAAAGGCCAAGGATT 722326 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Old 722257 CCGGATATGAGTAAGAGTGATCTTGCCGGAGAGATAATAGCTGCACAAAGGCCAAGGATT 722316 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR151W-A, YJR152W	717775	717775	Substitution	G	A
		717671	717671	Substitution	C	A
	Two separate single nucleotide substitutions were made in the intergenic region between ORFs YJR151W-A and DAL5/YJR152W. New 717672 AAAAAAAAAACCAGATCTGTTGATCAGTTGTAATCGTGTAAACGAGTACAAAAGGCCAGA 717731 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Old 717662 AAAAAAAAACCCAGATCTGTTGATCAGTTGTAATCGTGTAAACGAGTACAAAAGGCCAGA 717721 New 717732 GACAGCTTCTACTCCAAGCTTAAGATACGTATACACAAAAGATTTTTACTTGAAGGAGTA 717791 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Old 717722 GACAGCTTCTACTCCAAGCTTAAGATACGTATACACAAAAGATTTTTACTTGAGGGAGTA 717781 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR151C, YJR151W-A	716502	716502	Substitution	C	A
		716149	716149	Substitution	A	T
	Two separate single nucleotide substitutions were made in the intergenic region between ORFs DAN4/YJR151C and YJR151W-A. New 716147 TTGATGTCGTCGTTCAATAGACATTCACATAACTTTACTCTACGTGCTATACGCGCTACC 716206 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Old 716137 TTGATGTCGTCGATCAATAGACATTCACATAACTTTACTCTACGTGCTATACGCGCTACC 716196 New 716497 AGTCTACATGTGACAAAAAGAAAACCCAAATACTTCTTGGCTATGAATGTTATCGTTTGA 716556 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 716487 AGTCTACATGTGACACAAAGAAAACCCAAATACTTCTTGGCTATGAATGTTATCGTTTGA 716546 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL127C-B, YJL127W-A	180996	180996	Deletion	C
	A single nucleotide deletion was made in the intergenic region between ORFs YJL127W-A and YJL127C-B. New 180954 TTCCGTGCCTGCTGCTATGCTCAAGGGGAACAGAAAAGCAACACGC-TCAAAATAGTAAT 181012 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 180950 TTCCGTGCCTGCTGCTATGCTCAAGGGGAACAGAAAAGCAACACGCCTCAAAATAGTAAT 181009 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL124C, YJL125C	187027	187027	Deletion	A
	A single nucleotide deletion was made in the intergenic region between ORFs GCD14/YJL125C and LSM1/YJL124C. New 187013 ATTGTTCCATCTCCAAA-GGCAGTTGATTAAGTGTACGGATAGGTAAAACTGAATGTGGA 187071 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 187010 ATTGTTCCATCTCCAAAAGGCAGTTGATTAAGTGTACGGATAGGTAAAACTGAATGTGGA 187069 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL115W, YJL116C	195502	195502	Insertion		C
	A single nucleotide insertion was made in the intergenic region between ORFs NCA3/YJL116C and ASF1/YJL115W. New 180954 TTCCGTGCCTGCTGCTATGCTCAAGGGGAACAGAAAAGCAACACGC-TCAAAATAGTAAT 181012 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 180950 TTCCGTGCCTGCTGCTATGCTCAAGGGGAACAGAAAAGCAACACGCCTCAAAATAGTAAT 181009 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL112W	205347	205347	Substitution	C	A
	A single nucleotide substitution was made within ORF MDV1/YJL112W. Note that the protein sequence was not affected. New 205310 AGTGAACGACCAAATAACTCATATAGGAAAAACATTGTCCACAACGGCTTCCGCTTTTTT 205369 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 205305 AGTGAACGACCAAATAACTCATATAGGAAAAACATTGTCCACCACGGCTTCCGCTTTTTT 205364 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR151C	713832	713832	Substitution	C	G
	A single nucleotide substitution was made within ORF DAN4/YJR151C. Note that the protein sequence was not affected. New 713807 CTCGAGGAAACAACGGCTGAAGTGAAAGTGGATGTGGCAGATAGACTTTCAGTAGAAGAA 713866 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old 713797 CTCGAGGAAACAACGGCTGAAGTGAAAGTGGATGTCGCAGATAGACTTTCAGTAGAAGAA 713856 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR149W, YJR150C	708438	708438	Substitution	A	T
	A single nucleotide substitution was made within the intergenic region between ORFs YJR149W and DAN1/YJR150C. New 708407 GACACAAATTTTCTGGATGACCTTTTTCTATATGATATATATACGTCGCTATTGGATCGT 708466 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 708397 GACACAAATTTTCTGGATGACCTTTTTCTATATGATATATAAACGTCGCTATTGGATCGT 708456 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2004-01-23	ARS1008	204550	204551	Substitution	GT	TG
		204535	204535	Insertion		AAT
		204533	204533	Substitution	A	T
		204519	204519	Insertion		T
	Several nucleotide changes were made within ARS1008. New 204510 ATTACACGTTTTAAATACTAATTATTAAAATTTATCCTGATAAGTTGATCTTTATTTCCG 204569 ||||||||||| ||||||||||||| || |||||||||||||| ||||||||||||| Old 204508 ATTACACGTTT-AAATACTAATTATAAA---TTATCCTGATAAGTGTATCTTTATTTCCG 204564 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2004-01-23	ARS1006	99643	99643	Deletion	A
		99634	99634	Deletion	T
		99573	99574	Deletion	TA
		99532	99532	Insertion		T
		99531	99531	Insertion		A
		99525	99525	Insertion		TT
		99469	99469	Substitution	C	G
	Several nucleotide changes were made within ARS1006. New 99421 TTGCCTTTGTTTACGAGTATATCGTTAATGTTAACGAATACGCTTAAGCGCAATGATTGA 99480 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Old 99415 TTGCCTTTGTTTACGAGTATATCGTTAATGTTAACGAATACGCTTAAGCGCAATCATTGA 99474 New 99481 ATAGTCAAAGATTTTTTTTTTTTAATTTTTTTTTTTTAATTTTTTTTTTTTTTCATAGAA 99540 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Old 99475 ATAGTCAAAGATTTTTTTTTTTTAATTTTTTTTTTTTAATTTTTTTTTTTT--CATAGA- 99531 New 99541 CTTTTTATTTAAATAAATCACGTCTATATATGTATCAGTATA--ACGTAAAAAAAAAAAC 99598 | |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 99532 C-TTTTATTTAAATAAATCACGTCTATATATGTATCAGTATATAACGTAAAAAAAAAAAC 99590 New 99599 ACCGTCAGTTAAACAAAACATAAATAAAAAAAAAAAGAAGTGT-CAAATCAA-GTGTCAA 99656 ||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| Old 99591 ACCGTCAGTTAAACAAAACATAAATAAAAAAAAAAAGAAGTGTTCAAATCAAAGTGTCAA 99650 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR138W	687982	687982	Substitution	A	G
	A single nucleotide substitution was made within ORF IML1/YJR138W. Note that the protein sequence was not affected. New 687947 AGAGAAAGAAAAAAAAGGAAGAAAAACTAAGAGAGAAGAAATACAGCCTGAAGTTATGTT 688006 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 687937 AGAGAAAGAAAAAAAAGGAAGAAAAACTAAGAGAGAAGAAATACAACCTGAAGTTATGTT 687996 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJR135C, YJR135W-A	676910	676910	Substitution	G	A
	A single nucleotide substitution was made within the intergenic region between ORFs MCM22/YJR135C and TIM8/YJR135W-A. New 676907 ATTCATTTATATGAAAGTATTGAAGAAGAGGTAAAAAGGAAAACAAATTTACAAACAACA 676966 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 676897 ATTCATTTATATGGAAGTATTGAAGAAGAGGTAAAAAGGAAAACAAATTTACAAACAACA 676956 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL177W, YJL178C	90365	90365	Substitution	A	C
	A single nucleotide substitution was made in the intergenic region between ORFs ATG27/YJL178C and RPL17B/YJL177W. New 90351 GGCGTGGGAAGTGAAGCTCTTTCGCTCTTTCTGTGATGATCTCCTTCCAGCTAGGCTCGG 90410 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 90349 GGCGTGGGAAGTGAAGATCTTTCGCTCTTTCTGTGATGATCTCCTTCCAGCTAGGCTCGG 90408 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL173C, YJL174W	96057	96057	Substitution	G	C
	A single nucleotide substitution was made in the intergenic region between ORFs KRE9/YJL174W and RFA3/YJL173C. New 96011 GGAAGGCGTTAAGGCAGCAAGTACACATTCATTTATCTATCTATACATCTATAAACACAA 96070 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 96009 GGAAGGCGTTAAGGCAGCAAGTACACATTCATTTATCTATCTATACATGTATAAACACAA 96068 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YJL156C	126896	126896	Deletion	T
	Poulsen et al. 2005 report an error in the systematic reference sequence for SSY5/YJL156C. There is an extra A in codon 685 (GAC) that should not be present in the sequence. SGD curators have corrected the sequence as necessary. Deletion of the A results in a frameshift that makes the Ssy5 protein 12 amino acids longer than previously annotated. Many thanks to Thorsten Pfirrmann for bringing this error to our attention. new: 2113 TCAAAAAGGCAAATCATCCATCTAGTTGTGGATCAATGTCCCATTGAATTTTAGTTACAG 2054 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| old: 126836 TCAAAAAGGCAAATCATCCATCTAGTTGTGGATCAATGTCCCATTGAATTTTAGTTACAG 126895 new: 2053 -CATGTAGTCTCTCCAGGATATCACCTATAGGTGTGAACAAACCAAACTGCCTCTGTTCA 1995 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| old: 126896 TCATGTAGTCTCTCCAGGATATCACCTATAGGTGTGAACAAACCAAACTGCCTCTGTTCA 126955 Poulsen, et al. (2005) Constitutive Signal Transduction by Mutant Ssy5p and Ptr3p Components of the SPS Amino Acid Sensor System in Saccharomyces cerevisiae. Eukaryot Cell 4(6):1116-24. SGD paper | PubMed | Full-Text